![]() |
|
|
Vol. 10, Issue 1, 35-46, January 1999
Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461
Submitted July 13, 1998; Accepted October 7, 1998| |
ABSTRACT |
|---|
|
|
|---|
Gp180, a duck protein that was proposed to be a cell surface receptor for duck hepatitis B virus, is the homolog of metallocarboxypeptidase D, a mammalian protein thought to function in the trans-Golgi network (TGN) in the processing of proteins that transit the secretory pathway. Both gp180 and mammalian metallocarboxypeptidase D are type I integral membrane proteins that contain a 58-residue cytosolic C-terminal tail that is highly conserved between duck and rat. To investigate the regions of the gp180 tail involved with TGN retention and intracellular trafficking, gp180 and various deletion and point mutations were expressed in the AtT-20 mouse pituitary corticotroph cell line. Full length gp180 is enriched in the TGN and also cycles to the cell surface. Truncation of the C-terminal 56 residues of the cytosolic tail eliminates the enrichment in the TGN and the retrieval from the cell surface. Truncation of 12-43 residues of the tail reduced retention in the TGN and greatly accelerated the turnover of the protein. In contrast, deletion of the C-terminal 45 residues, which truncates a potential YxxL-like sequence (FxxL), reduced the protein turnover and caused accumulation of the protein on the cell surface. A point mutation of the FxxL sequence to AxxL slowed internalization, showing that this element is important for retrieval from the cell surface. Mutation of a pair of casein kinase II sites within an acidic cluster showed that they are also important for trafficking. The present study demonstrates that multiple sequence elements within the cytoplasmic tail of gp180 participate in TGN localization.
| |
INTRODUCTION |
|---|
|
|
|---|
Duck hepatitis B virus is a member of the hepadnavirus group that
infects liver cells, causing acute and chronic hepatitis (Ganem and
Varmus, 1987
). A candidate receptor for duck hepatitis B virus was
previously described by its ability to bind to viral particles (Kuroki
et al., 1994
, 1995
). This 180-kDa protein, named gp180, was
shown to bind to the PreS envelope protein of the virus (Kuroki
et al., 1994
). The gp180-binding region within PreS overlaps key areas that have been established as important for viral infectivity (Kuroki et al., 1994
). Cloning of the cDNA for gp180
revealed that it is a member of the metallocarboxypeptidase gene family with approximately 50% amino acid identity to carboxypeptidase E
(CPE), a neuropeptide-processing enzyme (Kuroki et al.,
1995
).
CPE was originally identified as an enkephalin-producing
carboxypeptidase in secretory vesicles isolated from various
neuroendocrine tissues (Fricker, 1988
, 1991
). CPE removes the basic
amino acids that remain on the C terminus of peptide precursors after
endopeptidase processing (Fricker, 1988
, 1991
). For many years, CPE was
thought to be the only carboxypeptidase involved in the production of numerous neuroendocrine peptides; however, the recent finding that
peptide processing is substantially reduced, but not eliminated, in
mice that lack CPE activity attributable to a point mutation (Cpefat/Cpefat mice)
suggests that another carboxypeptidase is able to partially compensate
for CPE (Naggert et al., 1995
). A search for additional CPE-like enzymes turned up a 180-kDa enzyme named
metallocarboxypeptidase D (CPD) (Song and Fricker, 1995
).
Partial amino acid sequence analysis of bovine and rat CPD matched the
N terminus of gp180 that was deduced from the cDNA clone (Kuroki
et al., 1995
; Song and Fricker, 1995
, 1996
). Furthermore, both CPD and gp180 have similar tissue distributions (Kuroki et al., 1995
; Song and Fricker, 1996
; Xin et al., 1997
)
and enzymatic properties (Song and Fricker, 1995
; Eng et
al., 1998
). Finally, cloning and sequence analysis of cDNA for rat
and human CPD revealed this enzyme to be a homolog of the duck gp180
(Tan et al., 1997
; Xin et al., 1997
). Both
mammalian CPD and gp180 have three metallocarboxypeptidase domains
followed by a transmembrane domain and a cytosolic tail. Antisera to
various domains of CPD were used to confirm that the C-terminal tail of
the protein is cytosolic (Varlamov and Fricker, 1998
). In addition to
the avian and mammalian proteins, the Silver gene product of
Drosophila presumably also represents a homolog, although it
appears to contain only two carboxypeptidase domains and no
transmembrane domain (Settle et al., 1995
). The overall amino acid identity between duck gp180 and rat CPD is 75%. The highest
homology between the two proteins is the cytosolic tail; of the 58 amino acids within this region, there is only one conservative change
between the duck and rat/human sequences (Figure 1). This high degree
of conservation implies that this region performs an essential function.
The cytosolic regions of many integral membrane proteins are
involved in the compartmentalization and trafficking of the proteins (Sandoval and Bakke, 1994
; Marks et al., 1997
). For example,
the C-terminal cytosolic tails of resident TGN proteins such as TGN38, furin (an endopeptidase), and PAM (a neuropeptide-processing enzyme) are important for their TGN localization and their trafficking to and
from the cell surface (Luzio et al., 1990
; Tausk et
al., 1992
; Bos et al., 1993
; Humphrey et
al., 1993
; Wong and Hong, 1993
; Bosshart et al., 1994
;
Molloy et al., 1994
; Schafer et al., 1995
).
Recently, endogenous CPD in AtT-20 cells was shown to be localized in
the TGN and to cycle to and from the cell surface (Varlamov and
Fricker, 1998
). In the present study, we examined the role of the
cytosolic tail of CPD/gp180 using gp180 constructs expressed in AtT-20
cells. Mutations within the gp180 tail identified regions and sequence
elements that are involved in TGN retention and retrieval. Some of
these sequence elements are similar to those found in furin, PAM, and
TGN38; however, the activity of these elements differs between the
proteins. Important elements for the TGN retention and retrieval of
gp180 from the cell surface include an FxxL sequence, which resembles a
YxxL motif, and casein kinase II (CKII) sites within an acidic cluster
of residues.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Recombinant DNA Procedures
For the construction of a gp180-expressing vector, a 4.2-kb NcoI fragment encoding the gp180 cDNA was first inserted into a modified version of the plasmid pVL1392L (PharMingen, San Diego, CA) to introduce a consensus Kozak sequence that includes the initiating ATG of gp180. pVL1392L was created by inserting the double-stranded linker GGCCGCGCCATGGCTTAAGTGAGGTAATCTAG into the NotI and XbaI sites of its polylinker. The linker contains an NcoI site (underlined). The initiating ATG of gp180 is encoded within one end of the 4.2-kb NcoI fragment. Incorporation of the fragment in the correct orientation introduces the Kozak sequence and generated the plasmid pVL180. Gp180 and the Kozak sequence were then excised from pVL180 as a 4.2-kb NotI-XbaI fragment and ligated into the vector pcDNA3 (Invitrogen, San Diego, CA), resulting in the gp180 expression vector p180X.
Deletion mutations indicated in Figure 1 were constructed using PCR.
Tailored fragments (60-190 nucleotides) spanning the transmembrane/lumenal border to the deletion site within the
cytoplasmic tail were obtained using AmpliTaq polymerase (Perkin
Elmer-Cetus, Norwalk, CT) and oligonucleotide primers. Primers
corresponding to regions within the cytoplasmic domain incorporated an
AflII site followed by a stop codon and an XbaI
site. The AflII site would code for an additional two amino
acids (LK) at the C terminus of each deletion mutant. The
56 mutant
has the additional residues SD at its C terminus. The primer
corresponding to the transmembrane/lumenal border incorporated a native
XhoI site. PCR products were purified using a PCR
purification kit (Qiagen, Hilden, Germany) and then digested with
XhoI and XbaI for 3 h. Substitution of the
XhoI-XbaI fragment of p180X resulted in plasmids
encoding gp180 with C-terminal truncations of its cytoplasmic domain.
To construct the point mutations indicated in Figure 1, a small 230-nucleotide XhoI-XbaI fragment that encompasses the transmembrane and cytoplasmic domain was first ligated into the vector pAlter (Promega, Madison, WI) at its SmaI/XbaI sites, resulting in the plasmid pAlt-Tail. The XhoI end of the 230-bp fragment had been blunt-ended with Klenow before ligation. Fusion of the blunt-ended XhoI site with the SmaI site regenerates the XhoI site. The pAlt-Tail plasmid was used as the template for mutagenesis. Point mutations were made using Quik-Change Mutagenesis kit (Stratagene, La Jolla, CA) following the manufacturer's instructions. Briefly, complementary oligonucleotide pairs incorporating the respective mutations in the middle of each oligonucleotide were used with Pfu polymerase (Stratagene) to replicate the pAlt-Tail plasmid, introducing the mutation. After replication, the reaction was digested with DpnI, an enzyme that cleaves only the methylated DNA template plasmid. The remaining uncleaved replicated plasmids were then transformed into Escherichia coli. Mutations were screened by DNA sequence analysis. XhoI-XbaI fragments from the mutated pAlt-Tail plasmids were then ligated into the gp180 expression vector p180X, substituting the nonmutated XhoI-XbaI fragment of p180X for the mutant. All plasmids were confirmed by sequence analysis of the modified region.
Cells and Media
AtT-20 cells and stable transfectants were cultivated in DMEM
(Life Technologies, Gaithersburg, MD) supplemented with 10% fetal
bovine serum, 100 U penicillin, and 100 µg/ml streptomycin at 37°C
in 5% CO2. To establish stable transfectants, AtT-20 cells (approximately 40% confluent in a 100 mm dish) were transfected with
10 µg of linearized DNA using the calcium phosphate method (Davis
et al., 1986
). Approximately 16-18 h after transfection, cells were washed three times with phosphate-buffered saline (PBS) and
then incubated with DMEM. On the following day, cells were trypsinized,
replated into three 100 mm dishes, and cultivated for 24 h. Media
(DMEM) containing G418 (650 µg/ml) was then used to cultivate cells
and select for stable transfectants. Single clones were screened by
Western analysis. Clones selected for further analysis were checked for
expression levels by labeling with [35S]Met for 15 min
followed by immunoprecipitation with anti-gp180 antiserum. Only those
clones that expressed levels of the transfected protein that were
within two- to threefold of the level of transfected full-length gp180
were used for subsequent studies. In some studies, cells were treated
for the indicated time with 100 µg/ml cycloheximide or with lysosomal
protease inhibitors (100 µg/ml leupeptin, 100 µg/ml E-64, 100 µg/ml pepstatin A, and 2 mM methionine methyl ester).
Antibodies
Polyclonal anti-gp180 antiserum was raised in rabbits using only
the 170-kDa lumenal domain of gp180, which had been generated from a
recombinant protein expressed in the baculovirus system. Polyclonal
anti-CPD rabbit antiserum was raised using CPD purified from rat brain,
as described previously (Song and Fricker, 1996
). Texas Red-labeled
anti-rabbit immunoglobulin G (IgG) and fluorescein-labeled anti-mouse
IgG were obtained from Vector Laboratories (Burlingame, CA). A
monoclonal antibody to syntaxin 6 was obtained from Dr. Richard
Scheller (Stanford University), and a monoclonal antibody to LAMP-1 was
obtained from the Developmental Studies Hybridoma Bank (University of Iowa).
Pulse-Chase Analysis
Cells grown to 90% confluence on 12-well plates (Falcon; Becton Dickinson, Lincoln Park, NJ) were washed twice with PBS and once with methionine-free DMEM. The cells were then starved of methionine by incubating in methionine-free DMEM for 1 h at 37°C. Cells were metabolically labeled (pulsed) with DMEM containing [35S]Met (100 µCi/ml) for 15 min at 37°C. The pulse was quenched by placing the plates on ice and washing four times with cold PBS. Pulse-labeled cells in replicate plates were chased for different periods at 37°C in complete DMEM. Cell pellets were solubilized in lysis buffer (50 mM Tris 7.4, 150 mM NaCl, 1% Triton X-100, and 1% deoxycholate). Proteins containing the lumenal domain of gp180 were immunoprecipitated with anti-gp180 antibodies (1:500) and protein A Sepharose (35 µl) overnight at 4°C. The protein A Sepharose beads were then washed three times with lysis buffer. Bound proteins were eluted from the beads by heating at 95°C for 5 min in gel loading buffer containing 0.1% SDS and then subjected to denaturing PAGE (SDS-PAGE). The gel was fixed in 30% methanol and 10% acetic acid, soaked in Fluoro-hance (Research Products International, Mt. Prospect, IL), dried, and then subjected to autoradiography at -80°C.
Immunofluorescence Microscopy
Cells (stable transfectants) were grown on growth-supporting glass coverslips (Fisher Scientific, Houston, TX) in either 6- or 12-well plates. In some studies, cells were treated with cycloheximide (100 µg/ml) for 2 h or with brefeldin A (10 µg/ml) before immunostaining. Before fixation, cells were washed twice with DMEM and once with PBS. Cells were fixed for 10 min in 4% paraformaldehyde in PBS and then washed with PBS. Cells were permeabilized with 0.1% Triton X-100 in PBS for 15 min, washed with PBS, and then blocked with 5% bovine serum albumin (BSA) in PBS for 1 h. For LAMP-1 staining, cells were additionally fixed with ice-cold methanol for 2 min after the paraformaldehyde fixation. In analyses for steady-state distribution, cells were immunostained for 1 h with primary antisera diluted in 5% BSA in PBS (anti-gp180; 1:2500). Unbound antibodies were removed by washing with 0.2% Tween-20 in PBS (3 × 5 min) and PBS (1 × 5 min). To detect bound antibodies, Texas Red-conjugated goat anti-rabbit IgG (1:200, diluted in 5% BSA) was added and incubated in the dark for 1 h. Unbound antibodies were removed by washing as described above, and then the coverslips were mounted on glass slides with Prolong antifade reagent (Molecular Probes, Eugene, OR). Representative single plane of focus images were obtained with a Bio-Rad (Bio-Rad, Hercules, CA) confocal microscope.
Antibody Internalization
Cells were grown on glass coverslips in 12-well plates. For continuous uptake of antisera, cells were incubated for 1 h with anti-gp180 antiserum (1:500) in DMEM supplemented with 20 mM HEPES, pH 7.4, and 2 mg/ml BSA. For experiments examining the time course of antisera uptake, cells were washed three times with ice-cold DMEM and then incubated on ice for 1 h with anti-gp180 antiserum (1:250) in DMEM supplemented with HEPES and BSA. Unbound antiserum was removed by washing four times with cold PBS, and the cells were then incubated for various times at 37°C in DMEM supplemented with HEPES and BSA. At the indicated time points, the plates were placed on ice, and the cells were washed with cold PBS. Cells were fixed, permeabilized with Triton X-100, and stained with fluorescently labeled secondary antibodies.
| |
RESULTS |
|---|
|
|
|---|
The Cytoplasmic Domain of Gp180 Contains Essential Information for Both Its Retrieval from the Cell Surface and Its Steady-State Accumulation in the TGN
In a previous study, endogenous CPD in AtT-20 cells was found to
be localized in the TGN and to traffic between this compartment and the
cell surface (Varlamov and Fricker, 1998
). To establish an experimental
system that could examine the potential role of the cytoplasmic domain
in the localization of CPD/gp180 to the TGN, we first assessed whether
duck gp180 can be used as a reporter construct in AtT-20 cells.
Immunofluorescence labeling of permeabilized AtT-20 cells stably
transfected with gp180 cDNA shows a juxtanuclear staining pattern with
a gp180-specific antiserum (Figure 2, row 2). This distribution is
similar to that observed for endogenous CPD in AtT-20 cells using an
antiserum specific for rodent CPD (Figure 2, row 1). The antiserum
raised against duck gp180 does not recognize the endogenous mouse CPD
or any other protein in the wild-type AtT-20 cells (Figure 2, row 3).
This specificity of detection permits gp180 constructs to be analyzed
in the presence of endogenous CPD in AtT-20 cells.
To determine whether the juxtanuclear staining of gp180 in AtT-20 cells
reflects localization to the TGN, the cells were treated with brefeldin
A before staining with an antiserum to gp180. Brefeldin A causes a
redistribution of Golgi but not TGN proteins from the juxtanuclear
compartment and releases
-COP from Golgi membranes to the
cytoplasm (Fujiwara et al., 1988
; Lippincott-Schwartz
et al., 1989
; Reaves and Banting, 1992
). Treatment of AtT-20
cells expressing full-length gp180 with brefeldin A for 30 min had
little effect on the juxtanuclear staining of gp180 (our unpublished results), as previously found for endogenous CPD (Varlamov and Fricker,
1998
) and furin (Molloy et al., 1994
). This result suggests that the juxtanuclear staining of gp180 in transfected AtT-20 cells is
not Golgi but a post-Golgi compartment such as the TGN.
To determine whether gp180 was expressed on the cell surface and could be recycled to the TGN, gp180-expressing AtT-20 cells were incubated with antiserum at 4°C for 1 h, washed with cold PBS to remove unbound antiserum, and then incubated at 37°C for 1 h. Cells were subsequently permeabilized and then labeled with fluorescently tagged secondary antiserum. Antiserum to gp180 was internalized to a juxtanuclear compartment (Figure 2, row 2). The distribution of the internalized antiserum to gp180 was generally similar to the distribution of internalized antiserum to rodent CPD in wild-type AtT-20 cells (Figure 2, row 1). In contrast, only background staining was observed with the anti-gp180 antiserum in wild-type AtT-20 cells (Figure 2, row 3), which further demonstrates the specificity of this antiserum for the duck protein.
To determine whether the cytoplasmic domain contains information
for TGN localization and trafficking of gp180, a deletion mutant was
constructed removing 56 of the 58 residues of the cytoplasmic domain
(Figure 1). Upon expression in AtT-20
cells, the
56 mutant shows a diffuse distribution throughout the
cell, with some accumulation near the cell perimeter that is suggestive
of cell surface localization (Figure 2,
row 4). In antiserum uptake experiments, cells expressing the
56
mutant show a pattern that resembles cell surface staining, suggesting
that this mutant enzyme is not retrieved from the cell surface. Thus,
the cytoplasmic domain is important for this enzyme's enrichment in
the TGN and retrieval from the cell surface.
|
|
Effect of Cycloheximide on Cytoplasmic Domain Deletion Mutants
A series of deletion mutations that results in the successive
shortening of the cytoplasmic domain from its C terminus were incorporated into the gp180 construct (Figure 1). Stable transfectants expressing similar levels of these mutant constructs were analyzed. The
steady-state staining pattern for all of the deletion mutants showed
some juxtanuclear staining (Figure 3, and
our unpublished results). Costaining of the cells with an antibody to
syntaxin 6, which has been previously localized to the TGN (Bock
et al., 1997
), showed substantial colocalization with gp180.
The
12 to
43 deletion mutants also showed colocalization with
syntaxin 6, with some additional distribution beyond the syntaxin 6 distribution (Figure 3). The
45 deletion mutant showed a broad
distribution that had partial overlap with syntaxin 6 (Figure 3).
|
To determine whether the juxtanuclear staining represented only newly
synthesized proteins, a blockade on protein synthesis was introduced by
treating cells with cycloheximide for 2 h. The juxtanuclear
staining of full-length gp180 remains relatively unchanged as compared
with untreated cells (Figure 3, CHX). In contrast, cells expressing the
12 mutant show a reduction in juxtanuclear staining after the
cycloheximide treatment. The
24 mutant shows an even greater
reduction of staining after cycloheximide treatment, whereas the
33,
36, and
43 mutants show virtually no staining above background
after this treatment (Figure 3, and our unpublished results). After
CHX, the
45 deletion mutant shows diffuse staining (Figure 3). These
results suggest that newly synthesized mutant proteins are reduced in
their capacity to be retained in a juxtanuclear compartment and further
suggests that the cellular half-lives of the
12 to
43 mutants,
but not the
45 mutant, are decreased.
Pulse-Chase Analysis with [35S]Met
To examine the half-lives of gp180 and the mutant proteins, a
pulse-chase analysis was performed (Figure
4). Stable transfectants expressing the
various proteins were pulsed in media containing [35S]Met
for 15 min and then chased in basal media for the indicated time
(Figure 4). Proteins were isolated by immunoprecipitation. The amount
of full-length gp180 detected after the 2-h chase period remained
relatively unchanged. The molecular weight increase of the gp180
protein detected between pulse and chase times has been observed for
endogenous CPD in AtT-20 cells (Varlamov and Fricker, unpublished
observations). In comparison to full-length gp180, the
12 mutant
exhibits some reduction in half-life, and the
24,
33,
36, and
43 mutants show an even greater reduction in half-life (Figure
4). The
45 mutant was more stable than the
43 mutant (Figure 4), consistent with the studies of CHX-treated cells (Figure 3). Quantitation of the results from two separate experiments showed
that the half-life of the
24,
33,
36, and
43 mutants was
70-90 min, the
12 mutant was 120 min, the
45 mutant was approximately 6 h, and full-length gp180 had a half-life >7
h. Inspection of the media from the 2 h chase for the
33
and
43 mutants revealed no immunoreactive material,
indicating that the half-life reduction is not caused by secretion or
cell surface shedding.
|
Point Mutations in the CKII Sites
The deletion analysis indicated that a sequence present within the
C-terminal 12 residues is important for the relatively long half-life
of gp180. This region of gp180 contains an acidic cluster with
potential CKII phosphorylation sites in positions -11 and -13 (Figure
1). These CKII sites were mutated (TDT to ADA), destroying the
potential for CKII-dependent phosphorylation. The intracellular
localization of the ADA mutant shows strong juxtanuclear staining in
addition to punctate staining throughout the cell body (Figure
5, top). The juxtanuclear staining showed partial overlap with the distribution of the TGN marker syntaxin 6 (Figure 5). When cells expressing the ADA mutant were exposed to gp180
antiserum continuously for 1 h, the internalized antiserum showed
a juxtanuclear distribution that overlapped with the distribution of
syntaxin 6 (Figure 5). In addition to this juxtanuclear staining, there
was also diffuse punctate staining throughout the cell body that did
not overlap with syntaxin 6. Similar results were found with the
24
mutant, whereas the full-length gp180 showed more complete overlap with
syntaxin 6 (Figure 5). To examine the time course of the
internalization, cells were incubated with antiserum at 4°C, the
antiserum was removed, and then the cells were incubated at 37°C for
the indicated time (Figure 6). These
experiments showed that the ADA mutant is internalized from the cell
surface within 5 min; however, after 120 min of uptake the antiserum is
not detected above background levels (Figure 6), which is similar to
the results with the
12,
24, and
43 deletions (Figure 6, and
our unpublished results).
|
|
To test whether the CKII sites are responsible for the shorter
half-life of the
12 deletion mutant, pulse-chase analysis with
[35S]Met was performed. The ADA mutant was more
stable (t1/2 = 4 h) than the
12 mutant
(t1/2 = 2 h), but considerably less stable than the full-length gp180 (t1/2 > 7 h).
This finding indicates that the CKII sites within the cytoplasmic tail
of gp180 contribute to the routing or retention of the protein and that
deletion of this motif leads to increased degradation.
FHRL Is Required for Cell Surface Retrieval and Targeting to the TGN
The dramatic difference in half-life between the
43 and the
45 constructs suggested an important element in this region. The
45 deletion mutant lacks the RL of the FHRL sequence as well as all
of the amino acids C-terminal of it (Figure 1). The sequence FHRL
within the gp180/CPD cytoplasmic domain resembles the tyrosine-based retrieval sequence YxxL seen in numerous transmembrane proteins (Sandoval and Bakke, 1994
; Marks et al., 1997
). To examine
whether the FHRL sequence is important for retrieval, a point mutation was constructed to convert the phenylalanine to an alanine. At steady
state this AHRL mutant displayed juxtanuclear staining that
substantially overlaps the distribution of syntaxin 6 (Figure 5). When
cells expressing the AHRL mutant were continuously labeled with
antiserum to gp180 for 1 h, this antiserum was largely
internalized to a juxtanuclear compartment that partially overlaps with
the syntaxin 6-containing compartment (Figure 5). In addition, the internalized AHRL mutant shows a diffuse punctate pattern that does not
overlap with syntaxin 6 (Figure 5).
To examine the timecourse of the internalization of the AHRL mutant, cells were exposed to antiserum at 4°C, and then the antiserum was removed and the cells were incubated at 37°C for various times. In these experiments, cell surface staining is seen after 5 min of internalization, indicating an impairment in internalization compared with full-length gp180 (Figure 6); however at 30 min, a punctate staining pattern is seen throughout the cell. After 2 h of incubation, more of the internalized antiserum is concentrated in a juxtanuclear region. These results show that the FHRL sequence is required for efficient internalization from the cell surface to the TGN.
Pulse-chase analysis with [35S]Met was performed to examine whether the FHRL motif played a role in the stability of the protein. The AHRL point mutant was stable for the first 2 h of the chase; however, longer chase periods showed it to have a half-life of approximately 5 h (not shown), which is shorter than that for full-length gp180, which has a half-life of >7 h. This result suggests that the FxxL motif is an important determinant of the routing or retention of gp180 and that mutation of this motif leads to increased degradation.
Colocalization of
24 Mutant with a Lysosomal Marker
To examine whether the deletion mutants are targeted to lysosomes,
cells expressing either the
24 mutant or full-length gp180 were
treated with lysosomal protease inhibitors and CHX. Although the 2-h
CHX treatment without lysosomal protease inhibitors eliminated staining
for the
24 mutant (Figure 3), in the presence of lysosomal protease
inhibitors a punctate pattern of staining is observed (Figure
7). The distribution of the
24 mutant
in the CHX-treated cells shows substantial overlap with the
distribution of LAMP-1 (Figure 7), a lysosomal marker (Fukuda, 1991
).
In contrast, full-length gp180 shows only partial overlap with the
LAMP-1 distribution (Figure 7), consistent with the predominant
localization of gp180 to the TGN.
|
| |
DISCUSSION |
|---|
|
|
|---|
A major finding of the present study is the identification of
motifs involved in the retention and trafficking of CPD/gp180. The
[35S]Met pulse-chase analysis (Figure 4) revealed
that two distinct regions of the cytoplasmic tail of gp180 play a large
role in the half-life of the protein. One domain present in the
C-terminal 12 residues appeared to be important for preventing the
degradation of gp180, either by retention in the TGN or by retrieval
from the endosomal-lysosomal pathway. Point mutations of the CKII
sites within this region resembled the
12 deletion mutant,
suggesting that these CKII sites contribute to the trafficking and
retention of gp180. The other domain, present in the
43 construct
but absent from the
45 construct, has a positive effect on the
turnover of gp180 because deletion of this domain (i.e., the
45
construct) resulted in a longer half-life. A point mutation of the
YxxL-like sequence (FxxL) in this region showed that the aromatic
residue of this sequence contributes to the routing and retention of gp180.
The finding that the gp180/CPD cytoplasmic domain is essential for TGN
localization and trafficking is consistent with previous studies on
other TGN proteins (Luzio et al., 1990
; Tausk et
al., 1992
; Bos et al., 1993
; Wong and Hong, 1993
;
Bosshart et al., 1994
; Molloy et al., 1994
;
Sandoval and Bakke, 1994
; Schafer et al., 1995
; Marks
et al., 1997
). Although some sequence elements within the
cytoplasmic domains are similar between gp180/CPD and other TGN
proteins, the activity of individual elements to promote TGN
localization and retrieval differ. For TGN38, the retrieval sequence
YQRL was found to be important for TGN localization and retrieval (Bos
et al., 1993
; Humphrey et al., 1993
; Wong and
Hong, 1993
). For furin, the sequence YKGL can internalize the protein from the cell surface into endosomes but is not sufficient for retrieval back to the TGN (Schafer et al., 1995
). Instead,
furin has an acidic cluster containing CKII sites that can
independently mediate both TGN retrieval and retention (Jones et
al., 1995
; Schafer et al., 1995
; Voorhees et
al., 1995
). The internalization activity of both sequence elements
suggests their cooperation in the retrieval into endosomes, but the
subsequent delivery to the TGN requires an additional sorting step
mediated by the acidic cluster of furin. In the present study, we have
shown that the sequence (FHRL) of CPD/gp180 is important for the
efficient internalization and retrieval to the TGN as demonstrated by
the impaired retrieval of the AHRL point mutant (Figure 6). This mutant
also demonstrates that the CPD/gp180 acidic region does not efficiently
and independently mediate retrieval to the TGN, as does the acidic
region of furin.
The CKII sites in CPD/gp180 are similar to sites found in PAM and
furin (SESEEE in PAM, SDSEED in furin, and TDTEEE in CPD/gp180). All
three of these sequences have two phosphorylatable residues separated
by a single amino acid within a larger acidic-rich region and are
located near the C terminus. Thus, it is tempting to speculate that
this sequence similarity might represent functional similarity. Although deletion of the CKII sites and surrounding acidic cluster of
PAM did not alter the trafficking of this protein (Milgram et
al., 1996
), deletion of this region of furin affects uptake of the
protein to the TGN (Jones et al., 1995
; Voorhees et
al., 1995
). Recently, a protein designated PACS-1 has been shown
to interact with the cytosolic tail of furin when the CKII sites are
phosphorylated (Wan et al., 1998
). Furin with alanine
substitutions in the CKII sites was detected in the tips of the AtT-20
cell processes (Dittie et al., 1997
). In some experiments,
we found a small amount of staining of the CPD/gp180 ADA mutant in the tips of the cells. Although it is possible that this represents a small amount of sorting into mature secretory vesicles, there are
examples of nonregulated pathway proteins that have been detected in
the tips of AtT-20 cell processes (Matsuuchi and Kelly, 1991
; Song and
Fricker, 1997
). Further studies are needed to examine whether the
CPD/gp180 with mutated CKII sites enters mature secretory vesicles.
In addition to the YxxL-like motif and the CKII sites within the acidic cluster, it is likely that other motifs within the tail of CPD/gp180 are involved in the routing of this protein. Additional domains within the C-terminal tail are predicted from the extremely high conservation of the entire tail among human, rat, and duck. Inspection of the sequence reveals additional motifs that have been previously reported to function in the trafficking of other proteins, such as the di-leucine sequence. CPD/gp180 also contains a di-methionine that may be related to the di-leucine sequence. It is also possible that additional sequences will be found that affect the interaction of transmembrane proteins with cytosolic proteins.
The finding that gp180 is transiently expressed on the cell surface is
consistent with previous studies that suggested but did not clearly
establish its expression on the cell surface (Kuroki et al.,
1995
; Varlamov and Fricker, 1998
). Our finding further supports the
potential role for gp180 as a receptor for duck hepatitis B virus. The
internalization of gp180 from the cell surface of AtT-20 cells and also
of primary duck hepatocytes (our unpublished observations)
suggests that viral entry could proceed through an endocytic pathway.
In support of this possibility, it has been shown that infection with
duck hepatitis B virus requires endocytosis (Kock et al.,
1996
); however, the expression of gp180 alone in hepatoma cell lines is
not sufficient for productive virus infection even though the virus is
internalized (Breiner et al., 1998
), indicating that other
cellular factors are required to reconstruct the viral entry pathway as
has been shown for the human immunodeficiency virus (Feng et
al., 1996
).
CPD/gp180 functions in the processing of proteins in the secretory
pathway. Based on the broad pH optimum of CPD/gp180 between pH 5 and 7 (Song and Fricker, 1995
; Eng et al., 1998
), the enzyme will
be catalytically active in multiple compartments within both the
secretory and endocytic pathways as well as when exposed on the cell
surface. A recent analysis of gp180 revealed that the first two
carboxypeptidase-like domains are enzymatically active, but not the
third carboxypeptidase-like domain (Eng et al., 1998
). Because the third domain is highly conserved between distant species (82% amino acid identity between rat CPD and duck gp180), it is likely
that this region has a biological function. Analysis of the predicted
active site amino acids of CPD/gp180 suggests that the third domain
will bind but not cleave peptides (Eng et al., 1998
).
Recently, we have shown that the third domain binds the duck hepatitis
B virus (Eng et al., 1998
). Taken together with the results
of the present study, the possibility that CPD/gp180 functions in the
transport of molecules in endocytic and exocytic pathways should be considered.
| |
ACKNOWLEDGMENTS |
|---|
Confocal microscopy was performed in the Analytical Imaging Facility of the Albert Einstein College of Medicine. Antibodies to syntaxin 6 were generously provided by Dr. Richard Scheller and Jason Bock (Stanford University). This work was supported primarily by National Institutes of Health grant DK-51271 and also by Research Scientist Development Award DA-00194. The DNA sequencing facility of the Albert Einstein College of Medicine is supported in part by Cancer Center grant CA-13330.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: fricker{at}aecom.yu.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
N. B. Lubben, D. A. Sahlender, A. M. Motley, P. J. Lehner, P. Benaroch, and M. S. Robinson HIV-1 Nef-induced Down-Regulation of MHC Class I Requires AP-1 and Clathrin but Not PACS-1 and Is Impeded by AP-2 Mol. Biol. Cell, September 1, 2007; 18(9): 3351 - 3365. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Marion, G. B. Fralish, S. Laporte, M. G. Caron, and L. S. Barak N-terminal Tyrosine Modulation of the Endocytic Adaptor Function of the beta-Arrestins J. Biol. Chem., June 29, 2007; 282(26): 18937 - 18944. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Saunders, J. P. C. Ting, J. Meisner, B. W. Neuman, M. Perez, J. C. de la Torre, and M. J. Buchmeier Mapping the Landscape of the Lymphocytic Choriomeningitis Virus Stable Signal Peptide Reveals Novel Functional Domains J. Virol., June 1, 2007; 81(11): 5649 - 5657. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Nielsen, M. Madsen, H. J. Moller, and S. K. Moestrup The macrophage scavenger receptor CD163: endocytic properties of cytoplasmic tail variants J. Leukoc. Biol., April 1, 2006; 79(4): 837 - 845. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Meulendyke, M. A. Wurth, R. O. McCann, and R. E. Dutch Endocytosis Plays a Critical Role in Proteolytic Processing of the Hendra Virus Fusion Protein J. Virol., October 15, 2005; 79(20): 12643 - 12649. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Nair, B. E. Schaub, K. Huang, X. Chen, R. F. Murphy, J. M. Griffith, H. J. Geuze, and J. Rohrer Characterization of the TGN exit signal of the human mannose 6-phosphate uncovering enzyme J. Cell Sci., July 1, 2005; 118(13): 2949 - 2956. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. W. Wisner and D. C. Johnson Redistribution of Cellular and Herpes Simplex Virus Proteins from the Trans-Golgi Network to Cell Junctions without Enveloped Capsids J. Virol., November 1, 2004; 78(21): 11519 - 11535. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fayad, V. Levesque, J. Sirois, D. W. Silversides, and J. G. Lussier Gene Expression Profiling of Differentially Expressed Genes in Granulosa Cells of Bovine Dominant Follicles Using Suppression Subtractive Hybridization Biol Reprod, February 1, 2004; 70(2): 523 - 533. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. V. Kalinina and L. D. Fricker Palmitoylation of Carboxypeptidase D. IMPLICATIONS FOR INTRACELLULAR TRAFFICKING J. Biol. Chem., March 7, 2003; 278(11): 9244 - 9249. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Talbot, B. D. Shur, and D. G. Myles Cell Adhesion and Fertilization: Steps in Oocyte Transport, Sperm-Zona Pellucida Interactions, and Sperm-Egg Fusion Biol Reprod, January 1, 2003; 68(1): 1 - 9. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sidyelyeva and L. D. Fricker Characterization of Drosophila Carboxypeptidase D J. Biol. Chem., December 13, 2002; 277(51): 49613 - 49620. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Huang, H. Deng, A. W. Wolkoff, and R. J. Stockert Phosphorylation-dependent Interaction of the Asialoglycoprotein Receptor with Molecular Chaperones J. Biol. Chem., September 27, 2002; 277(40): 37798 - 37803. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-S. Lee, J. Rohrer, R. Kornfeld, and S. Kornfeld Multiple Signals Regulate Trafficking of the Mannose 6-Phosphate-uncovering Enzyme J. Biol. Chem., January 25, 2002; 277(5): 3544 - 3551. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Steveson, G. C. Zhao, H. T. Keutmann, R. E. Mains, and B. A. Eipper Access of a Membrane Protein to Secretory Granules Is Facilitated by Phosphorylation J. Biol. Chem., October 19, 2001; 276(43): 40326 - 40337. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. O. Johnson, M. A. Lampson, and T. E. McGraw A Di-Leucine Sequence and a Cluster of Acidic Amino Acids Are Required for Dynamic Retention in the Endosomal Recycling Compartment of Fibroblasts Mol. Biol. Cell, February 1, 2001; 12(2): 367 - 381. [Abstract] [Full Text] |
||||
![]() |
S Alais, N Allioli, C Pujades, J. Duband, O Vainio, B. Imhof, and D Dunon HEMCAM/CD146 downregulates cell surface expression of (&bgr;)1 integrins J. Cell Sci., January 5, 2001; 114(10): 1847 - 1859. [Abstract] [PDF] |
||||
![]() |
K. M. Breiner, S. Urban, B. Glass, and H. Schaller Envelope Protein-Mediated Down-Regulation of Hepatitis B Virus Receptor in Infected Hepatocytes J. Virol., January 1, 2001; 75(1): 143 - 150. [Abstract] [Full Text] |
||||
![]() |
O Varlamov, E Kalinina, F. Che, and L. Fricker Protein phosphatase 2A binds to the cytoplasmic tail of carboxypeptidase D and regulates post-trans-Golgi network trafficking J. Cell Sci., January 1, 2001; 114(2): 311 - 322. [Abstract] [PDF] |
||||
![]() |
Y. Xiang, S. S. Molloy, L. Thomas, and G. Thomas The PC6B Cytoplasmic Domain Contains Two Acidic Clusters That Direct Sorting to Distinct trans-Golgi Network/Endosomal Compartments Mol. Biol. Cell, April 1, 2000; 11(4): 1257 - 1273. [Abstract] [Full Text] |
||||
![]() |
K. M. Breiner and H. Schaller Cellular Receptor Traffic Is Essential for Productive Duck Hepatitis B Virus Infection J. Virol., March 1, 2000; 74(5): 2203 - 2209. [Abstract] [Full Text] |
||||
![]() |
R. T. Watson and J. E. Pessin Functional Cooperation of Two Independent Targeting Domains in Syntaxin 6 Is Required for Its Efficient Localization in the trans-Golgi Network of 3T3L1 Adipocytes J. Biol. Chem., January 14, 2000; 275(2): 1261 - 1268. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. G. Novikova, F. J. Eng, L. Yan, Y. Qian, and L. D. Fricker Characterization of the Enzymatic Properties of the First and Second Domains of Metallocarboxypeptidase D J. Biol. Chem., October 8, 1999; 274(41): 28887 - 28892. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Varlamov, F. J. Eng, E. G. Novikova, and L. D. Fricker Localization of Metallocarboxypeptidase D in AtT-20 Cells. POTENTIAL ROLE IN PROHORMONE PROCESSING J. Biol. Chem., May 21, 1999; 274(21): 14759 - 14767. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Varlamov, F. Wu, D. Shields, and L. D. Fricker Biosynthesis and Packaging of Carboxypeptidase D into Nascent Secretory Vesicles in Pituitary Cell Lines J. Biol. Chem., May 14, 1999; 274(20): 14040 - 14045. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||