![]() |
|
|
Vol. 10, Issue 10, 3097-3112, October 1999









*Cold Spring Harbor Laboratory, Cold Spring Harbor, New York
11724; and Departments of
Molecular Cell Biology and
§Materials and Interfaces, The Weizmann Institute of
Science, Rehovot 76100, Israel
| |
ABSTRACT |
|---|
|
|
|---|
Caldesmon is known to inhibit the ATPase activity of actomyosin in a Ca2+-calmodulin-regulated manner. Although a nonmuscle isoform of caldesmon is widely expressed, its functional role has not yet been elucidated. We studied the effects of nonmuscle caldesmon on cellular contractility, actin cytoskeletal organization, and the formation of focal adhesions in fibroblasts. Transient transfection of nonmuscle caldesmon prevents myosin II-dependent cell contractility and induces a decrease in the number and size of tyrosine-phosphorylated focal adhesions. Expression of caldesmon interferes with Rho A-V14-mediated formation of focal adhesions and stress fibers as well as with formation of focal adhesions induced by microtubule disruption. This inhibitory effect depends on the actin- and myosin-binding regions of caldesmon, because a truncated variant lacking both of these regions is inactive. The effects of caldesmon are blocked by the ionophore A23187, thapsigargin, and membrane depolarization, presumably because of the ability of Ca2+-calmodulin or Ca2+-S100 proteins to antagonize the inhibitory function of caldesmon on actomyosin contraction. These results indicate a role for nonmuscle caldesmon in the physiological regulation of actomyosin contractility and adhesion-dependent signaling and further demonstrate the involvement of contractility in focal adhesion formation.
| |
INTRODUCTION |
|---|
|
|
|---|
The regulation of the interactions between actin filaments and
myosin molecular motors is essential for many cellular functions, from
muscle contraction to signal transduction (Tan et al., 1992
; Brzeska and Korn, 1996
; Burridge and Chrzanowska-Wodnicka, 1996
; Squire
and Morris, 1998
). In addition to actin and myosin, other actin
filament-associated proteins play basic roles in the regulation of
cellular contractility, and these components differ between striated
and smooth muscle and nonmuscle systems. In vertebrate skeletal and
cardiac muscle, tropomyosins, in association with the troponin complex,
regulate the calcium-sensitive interactions of actin and myosin II
(Tobacman, 1996
; Squire and Morris, 1998
). In contrast, smooth muscle
(as well as nonmuscle) cells do not express the troponin complex, and
regulation of contractility is mediated by at least two independent
mechanisms involving myosin light chain phosphorylation and caldesmon.
The regulation of actomyosin activity in smooth muscle and nonmuscle
cells by phosphorylation of the regulatory light chain of myosin II
(MLC) has been extensively characterized (Tan et al., 1992
;
Somlyo and Somlyo, 1994
). Phosphorylation of MLC by Ca2+-calmodulin activated myosin light chain
kinase leads to an increase in actomyosin ATPase activity and triggers
myosin II-driven motility in vitro. Recently the small GTPase Rho was
established to be a key regulator of MLC phosphorylation. GTP-bound Rho
activates an enzyme known as Rho-kinase, which phosphorylates the
myosin-binding subunit of myosin light chain phosphatase, inactivating
it and thereby preventing MLC dephosphorylation (Kimura et
al., 1996
). As a result, Rho activation leads to an accumulation
of the phosphorylated MLC and, subsequently, to the stimulation of
actomyosin ATPase activity.
The second type of regulation of myosin II activity involves caldesmon.
This protein has been studied mainly in smooth muscle cells. Caldesmon
contains actin-, myosin-, tropomyosin-, and
Ca2+-calmodulin-binding domains and acts by
blocking the interaction of actin with myosin, inhibiting
actin-activated myosin ATPase activity (for review, see Huber, 1997
;
Chalovich et al., 1998
; Marston et al., 1998
).
Caldesmon has been shown to affect several processes dependent on the
actin-myosin interaction, including the movement of actin filaments
over myosin heads as shown by in vitro motility assays (Okagaki
et al., 1991
; Haeberle et al., 1992
; Shirinsky
et al., 1992
; Fraser and Marston, 1995
; Wang et al., 1997
) and tension development in skinned smooth muscle fibers (Katsuyama et al., 1992
; Pfitzer et al., 1993
).
Although the majority of experimental data cited above were obtained
using smooth muscle caldesmon, the properties of nonmuscle caldesmon
should be quite similar (for review, see Matsumura and Yamashiro, 1993
;
Huber, 1997
). Smooth muscle and nonmuscle caldesmon are expressed from
a single gene via alternative RNA splicing (Hayashi et al.,
1992
; Payne et al., 1995
), and except for the lack of a
central "spacer" domain, nonmuscle caldesmon contains all the
functionally important domains of the muscle-derived molecule (Figure
1). However, although studies in smooth
muscle cells strongly suggest a role for caldesmon in the regulation of
contractility, there is no direct evidence for such a role in nonmuscle
cell systems (Huber, 1997
). At the same time, it appears that changes in fibroblast contractility may proceed without any MLC phosphorylation changes (Obara et al., 1995
), suggesting that regulation of
nonmuscle cell contractility may involve independent alternative
mechanisms. Nonmuscle caldesmon would constitute a good candidate
as an alternative regulator of actomyosin contractility.
|
Contractility of nonmuscle cells has recently been demonstrated to be
intimately associated with adhesion and adhesion-dependent signaling.
Focal adhesions are sites of contact between the cell surface and the
extracellular matrix, where the associated actin stress fibers
terminate. They comprise integrin-type extracellular matrix
receptors and a number of intracellular structural and signaling
proteins (for review, see Geiger et al., 1995
; Jockusch et al., 1995
; Burridge and Chrzanowska-Wodnicka, 1996
;
Ben-Ze'ev and Bershadsky, 1997
). Rho was shown to be an essential
mediator in pathways leading to formation of focal adhesions and to the associated focal adhesion-dependent signaling (Ridley and Hall, 1992
;
Hotchin and Hall, 1995
; Clark et al., 1998
). Similarly to the Rho-mediated contractility regulation, the formation of focal adhesions has been shown to depend on Rho-kinase activation (Leung et al., 1996
; Amano et al., 1997
; Ishizaki
et al., 1997
). Furthermore, chemical inhibitors of MLC
phosphorylation have been shown to prevent Rho-induced formation of
focal adhesions (Chrzanowska- Wodnicka and Burridge, 1996
).
Another body of evidence documenting the role played by contractility
in the regulation of focal adhesion signaling lies in studies using
microtubule disruption as an inducer of cellular contractility.
Microtubule disruption increases contractility in various cell types
(Danowski, 1989
; Lampidis et al., 1992
; Kolodney and Elson,
1995
; Sheridan et al., 1996
; Canman and Bement, 1997
). This
process is accompanied by an increase of MLC phosphorylation (Kolodney
and Elson, 1995
) that can be a consequence of augmentation of Rho
activity (Ren et al., 1999
). At the same time, the
disruption of microtubules was shown to be sufficient to induce a rapid
assembly of focal adhesions and downstream adhesion-dependent signaling (Bershadsky et al., 1996
; Enomoto, 1996
; Liu et
al., 1998
). Moreover, the effect of microtubule disruption on the
focal adhesion formation and signaling can be prevented by the Rho
inhibitor C3 botulinum toxin (Enomoto, 1996
; Liu et al.,
1998
), as well as by chemical inhibitors of MLC phosphorylation
(Bershadsky et al., 1996
). Altogether, these results led us
to propose that an increase in cell contractility is an indispensable
step in the activation of adhesion-dependent signaling and focal
adhesion formation.
Thus, most studies investigating the regulation of nonmuscle cell contractility and its relationship to adhesion-dependent signaling have focused on the role of myosin light chain phosphorylation and its upstream regulators. We show here that expression of nonmuscle caldesmon in cultured human fibroblasts inhibits cell contractility, as well as the assembly of stress fibers and focal adhesions, in a Ca2+-sensitive manner. Thus, nonmuscle caldesmon can control contractility in fibroblasts and consequently affect adhesion-dependent signaling. In addition, these data further demonstrate that stimulation of contractility is an indispensable step in adhesion-dependent signaling processes.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cells
The SV80 cell line, derived from simian virus
(SV40)-transformed, but weakly tumorigenic, human fibroblasts (Kahn
et al., 1983
) was used in all the experiments. The cultures
were maintained in Dulbecco's modified Eagle's medium supplemented
with 10% bovine calf serum (Hyclone, Logan, UT). Subconfluent cultures
were transfected and examined 24-36 h later with or without incubation
in serum-free medium and drug treatment.
cDNA Constructs and Transfections
cDNA clones encoding constitutively active Rho A-V14 kindly
provided by Dr. A. Hall (University College, London, United Kingdom) and nonmuscle rat caldesmon (Yamashiro et al., 1995
), a gift
from Dr. F. Matsumura (Rutgers University, Piscataway, NJ), were PCR amplified and cloned in-frame between the XbaI and
BamHI sites in the pCGN expression vector with an N-terminal
16-aa hemagglutinin (HA) tag or an 11-aa vesicular stomatitis virus
(VSV) tag (Tanaka and Herr, 1990
; Temm-Grove et al., 1996
).
A scheme depicting the localization of actin-, myosin-, tropomyosin-,
and Ca2+-calmodulin-binding sites in the
sequence of nonmuscle caldesmon is presented in Figure 1. The caldesmon
deletion mutant CD445B ("truncated caldesmon") was used as a
control. This mutant contains aa 237-445 of nonmuscle caldesmon but
lacks the strong actin-binding sites, the high-affinity
Ca2+-calmodulin-binding sites, one of the
tropomyosin-binding sites at the C terminus, as well as the
myosin-binding domain at the N terminus (Figure 1). This deletion
mutant of caldesmon was prepared by PCR using sense primer
ACCTTCTAGAGAATTCATGACCCACAAAC (containing an XbaI site) and
antisense primer ACCTGGATCCCTATTCCGCAGGGACAGGAAGATC (containing a
BamHI site) and subcloned into the pCGN expression vector as
described above.
To visualize caldesmon in living cells a fusion construct comprising caldesmon and the green fluorescent protein (GFP) was created. GFP cloned into the pRK expression vector was kindly provided by Dr. B. Geiger (The Weizmann Institute of Science). To produce a GFP-caldesmon construct, GFP was amplified by PCR from the pRK vector using sense ACCTTCTAGAATGGTGAGCAAGGGCGAGG and antisense ACCTACTAGTTTACTTGTACAGCTCGTCCATG primers. The PCR product was digested by XbaI and SpeI and cloned into the pCGN vector bearing HA-tagged full-length or truncated CD445B caldesmon in the XbaI site. The GFP bearing pRK vector was also used as a control in transfection experiments and, in some cases, in cotransfection experiments with other constructs to visualize living, transfected cells.
Cells were transfected using Ca2+-phosphate or LipofectAMINE (Life Technologies, Grand Island, NY). Five hours after transfection, the medium was changed, and the cells were incubated for an additional time interval in serum-containing or serum-free medium before experimental treatment or fixation.
Drug Treatment
Microtubule disruption and the consequent induction of focal
adhesion formation was achieved by 10 µM nocodazole treatment of
serum-starved cells for 30 min (Bershadsky et al., 1996
). To inhibit Rho activity, C3 Botulinum toxin (10 µg/ml) was added to the
culture in serum-containing medium and incubated overnight. H-7, a
kinase inhibitor shown to suppress cell contractility (Volberg et
al., 1994
), was added to the medium for 30 min at a final
concentration of 300 µM. To increase the intracellular
Ca2+ concentration, cells were treated with the
calcium ionophore A23187 (5 µM) or with the calcium ATPase inhibitor
thapsigargin (1 µM). Alternatively, the intracellular
Ca2+ concentration was increased by addition of
50-100 mM KCl to the culture medium, leading to depolarization of cell
membrane and opening of voltage-gated Ca2+
channels (Chen et al., 1988
; De Roos et al.,
1997
).
Nocodazole [methyl-(5-[2-thienylcarbonyl]-1H-benzimidazol-2-yl)
carbamate] and H-7 [1-(5-isoquinolinylsulfonyl)-2-methylpiperazine] were obtained from Sigma (Rehovot, Israel). A23187 and thapsigargin were from Calbiochem (La Jolla, CA). Recombinant C3 toxin of
Clostridium botulinum was purified as described (Dillon and
Feig, 1995
) following expression from a plasmid obtained from Dr. A. Hall (University College) and was kindly provided to us by Dr. Ronen
Alon (The Weizmann Institute of Science).
Fluorescence Microscopy
Cells were simultaneously fixed and permeabilized in PBS
containing 3% paraformaldehyde and 0.5% Triton X-100 for 2 min,
postfixed in 3% paraformaldehyde for 20 min, and labeled using
indirect immunofluorescence. Monoclonal antibody to paxillin was
purchased from Transduction Laboratories (Lexington, KY), monoclonal
anti-phosphotyrosine antibody (clone PT66), anti-VSV antibody (clone
P5D4), FITC- and TRITC-labeled phalloidin from Sigma, and monoclonal
anti-HA tag antibody (clone16B12) from Babco (Richmond, CA). Rabbit
anti-phosphotyrosine antibody was kindly provided by Dr. I. Pecht (The
Weizmann Institute of Science), and polyclonal anti-VSV-G antibody
(Soldati and Perriard, 1991
) was provided by Dr. J.-C. Perriard (Swiss
Federal Institute of Technology, Honggerberg, Switzerland). FITC-,
TRITC-, and Cy5-conjugated goat anti-mouse and anti-rabbit
immunoglobulins were obtained from Jackson Laboratories (West Grove, PA).
Immunolabeling and photography were performed as described (Volberg
et al., 1994
). For the immunolabeling of cells double transfected with caldesmon and Rho A-V14, we used the constructs bearing different tags (VSV and HA) and labeled the cells with rabbit
anti-VSV and mouse anti-HA antibodies, followed by goat anti-rabbit
TRITC-conjugated and anti-mouse Cy5-conjugated antibodies. FITC-phalloidin was used to visualize F-actin in the same cells. For
the visualization of phosphotyrosine in the cells transfected with
GFP-caldesmon and VSV-Rho A-V14, we labeled the cells with mouse
anti-VSV and rabbit anti-phosphotyrosine, followed by the same
combination of secondary antibodies. The triple-stained specimens were
examined by video microscopy using a Zeiss (Thornwood, NY) Axiovert
fluorescence microscope with a Plan-Apochromat 100× numerical aperture
1.3 objective, charge-coupled device camera (Photometrics, Tucson, AZ) and the Priism and Delta-Vision software packages (Applied
Precision, Issaquah, WA) on a Silicon Graphics computer (SGI, Mountain
View, CA). We used FITC filters to visualize GFP fluorescence.
The Delta-Vision video microscopy system was also used for the observations of GFP-caldesmon dynamics in living cells. We used 35-mm plastic Petri dishes, in which circular holes were made and onto which number 1 glass coverslips were mounted with wax to allow high-resolution visualization. The cells were plated onto these chambers 5-7 h after the GFP-caldesmon transfection, and the observations were performed 16-20 h after plating. The objective was maintained at 37°C by a regulated electric heater while thermal contact through the immersion oil held the cells at the same temperature. The medium was buffered by 20 mM HEPES. Dynamics of GFP-caldesmon was registered by recording the fluorescent images every 10 min.
Quantitation of Focal Adhesions
To assess semiquantitatively the effects of different treatments and transfections on the formation and tyrosine phosphorylation of focal adhesions, we developed a simple classification system. The cells in each specimen were classified according to the prevailing size of their focal adhesions, as revealed by anti-phosphotyrosine labeling. The reference point in this classification was the predominant focal adhesion size in cells growing in serum-containing medium (Figures 2A and 3A). A majority of these cells have elongated focal adhesions of 3-5 µm length and ~1 µm in width. We defined the cells with prevalent focal adhesions of this size as belonging to the "medium" class. Cells in which the majority of focal adhesions had either greater width or length or were bigger in both dimensions formed the "large" class. Cells with prevalent small dot-like focal adhesions <1 µm in size were referred to as the "small" class. For each type of treatment, 100-200 randomly selected cells were scored.
Contractility Assays
The traction forces exerted by substrate-attached cells were
assessed using the silicone-rubber substratum method (Harris et
al., 1980
), modified according to Burton and Taylor (1997)
. Briefly, thin films of silicone rubber were prepared by vulcanizing the
surface of a layer of phenylmethyl polysiloxane, trimethyl terminated
(710 fluid; Dow Corning, Midland, MI) with a Bunsen burner flame. Film
compliance was increased by UV irradiation (3 h, at 1 cm from 15-W
lamp;
= 312 nm). Films were coated with fibronectin (F-1141,
Sigma) by incubation with 10 µg/ml fibronectin solution in PBS for
24 h at 4°C before cell seeding. Cells were transfected with
constructs encoding GFP-caldesmon, GFP-CD445B (truncated caldesmon),
or GFP alone and plated on the films 10-20 h before the observations.
The observations were performed using a Plan-Apochromat 40× numerical
aperture 1.0 objective and phase-contrast optics.
To evaluate cell contractility, we also performed live recording of
cell rounding after trypsin treatment (Symons and Mitchison, 1992
). In
these experiments the cells were cotransfected with GFP and caldesmon
expression plasmids. Because the efficiency of cotransfection was
estimated to be ~95%, as assayed by immunofluorescence labeling of
cotransfected cells, we assumed that all GFP-fluorescent cells were
also expressing caldesmon. The observations were performed using a
Fluar 100×, numerical aperture 1.3 oil immersion objective and
differential interference contrast optics. The serum-containing medium
was changed to a serum-free medium 1 h before treatment. Standard
0.25% trypsin solution (Bio Labs, Jerusalem, Israel) was injected into
the medium with a final dilution of 1:5. In these experiments the
images were recorded by a digital charge-coupled device camera (iSight,
Tirat haCarmel, Israel).
| |
RESULTS |
|---|
|
|
|---|
Effects of Caldesmon Overexpression on Cell Shape, the Actin Cytoskeleton, and Focal Adhesions
Subconfluent untreated SV80 cells in serum-containing medium
exhibit a polygonal shape and form numerous elongated (dash-like) focal
adhesions usually localized at the cell periphery. These focal
adhesions were readily visualized by immunofluorescence labeling with
an anti-phosphotyrosine antibody (Figure
2A), as well as with antibodies to
vinculin or paxillin (see Figure 9). The actin cytoskeleton of SV80
fibroblasts, revealed by fluorochrome-conjugated phalloidin, showed
actin filament bundles ("stress fibers") and a dense filamentous
network localized in lamellipodia at the leading edges (Figure 2B).
|
Significant changes in cell shape, adhesion, and actin cytoskeletal organization were observed in subconfluent SV80 cells transfected with cDNA encoding full-length rat nonmuscle caldesmon (Figure 2, C-F). Transfected cells acquired a characteristic morphology with augmented lamellipodia at the leading edge and elongated tails (Figure 2, D and F). Some cells with especially high levels of caldesmon expression became "arborized" because of the formation of long, slender, and sometimes branching cell processes (our unpublished results). Phalloidin staining of caldesmon-transfected cells revealed different stages of actin cytoskeleton disorganization. At 12-15 h after transfection, alterations in morphology were not yet very pronounced, and the transfected caldesmon in many cells was associated with normal actin-containing structures, including stress fibers. After 24-48 h of incubation, however, only a few caldesmon-transfected cells showed well-developed straight stress fibers, whereas the majority of cells exhibited altered, thin, and wavy stress fibers, to which the caldesmon remained associated or demonstrated diffuse distribution of both actin and caldesmon (Figure 2, E and F). The truncated variant of caldesmon, CD445B, incorporated to some extent into stress fibers, although nuclear and diffuse cytoplasmic staining was more pronounced than in the case of full-length caldesmon (Figure 2H). Transfection with CD445B did not produce apparent changes in the actin cytoskeleton.
Anti-phosphotyrosine labeling showed that tyrosine phosphorylation in caldesmon-overexpressing cells was significantly lower than in control cells (Figure 2, C compared with A). Phosphotyrosine-containing focal adhesions in these cells were small, dot-like, and localized mainly at the edges of lamellipodial protrusions (Figure 2C). Transfection of cells with the truncated variant of caldesmon, CD445B, did not interfere with formation and tyrosine phosphorylation of focal adhesions (Figure 2G).
The results of cell treatment with the protein kinase inhibitor H-7 and
with the Rho inhibitor C3 botulinum toxin showed a striking similarity
to the phenotypic effects of caldesmon overexpression (Figure
3). Treatment with these inhibitors led
to an increase of protrusion activity, formation of elongated thin
processes, and deterioration of stress fibers (Figure 3, D and F). The
cells also failed to form large, dash-like focal adhesions, and
labeling with anti-phosphotyrosine antibody revealed only small
dot-like peripheral focal contacts (Figure 3, C and E compared with A).
|
Caldesmon Inhibits Cell Contractility
The contractility of caldesmon-transfected cells was assessed by
examining the ability of substrate-attached cells to generate traction
forces. This was analyzed in cells plated on elastic silicone rubber
films after transfection with a construct encoding GFP-caldesmon
(Figure 4). Formation of wrinkles on the
silicone rubber film because of cell traction depends on the local
compliance of the film. Because this parameter can vary from film to
film and even from one area to another on the same film, we assessed the behavior of transfected cells only in the fields in which 100% of
nontransfected neighboring cells exhibited apparent ability to
form the wrinkles. Under these circumstances, the cells transfected with GFP-caldesmon demonstrated a severely depressed ability to produce wrinkles, and ~90% of them did not induce wrinkling at all
(Figure 4, A and C). Under the same conditions, ~80% of cells transfected with truncated caldesmon 445B were able to induce wrinkles
(Figure 4E). The expression of GFP alone did not interfere with the
ability of cells to generate wrinkles (Figure 4G).
|
Another assay used to demonstrate an inhibitory effect of
caldesmon on cell contractility was trypsin-induced cell rounding. Trypsin treatment induces a rapid contraction in the majority of cell
types, leading to complete cell rounding. Cell rounding depends on an
actin-myosin interaction, as was shown on permeabilized cells (Sims
et al., 1992
). Signals inducing rounding activate MLC
phosphorylation in a Rho-dependent manner (Majumdar et al., 1998
). The rounding assay is convenient for analysis of
actomyosin-driven cell contractility (Symons and Mitchison, 1992
). As
shown in Figure 5, the transfected cells
did not round up after addition of trypsin, whereas neighboring,
nontransfected cells became round in <2 min under these conditions
(Figure 5, E and F compared with A and B). The rounding of cells
transfected with GFP alone was not retarded when compared with the
rounding of their nontransfected neighbors (our unpublished results).
Caldesmon-transfected cells treated with 50 mM KCl for 30 min before
trypsin addition demonstrated a rate of cell rounding similar to that
of neighboring nontransfected cells (our unpublished results).
|
Caldesmon Prevents Formation of Focal Adhesions and Stress Fibers Induced by Activated Rho or by Microtubule Disruption
Transfection of SV80 cells with a cDNA encoding the constitutively
activated Rho A-V14 induced dramatic changes in the organization of the
actin cytoskeleton and focal adhesions, both in serum-free and in
ordinary serum-containing medium. The transfected Rho A-V14 was
diffusely distributed over the entire cytoplasm (Figures
6 and 7), as previously described
(Adamson et al., 1992
). Phalloidin staining revealed very
large bundles of actin in the Rho A-V14-transfected cells (Figure 6B).
|
To investigate the effects of caldesmon expression on the Rho-dependent formation of stress fibers and focal adhesions, cells were cotransfected with two different constructs, one encoding caldesmon, and the other encoding Rho A-V14. Double indirect immunofluorescence labeling of the cotransfected cells showed that 95% of the transfected cells expressed both proteins, although the level of expression of each varied between cells. Triple staining of tagged-Rho A-V14 and caldesmon together with F-actin allowed us to analyze the organization of the actin cytoskeleton with respect to the different ratios of Rho and caldesmon expression (Figure 6, C-F). These data showed that the expression of caldesmon could inhibit or even completely abolish the effect of Rho on cell morphology and the assembly of actin bundles. The cells expressing a high level of caldesmon did not form prominent actin stress fibers, even in the presence of comparable levels of Rho A-V14 (Figure 6, C-F). In addition, cells coexpressing Rho A-V14 and caldesmon often exhibited a shape similar to that of cells expressing caldesmon alone, with numerous lamellipodia and elongated processes (Figure 6, E and F). On the other hand, in the presence of low or intermediate levels of caldesmon, high expression of Rho still correlated with the display of stress fibers (Figure 6, C and D, left cell).
Cells doubly transfected with Rho A-V14 and caldesmon often
showed small, dot-like focal adhesions (Figure
7A) typical of cells transfected with
caldesmon alone (Figure 2C). Truncated CD445B caldesmon did not
interfere with Rho-dependent stimulation of focal adhesion formation
(Figure 7D). The effect of caldesmon and Rho A-V14 on the focal
adhesions was quantified by classifying the cells according to the size
of their focal adhesions after labeling with anti-phosphotyrosine
antibody (see MATERIALS AND METHODS); the percentage of cells
displaying each phenotype in the population of transfected cells was
determined (Figure 8). These data showed
that the cells expressing active Rho A-V14 all presented oversized
focal adhesions when compared with mock-transfected cells (Figure 8, A
and B). More interestingly, ~50% of the cells cotransfected with
caldesmon and Rho exhibited tyrosine-phosphorylated focal adhesions
that were smaller than those of cells transfected with Rho alone
(Figure 8D). On the other hand, the fraction of cells with large focal
adhesions was still higher in the population of doubly transfected
cells when compared with the population of cells transfected with
caldesmon alone (Figure 8, D compared with C). Thus, overexpression of
full-length caldesmon efficiently inhibited formation of stress fibers
and the phosphotyrosine-positive focal adhesions induced by activated
Rho, but Rho also can partially suppress the effects of caldesmon.
|
|
We have previously shown that adhesion-dependent signaling, which
includes formation of stress fibers and focal adhesions, is activated
in serum-starved 3T3 fibroblasts by microtubule disruption (Bershadsky
et al., 1996
). Microtubule disruption was shown to induce
Rho activation (Ren et al., 1999
), MLC phosphorylation, and
cell contraction (Danowski, 1989
; Kolodney and Elson, 1995
). We
compared the effect of microtubule disruption on the formation of focal
adhesions in control and caldesmon-transfected cells. SV80 cells were
transfected with GFP-caldesmon, serum starved for 24 h, and
treated with nocodazole for 30 min. Caldesmon-transfected cells, in
contrast to the controls, did not form large phosphotyrosine- or
paxillin-positive focal adhesions upon microtubule disruption (Figure
9, A and B). Scoring the cells according
to the size of their focal adhesions showed that in serum-free medium,
control or caldesmon-transfected SV80 cells formed mainly small focal adhesions (Figure 10, A and B).
Addition of nocodazole induced the formation of numerous large focal
adhesions in control cells, whereas caldesmon-expressing cells were
much less affected (Figure 10, D compared with C). The difference
between nocodazole-induced focal adhesion formation in mock-transfected
and caldesmon-transfected cells was highly significant
(
2 = 82; p
0.001). Thus, caldesmon
expression, similar to chemical inhibitors that suppress cell
contractility (Bershadsky et al., 1996
), can efficiently
prevent the induction of focal adhesions by nocodazole.
|
|
The Effects of Caldesmon on Focal Adhesions and Stress Fibers Are Ca2+ Sensitive
The inhibitory effect of caldesmon on the ATPase activity of
actomyosin is reversible by calmodulin, calmodulin-like
Ca2+-binding protein, or S100 in the presence of
Ca2+ (Marston et al., 1998
). Here we
show that increased intracellular Ca2+ can
reverse the inhibitory effects of transfected caldesmon on the assembly
of stress fibers and focal adhesions. To investigate whether the
effects of caldesmon in vivo are Ca2+ sensitive,
we used several experimental procedures that increase the intracellular
Ca2+ concentration via various mechanisms. These
include treatment with the calcium ionophore A23187, with
Ca2+-ATPase inhibitor thapsigargin, which
releases Ca2+ from intracellular stores (Treiman
et al., 1998
), and with KCl, which induces membrane
depolarization and opening of voltage-gated calcium channels.
All these treatments efficiently reversed the effects of overexpressed
caldesmon. Caldesmon transfection, as described above, disorganized the
actin cytoskeleton; as a result, GFP-caldesmon exhibited diffuse
distribution with slightly increased intensity along a few wavy stress
fiber remnants (Figure 11A). Video
microscopic examination of GFP-caldesmon dynamics showed that
thapsigargin (Figure 11) or KCl (our unpublished results) induced rapid
recovery of the normal cytoskeleton structure with prominent
caldesmon-containing stress fibers (Figure 11, B-F). This
result demonstrates that caldesmon remains associated with the
actin filament bundles even under conditions when its inhibitory effect
on actin-myosin interaction is blocked by Ca2+.
|
Treatment with the calcium-mobilizing compounds interfered with the inhibitory effect of caldesmon on focal adhesions. The percentage of cells with medium or large focal adhesions increased, whereas the percentage of cells with small focal adhesions decreased in caldesmon-transfected cells after KCl treatment (Figure 10, E and F). Increased intracellular Ca2+ abolished the inhibitory effect of caldesmon on formation of focal adhesions induced by microtubule disruption. When A23187 or thapsigargin was added to the medium before the nocodazole treatment, both transfected and nontransfected cells developed elongated mature focal adhesions of similar size (Figure 9, D and F). Formation of prominent focal adhesions in nocodazole-treated cells with elevated levels of intracellular Ca2+ was accompanied by the assembly of stress fibers to which GFP-caldesmon was localized (Figure 9, C and E). Collectively, these results demonstrate the calcium sensitivity of the inhibitory effect of caldesmon on focal adhesions and stress fibers.
| |
DISCUSSION |
|---|
|
|
|---|
Previous studies of contractility in nonmuscle cells have focused
mainly on phosphorylation of the regulatory light chain of myosin. Here
we demonstrate that regulation of contractility can occur through a
mechanism involving nonmuscle caldesmon. We have shown that both
generation of traction forces by cells attached to flexible film and
cell rounding after trypsin treatment were suppressed in the cells
transfected with a construct encoding caldesmon. Overexpression of
caldesmon was also able to inhibit contractility induced by microtubule
disruption and expression of active Rho A-V14. Some
caldesmon-transfected cells acquire a typical arborized shape
with characteristic branching processes; this is likely to be a
consequence of the inability of the cells with impaired contractility
to retract their lamellipodial extensions and trailing edges
("tails") during locomotion. Comparable morphological changes were
previously observed in cells microinjected with antibodies against
myosin II (Honer et al., 1988
) or treated with chemical inhibitors that block myosin II-driven contractility (Volberg et
al., 1994
). The apparent similarity between the morphological effects of these different agents strongly suggests that the changes in
cell shape they induced are all related to their inhibitory effect on
cell contractility.
Previous studies have localized endogenous caldesmon to actin filaments
in cultured cells (Bretscher and Lynch, 1985
; Yamashiro-Matsumura and
Matsumura, 1988
; Hosoya et al., 1993
). Our results with
caldesmon overexpression are consistent with these observations. At
early time points after transfection caldesmon is localized to stress fibers. Later, at 24-48 h after transfection, caldesmon exhibits its
effects on stress fiber organization: straight, thick stress fibers
gradually disappear and are replaced by less-defined wavy bundles of
actin filaments, to which the exogenous caldesmon remains associated.
It is interesting to note, however, that when the effect of caldesmon
is blocked by elevated cytoplasmic Ca2+ levels
(see below), the prominent stress fibers appear again, and exogenous
caldesmon is still found associated to them. This result shows that the
association of nonmuscle caldesmon with stress fibers is preserved even
under conditions when its function is suppressed by
Ca2+-calmodulin. This is in agreement with
studies in smooth muscle in which it was demonstrated that caldesmon
remains associated with thin filaments in the presence of
Ca2+ complex with calmodulin-like
Ca2+-binding protein (Marston et al.,
1998
).
We found that caldesmon-transfected cells, in the presence of serum,
exhibit smaller focal adhesions with reduced levels of tyrosine-phosphorylated proteins compared with the nontransfected cells. These dot-like focal adhesions are usually concentrated at the
leading edge and associated with poorly defined actin structures. This
phenotype was essentially the same as that induced by chemical inhibitors of myosin-II-driven contractility or by Rho inactivation (Ridley and Hall, 1992
; Volberg et al., 1994
; Bershadsky
et al., 1996
; Chrzanowska-Wodnicka and Burridge, 1996
;
Pelham and Wang, 1997
). Moreover, we have shown that caldesmon
overexpression prevents the induction of focal adhesions and stress
fibers by activated Rho or by microtubule disruption. Thus, inhibition
of actomyosin contractility by caldesmon leads to the dissolution of
preexisting focal adhesions and blocks their formation. These results,
together with experiments using inhibitors of MLC phosphorylation
(Bershadsky et al., 1996
; Chrzanowska-Wodnicka and Burridge,
1996
; Pelham and Wang, 1997
), strongly suggest that the maintenance and
assembly of focal adhesions depend on myosin II-driven contractility.
It is worth noting that caldesmon has an advantage as an experimental tool over chemical inhibitors of myosin II function, because it is a
natural and specific inhibitor of actomyosin contractility.
The specificity of the effects of nonmuscle caldesmon is supported by
the following observations. First, these effects are Ca2+ sensitive, because they can be abrogated by
increasing the cytoplasmic Ca2+ concentration.
This characteristic is in agreement with the known calcium sensitivity
of caldesmon effects in vitro mediated by Ca2+-binding proteins such as calmodulin or S100
(Smith et al., 1987
; Pritchard and Marston, 1991
; Marston
et al., 1998
). Elevations of intracellular
Ca2+ could also be expected to lead to the
stimulation of actomyosin ATPase through an increased phosphorylation
of MLC by myosin light chain kinase (Tan et al., 1992
;
Somlyo and Somlyo, 1994
) and thereby indirectly counteract the effects
of caldesmon on contractility. However, caldesmon still inhibits
actomyosin ATPase and movement of actin filaments on smooth muscle
myosin even if MLC is phosphorylated (Okagaki et al., 1991
;
Shirinsky et al., 1992
). Thus we can attribute the observed
restoration of actomyosin contractility to the effect of
Ca2+ on caldesmon via
Ca2+-binding proteins.
Second, the truncated caldesmon CD445B mutant, lacking both a myosin-binding domain at the N terminus and a strong actin-binding site at the C terminus, does not exhibit any detectable biological activity in our experiments. In contrast, transfections with constructs containing either all the actin-binding sites of the molecule or truncated actin-binding domains together with intact myosin-binding domains at the N terminus are sufficient to produce phenotypic alterations similar to those induced by full-length caldesmon (our unpublished results). Detailed analysis of the in vivo functions of the different domains of nonmuscle caldesmon will require further work, but these observations clearly establish that the observed effects of caldesmon expression are due to its interactions with actin and myosin.
Thus, our results provide significant new evidence for the role of
contractility in maintenance and formation of focal adhesions. The
possible mechanisms underlying the relationship between contractility and the assembly of focal adhesions have been extensively discussed in
the literature (Bershadsky et al., 1996
; Burridge and
Chrzanowska- Wodnicka, 1996
; Chrzanowska-Wodnicka and Burridge,
1996
; Ben-Ze'ev and Bershadsky, 1997
; Chicurel et al.,
1998
; Elbaum et al., 1998
). A plausible suggestion is that
the maintenance of focal adhesions depends on the tension developed by
the actomyosin system, or, in other words, that focal adhesions belong
to the class of "tensegrity" structures that preserve their
integrity only under tension (Ingber, 1997
). Involvement of the
cytoskeletal tensegrity in integrin-dependent signaling was
proposed by Ingber (1991
, 1997
) and Chicurel et al.
(1998)
. In our model (Bershadsky et al., 1996
; Elbaum
et al., 1998
) the nascent adhesive contacts in association
with the actin cytoskeleton operate as tension-sensing devices
converting mechanical signals into protein modification (such as
tyrosine phosphorylation) and thus activate downstream intracellular
pathways. The importance of tension for triggering adhesion-dependent
signal transduction is supported by recent findings in which external
forces applied to the cell-extracellular matrix adhesion sites, such
as stretching of an elastic substrate (Hamasaki et al.,
1995
; MacKenna et al., 1998
) or trapping of cell
surface-attached beads (Choquet et al., 1997
; Schmidt
et al., 1998
; Suter et al., 1998
), were shown to increase the strength of adhesion itself, the phosphorylation of focal
adhesion proteins, and the progress of downstream signaling events. In
addition, plating of cells on a very flexible substrate suppressed
tension development and inhibited the formation and tyrosine
phosphorylation of focal adhesions (Pelham and Wang, 1997
).
Collectively, these studies show that the tension-sensing molecular
device, comprising focal adhesions and the actin cytoskeleton, has an
important regulatory role in eukaryotic cells. This mechanism is under
the control of several regulatory pathways, and we show here that
caldesmon plays an important role in the regulation of this mechanism.
Caldesmon may be a target for a variety of signaling pathways that
modulate its function and thereby its effect on cell contractility and
adhesion-dependent signaling. Besides the calcium-sensitive regulation
discussed above, it is known that caldesmon can be phosphorylated by
serine/threonine kinases, including MAPK (Gerthoffer et al.,
1996
), p34cdc2 (Yamashiro et al.,
1991
), p21-activated protein kinase (Van Eyk et al.,
1998
), and tyrosine kinases (McManus et al., 1997
). In some
cases, this phosphorylation was shown to affect caldesmon function (for
review, see Matsumura and Yamashiro, 1993
). In the future, it will be
of interest to determine whether caldesmon is a target for
phosphorylation during activation of signaling pathways dependent on
contractility, such as the Rho-dependent pathway.
Finally, tropomyosins are likely to play a significant role in
the modulation of caldesmon function. Tropomyosins are natural partners
of caldesmon in the regulation of actomyosin-based contractility and,
indeed, can mediate the inhibitory effects of caldesmon on actomyosin
(Horiuchi et al., 1995
; Hodgkinson et al., 1997
;
Marston et al., 1998
). In nonmuscle cells, the diversity of
tropomyosins is very large (Pittenger et al., 1994
; Gunning
et al., 1997
; Lin et al., 1997
), and caldesmon
specifically interacts with particular isoforms (Yamashiro-Matsumura
and Matsumura, 1988
; Novy et al., 1993
; Pittenger et
al., 1995
), the biological significance of which remains unclear.
Based on our results demonstrating the ability of caldesmon to regulate
adhesion-dependent signaling, we suggest that specific tropomyosins
could be important in maintaining the normal signaling function in the
cell. This may provide a clue to explain the enigmatic correlation
between the spectrum of tropomyosin isoforms and neoplastic
transformation (Prasad et al., 1993
; Braverman et
al., 1996
; Gimona et al., 1996
; Janssen and Mier,
1997
).
Future studies will determine more precisely how caldesmon contributes to the regulation of nonmuscle cell contractility, how its function is regulated, and what role caldesmon plays in the signaling cascades associated with adhesion-mediated signal transduction.
| |
ACKNOWLEDGMENTS |
|---|
We thank Avri Ben-Ze'ev and Benny Geiger for encouragement and interesting discussions, Fumio Matsumura for the nonmuscle caldesmon cDNA, and Alan Hall for Rho A-V14 and C3 toxin cDNA. These studies were supported in part by grants from Minerva Foundation, Israel Science Foundation, Israel Ministry of Science, and La Fondation Rapael et Regina Levy (to A.D.B.). Participation of M.E. was supported in part by the Israel Science Foundation and by the G.M.J. Schmidt Minerva Center for Supramolecular Architecture. C.B. is the recipient of a postdoctoral fellowship from the American Heart Association, New York State Affiliate. D.M.H. is supported by National Cancer Institute grant CA58607 and was the recipient of a Michael visiting professorship from the Weizmann Institute of Science.
| |
FOOTNOTES |
|---|
These authors contributed equally to this work.
Corresponding author. E-mail address:
libersha{at}weizmann.weizmann.ac.il.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. Kantawong, R. Burchmore, N. Gadegaard, R. O.C Oreffo, and M. J Dalby Proteomic analysis of human osteoprogenitor response to disordered nanotopography J R Soc Interface, February 9, 2009; (2009) rsif.2008.0447v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-P. Zheng, L.-A. Severijnen, M. van der Weiden, R. Willemsen, and J. M. Kros A crucial role of caldesmon in vascular development in vivo Cardiovasc Res, February 1, 2009; 81(2): 362 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. M. Goeckeler, P. C. Bridgman, and R. B. Wysolmerski Nonmuscle myosin II is responsible for maintaining endothelial cell basal tone and stress fiber integrity Am J Physiol Cell Physiol, October 1, 2008; 295(4): C994 - C1006. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Le Clainche and M.-F. Carlier Regulation of Actin Assembly Associated With Protrusion and Adhesion in Cell Migration Physiol Rev, April 1, 2008; 88(2): 489 - 513. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Basile, J. Gavard, and J. S. Gutkind Plexin-B1 Utilizes RhoA and Rho Kinase to Promote the Integrin-dependent Activation of Akt and ERK and Endothelial Cell Motility J. Biol. Chem., November 30, 2007; 282(48): 34888 - 34895. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yokouchi, Y. Numaguchi, R. Kubota, M. Ishii, H. Imai, R. Murakami, Y. Ogawa, T. Kondo, K. Okumura, D. E. Ingber, et al. l-Caldesmon Regulates Proliferation and Migration of Vascular Smooth Muscle Cells and Inhibits Neointimal Formation After Angioplasty Arterioscler. Thromb. Vasc. Biol., October 1, 2006; 26(10): 2231 - 2237. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Connell and D. M. Helfman Myosin light chain kinase plays a role in the regulation of epithelial cell survival J. Cell Sci., June 1, 2006; 119(11): 2269 - 2281. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Eves, B. A. Webb, S. Zhou, and A. S. Mak Caldesmon is an integral component of podosomes in smooth muscle cells J. Cell Sci., May 1, 2006; 119(9): 1691 - 1702. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Hoffman, C. C. Jensen, S. Kloeker, C.-L. A. Wang, M. Yoshigi, and M. C. Beckerle Genetic ablation of zyxin causes Mena/VASP mislocalization, increased motility, and deficits in actin remodeling J. Cell Biol., February 27, 2006; 172(5): 771 - 782. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Matthews, D. R. Overby, R. Mannix, and D. E. Ingber Cellular adaptation to mechanical stress: role of integrins, Rho, cytoskeletal tension and mechanosensitive ion channels J. Cell Sci., February 1, 2006; 119(3): 508 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Cuomo, A. Knebel, G. Platt, N. Morrice, P. Cohen, and S. Mittnacht Regulation of Microfilament Organization by Kaposi Sarcoma-associated Herpes Virus-cyclin{middle dot}CDK6 Phosphorylation of Caldesmon J. Biol. Chem., October 28, 2005; 280(43): 35844 - 35858. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shemesh, B. Geiger, A. D. Bershadsky, and M. M. Kozlov Focal adhesions as mechanosensors: A physical mechanism PNAS, August 30, 2005; 102(35): 12383 - 12388. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Foster, R. Huang, V. Hatch, R. Craig, P. Graceffa, W. Lehman, and C.-L. A. Wang Modes of Caldesmon Binding to Actin: SITES OF CALDESMON CONTACT AND MODULATION OF INTERACTIONS BY PHOSPHORYLATION J. Biol. Chem., December 17, 2004; 279(51): 53387 - 53394. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Scaife, R. Brown, S. Kellie, A. Filer, S. Martin, A. M. C. Thomas, P. F. Bradfield, N. Amft, M. Salmon, and C. D. Buckley Detection of differentially expressed genes in synovial fibroblasts by restriction fragment differential display Rheumatology, November 1, 2004; 43(11): 1346 - 1352. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Haxhinasto, A. Kamath, K. Blackwell, J. Bodmer, J. Van Heukelom, A. English, E.-W. Bai, and A. B. Moy Gene delivery of l-caldesmon protects cytoskeletal cell membrane integrity against adenovirus infection independently of myosin ATPase and actin assembly Am J Physiol Cell Physiol, October 1, 2004; 287(4): C1125 - C1138. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dhawan and D. M. Helfman Modulation of acto-myosin contractility in skeletal muscle myoblasts uncouples growth arrest from differentiation J. Cell Sci., August 1, 2004; 117(17): 3735 - 3748. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, J. L. C. Lin, R. S. Reiter, K. Daniels, D. R. Soll, and J. J. C. Lin Caldesmon mutant defective in Ca2+-calmodulin binding interferes with assembly of stress fibers and affects cell morphology, growth and motility J. Cell Sci., July 15, 2004; 117(16): 3593 - 3604. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-P. Zheng, A. M. Sieuwerts, T. M. Luider, M. van der Weiden, P. A.E. Sillevis-Smitt, and J. M. Kros Differential Expression of Splicing Variants of the Human Caldesmon Gene (CALD1) in Glioma Neovascularization versus Normal Brain Microvasculature Am. J. Pathol., June 1, 2004; 164(6): 2217 - 2228. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. H. Lin, Z.-Y. Park, D. Lin, A. A. Brahmbhatt, M.-C. Rio, J. R. Yates III, and R. L. Klemke Regulation of cell migration and survival by focal adhesion targeting of Lasp-1 J. Cell Biol., May 10, 2004; 165(3): 421 - 432. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Conway, A. P. Maxwell, D. A. Savage, C. C. Patterson, P. P. Doran, M. Murphy, H. R. Brady, and D. G. Fogarty Association Between Variation in the Actin-Binding Gene Caldesmon and Diabetic Nephropathy in Type 1 Diabetes Diabetes, April 1, 2004; 53(4): 1162 - 1165. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Y. Zhang, R. Stein, S. Chang, Y. Zheng, S. A. Zderic, A. J. Wein, and S. Chacko Smooth Muscle Hypertrophy Following Partial Bladder Outlet Obstruction Is Associated with Overexpression of Non-Muscle Caldesmon Am. J. Pathol., February 1, 2004; 164(2): 601 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Emmert, J. A. Fee, Z. M. Goeckeler, J. M. Grojean, T. Wakatsuki, E. L. Elson, B. P. Herring, P. J. Gallagher, and R. B. Wysolmerski Rho-kinase-mediated Ca2+-independent contraction in rat embryo fibroblasts Am J Physiol Cell Physiol, January 1, 2004; 286(1): C8 - C21. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Kuo, J.-R. Lin, J. M. Staddon, H. Hosoya, and R.-H. Chen Uncoordinated regulation of stress fibers and focal adhesions by DAP kinase J. Cell Sci., December 1, 2003; 116(23): 4777 - 4790. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zaidel-Bar, C. Ballestrem, Z. Kam, and B. Geiger Early molecular events in the assembly of matrix adhesions at the leading edge of migrating cells J. Cell Sci., November 15, 2003; 116(22): 4605 - 4613. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hu, J. Chen, B. Fabry, Y. Numaguchi, A. Gouldstone, D. E. Ingber, J. J. Fredberg, J. P. Butler, and N. Wang Intracellular stress tomography reveals stress focusing and structural anisotropy in cytoskeleton of living cells Am J Physiol Cell Physiol, November 1, 2003; 285(5): C1082 - C1090. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ben-Ya'acov and S. Ravid Epidermal Growth Factor-mediated Transient Phosphorylation and Membrane Localization of Myosin II-B Are Required for Efficient Chemotaxis J. Biol. Chem., October 10, 2003; 278(41): 40032 - 40040. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Borbiev, A. D. Verin, A. Birukova, F. Liu, M. T. Crow, and J. G. N. Garcia Role of CaM kinase II and ERK activation in thrombin-induced endothelial cell barrier dysfunction Am J Physiol Lung Cell Mol Physiol, July 1, 2003; 285(1): L43 - L54. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Hinz, V. Dugina, C. Ballestrem, B. Wehrle-Haller, and C. Chaponnier {alpha}-Smooth Muscle Actin Is Crucial for Focal Adhesion Maturation in Myofibroblasts Mol. Biol. Cell, June 1, 2003; 14(6): 2508 - 2519. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Manes, D.-Q. Zheng, S. Tognin, A. S. Woodard, P. C. Marchisio, and L. R. Languino {alpha}v{beta}3 integrin expression up-regulates cdc2, which modulates cell migration J. Cell Biol., May 26, 2003; 161(4): 817 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yamakita, F. Oosawa, S. Yamashiro, and F. Matsumura Caldesmon Inhibits Arp2/3-mediated Actin Nucleation J. Biol. Chem., May 9, 2003; 278(20): 17937 - 17944. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Brahmbhatt and R. L. Klemke ERK and RhoA Differentially Regulate Pseudopodia Growth and Retraction during Chemotaxis J. Biol. Chem., April 4, 2003; 278(15): 13016 - 13025. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kirchner, Z. Kam, G. Tzur, A. D. Bershadsky, and B. Geiger Live-cell monitoring of tyrosine phosphorylation in focal adhesions following microtubule disruption J. Cell Sci., March 15, 2003; 116(6): 975 - 986. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, H.-D. Je, S. Malek, and K. G. Morgan ERK1/2-mediated phosphorylation of myometrial caldesmon during pregnancy and labor Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2003; 284(1): R192 - R199. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Grove, V. V. Prabhu, B. L. Young, F. C. Lee, V. Kulpa, P. J. Munson, and E. C. Kohn Both Protein Activation and Gene Expression Are Involved in Early Vascular Tube Formation in Vitro Clin. Cancer Res., September 1, 2002; 8(9): 3019 - 3026. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pawlak and D. M. Helfman MEK Mediates v-Src-induced Disruption of the Actin Cytoskeleton via Inactivation of the Rho-ROCK-LIM Kinase Pathway J. Biol. Chem., July 19, 2002; 277(30): 26927 - 26933. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Cho and R. L. Klemke Purification of pseudopodia from polarized cells reveals redistribution and activation of Rac through assembly of a CAS/Crk scaffold J. Cell Biol., February 18, 2002; 156(4): 725 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Riveline, E. Zamir, N. Q. Balaban, U. S. Schwarz, T. Ishizaki, S. Narumiya, Z. Kam, B. Geiger, and A. D. Bershadsky Focal Contacts as Mechanosensors: Externally Applied Local Mechanical Force Induces Growth of Focal Contacts by an mDia1-dependent and ROCK-independent Mechanism J. Cell Biol., June 4, 2001; 153(6): 1175 - 1186. [Abstract] [Full Text] [PDF] |
||||
![]() |
I Grosheva, M Shtutman, M Elbaum, and A. Bershadsky p120 catenin affects cell motility via modulation of activity of Rho-family GTPases: a link between cell-cell contact formation and regulation of cell locomotion J. Cell Sci., January 2, 2001; 114(4): 695 - 707. [Abstract] [PDF] |
||||
![]() |
S. Yamashiro, H. Chern, Y. Yamakita, and F. Matsumura Mutant Caldesmon Lacking cdc2 Phosphorylation Sites Delays M-Phase Entry and Inhibits Cytokinesis Mol. Biol. Cell, January 1, 2001; 12(1): 239 - 250. [Abstract] [Full Text] |
||||
![]() |
H. Lee, D. Volonte, F. Galbiati, P. Iyengar, D. M. Lublin, D. B. Bregman, M. T. Wilson, R. Campos-Gonzalez Boumediene Bouzahzah, R. G. Pestell, P. E. Scherer, et al. Constitutive and Growth Factor-Regulated Phosphorylation of Caveolin-1 Occurs at the Same Site (Tyr-14) in Vivo: Identification of a c-Src/Cav-1/Grb7 Signaling Cassette Mol. Endocrinol., November 1, 2000; 14(11): 1750 - 1775. [Abstract] [Full Text] |
||||
![]() |
B.-Z. Katz, E. Zamir, A. Bershadsky, Z. Kam, K. M. Yamada, and B. Geiger Physical State of the Extracellular Matrix Regulates the Structure and Molecular Composition of Cell-Matrix Adhesions Mol. Biol. Cell, March 1, 2000; 11(3): 1047 - 1060. [Abstract] [Full Text] |
||||
![]() |
M. J. McManus, J. L. Boerner, A. J. Danielsen, Z. Wang, F. Matsumura, and N. J. Maihle An Oncogenic Epidermal Growth Factor Receptor Signals via a p21-activated Kinase-Caldesmon-Myosin Phosphotyrosine Complex J. Biol. Chem., November 3, 2000; 275(45): 35328 - 35334. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Cho and R. L. Klemke Purification of pseudopodia from polarized cells reveals redistribution and activation of Rac through assembly of a CAS/Crk scaffold J. Cell Biol., February 18, 2002; 156(4): 725 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pawlak and D. M. Helfman Post-transcriptional Down-regulation of ROCKI/Rho-kinase through an MEK-dependent Pathway Leads to Cytoskeleton Disruption in Ras-transformed Fibroblasts Mol. Biol. Cell, January 1, 2002; 13(1): 336 - 347. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||