|
|
|
|
Vol. 10, Issue 10, 3171-3186, October 1999


¶
*Department of Molecular, Cellular and Developmental Biology,
University of Colorado, Boulder, Colorado 80309-0347;
Washington University School of Medicine, St. Louis,
Missouri 63110; §Department of Molecular Biology and
Genetics, Johns Hopkins University School of Medicine, Baltimore,
Maryland 21205; and
Medical Research Council
Human Genetics Unit, Western General Hospital, Edinburgh EH4 2XU,
United Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
Although silencing is a significant form of transcriptional
regulation, the functional and mechanistic limits of its conservation have not yet been established. We have identified the
Schizosaccharomyces pombe hst4+ gene as a
member of the SIR2/HST silencing gene
family that is defined in organisms ranging from bacteria to humans.
hst4
mutants grow more slowly than wild-type cells
and have abnormal morphology and fragmented DNA. Mutant strains show
decreased silencing of reporter genes at both telomeres and
centromeres. hst4+ appears to be important
for centromere function as well because mutants have elevated
chromosome-loss rates and are sensitive to a microtubule-destabilizing
drug. Consistent with a role in chromatin structure, Hst4p localizes to
the nucleus and appears concentrated in the nucleolus.
hst4
mutant phenotypes, including growth and
silencing phenotypes, are similar to those of the Saccharomyces cerevisiae HSTs, and at a molecular level,
hst4+ is most similar to
HST4. Furthermore, hst4+ is a
functional homologue of S. cerevisiae HST3 and
HST4 in that overexpression of
hst4+ rescues the temperature-sensitivity
and telomeric silencing defects of an hst3
hst4
double mutant. These results together demonstrate that a
SIR-like silencing mechanism is conserved in the
distantly related yeasts and is likely to be found in other organisms
from prokaryotes to mammals.
| |
INTRODUCTION |
|---|
|
|
|---|
Transcriptional silencing is a general mechanism for regulating
the genome that can occur through alterations of large regions of
chromatin structure. This phenomenon has been studied extensively in
Drosophila melanogaster, in which placement of a gene
adjacent to heterochromatic regions can result in its variegated
expression, and in the yeasts Saccharomyces cerevisiae and
Schizosaccharomyces pombe (Weiler and Wakimoto, 1995
). In
S. cerevisiae, at least three loci are known to be silenced:
the silent mating-type loci, the telomeres, and the rDNA repeats
(reviewed by Loo and Rine, 1995
; Sherman and Pillus, 1997
; Lowell and
Pillus, 1998
). These silenced regions are inaccessible to DNA-modifying
enzymes and have a special chromatin structure that is also
inaccessible to transcriptional machinery (Nasmyth, 1982
; Gottschling,
1992
; Singh and Klar, 1992
; Kyrion et al., 1993
; Loo and
Rine, 1994
; Fritze et al., 1997
; Smith and Boeke, 1997
;
Singh et al., 1998
). Several cis- and
trans-acting factors are required for transcriptional silencing in S. cerevisiae, including the four Silent
Information Regulator (SIR) genes (Loo and Rine, 1995
).
SIR2 is unique among the SIR genes in that it is
required for silencing at all three loci (Shore et al.,
1984
; Ivy et al., 1986
; Aparicio et al., 1991
; Bryk et al., 1997
; Fritze et al., 1997
; Smith and
Boeke, 1997
; reviewed by Sherman and Pillus, 1997
). It has been
proposed that SIR2 participates in regulating the level of
histone deacetylation and thus the structural compactness of chromatin
at these loci (Braunstein et al., 1993
), although it has not
been established if this regulation is direct. Indeed, histones can be
modified not only through acetylation but also by means of methylation, phosphorylation, ubiquitination, and ADP ribosylation (Van Holde, 1989
;
Wolffe, 1992
). Thus, it is possible that SIR2's role may be
catalytic or may regulate one or more of these modifications.
A family of SIR2-related HST (Homologues of
SIR2) genes has been identified in organisms ranging from
bacteria to humans, including four additional genes in S. cerevisiae (Chen and Clark-Walker, 1994
; Brachmann et
al., 1995
; Derbyshire et al., 1996
; Yahiaoui et
al., 1996
; Tsang and Escalante-Semerena, 1998
; Zemzoumi
et al., 1998
; Frye, 1999
; Perez-Martin et al.,
1999
). Members of this gene family share between 26 and 63% identity
over the full lengths of their ORFs and contain a central core domain
of ~155 amino acids (Figure 1, bounded
by arrowheads) where identity is as high as 89% (Brachmann et
al., 1995
). The core domain contains two conserved sequence motifs
of unknown function (Figure 1, solid line) and two pairs of cysteines
(Figure 1, dots) that may form a noncanonical zinc finger. The core
domain and each of the conserved sequence motifs and cysteines are
essential for Sir2p silencing activity (Sherman et al.,
1999
). Furthermore, the core domain specifies a conserved silencing
function, because a chimeric protein substituting the core domain of a
human homologue within Sir2p functions in transcriptional silencing in
S. cerevisiae (Sherman et al., 1999
).
|
The HSTs are divided into three subfamilies based on the
overall sequence identities of their encoded proteins (Brachmann et al., 1995
). The first contains S. cerevisiae,
Kluyveromyces lactis, and Candida albicans SIR2
homologues and HST1 from S. cerevisiae (Chen and
Clark-Walker, 1994
; Brachmann et al., 1995
; Derbyshire
et al., 1996
; Perez-Martin et al., 1999
). The
second contains HST3 and HST4 of S. cerevisiae as well as hst4+, the
S. pombe homologue described here. The third subfamily
contains HST2 and homologues from many other organisms.
Homo sapiens has at least five homologues (Brachmann
et al., 1995
; Frye, 1999
). Members from the first and second
subfamilies have demonstrated roles in transcriptional silencing. As
noted above, SIR2 is required at each of the silenced loci
in S. cerevisiae, and sir2
phenotypes can be
partially rescued by overexpressed HST1 or K. lactis or C. albicans SIR2 homologues (Chen and
Clark-Walker, 1994
; Brachmann et al., 1995
; Derbyshire
et al., 1996
; Perez-Martin et al., 1999
). Mutants
in the second subfamily also have silencing defects. Although neither
the hst3
nor the hst4
single mutant has a
strong phenotype individually, an hst3
hst4
double
mutant has a variety of defects, including loss of telomeric silencing.
The double mutant is also temperature sensitive for growth, is
hypersensitive to UV radiation in combination with a rad9
mutant, and displays defects in chromosome segregation (Brachmann
et al., 1995
). Thus, in addition to their role in
transcriptional silencing, HST3 and HST4
contribute to cell cycle control, DNA damage, and genomic stability.
Here we report the identification of a S. pombe SIR2
homologue, thereby extending the SIR2 family to fission
yeast. In S. pombe as in S. cerevisiae, genes
placed adjacent to the silent mating-type loci (Thon and Klar, 1992
;
Thon et al., 1994
) or telomeres (Nimmo et al.,
1994
) are silenced. Reporter genes are also silenced when placed within
the relatively complex centromeres (Allshire et al., 1994
,
1995
), a regulation that is not found in budding yeast. Many silencing
genes have been discovered in S. pombe, predominantly
through screens focused on regulation of the silent mating loci. These
genes include clr1+,
clr2+, clr3+,
clr4+, clr6+,
rik1+, and
swi6+, a homologue of the D. melanogaster heterochromatin protein HP1 (Egel et al.,
1989
; Lorentz et al., 1992
, 1994
; Thon and Klar, 1992
;
Ekwall and Ruusala, 1994
; Thon et al., 1994
; Grewal et
al., 1998
). Swi6 protein localizes to all three silenced loci in
S. pombe and is important for transcriptional silencing at
all three sites (Lorentz et al., 1992
, 1994
; Allshire
et al., 1995
; Ekwall et al., 1995
; Grewal and
Klar, 1997
). Four of the silencing genes, rik1+, swi6+,
clr4+, and
clr6+, are also important for chromosome
segregation (Allshire et al., 1995
; Ekwall et
al., 1995
, 1996
; Grewal et al., 1998
). Furthermore, all
but clr6+ have been demonstrated to repress
meiotic recombination at the mating loci (Egel et al., 1989
;
Klar and Bonaduce, 1991
; Lorentz et al., 1992
; Thon and
Klar, 1992
; Thon et al., 1994
). Although extensive genetic
screens have been carried out to identify additional silencing genes in
fission yeast, no homologues of the SIR silencing genes have
been previously identified.
This study describes the cloning and phenotypic characterization of the
S. pombe hst4+ gene. S. pombe
hst4
mutants have phenotypes pointing to defects in chromatin
structure and function. hst4+ is not an
essential gene, but mutants display growth and morphological defects as
well as defects in transcriptional silencing, centromeric function, and
genomic stability. Thus, members of the SIR2/HST subfamilies
are likely to be similar in both molecular detail and organismal function.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Strains and Culture Conditions
Genotypes of the strains used are presented in Table
1. S. pombe strains were grown
in yeast extract (YE), yeast extract plus supplements (YES), or
Edinburgh Minimal Medium (EMM) (Moreno et al., 1991
). Malt
extract plates were used for sporulation (BIO 101, Vista, CA). 5-FOA
plates are EMM supplemented with 1 g/l 5-FOA (Toronto Research
Chemicals, North York, Ontario, Canada). For scoring of sectored
colonies, YE medium was supplemented with 12 mg/l adenine. S. pombe cells were grown at 32°C on plates and at 30°C in liquid
culture unless otherwise noted. Crosses were carried out by mixing
fresh cultures on malt extract plates and either selecting for diploids
after 18 h or sporulating for 3 d before dissecting tetrads.
Transformations were performed with the use of a lithium acetate
protocol (Moreno et al., 1991
), with the following
modifications. A 50-ml culture was grown to an optical density
(A600) of ~0.6. The cells were resuspended in
10 ml of 0.1 M lithium acetate and incubated at 32°C for 45 min before resuspending in 0.5 ml of 0.1 M lithium acetate.
After adding DNA and polyethylene glycol, the cells were incubated at
32°C for 40 min followed by 20 min at 45°C. Cells were resuspended in 100 µl of water and plated on EMM plates supplemented with appropriate amino acids.
|
S. cerevisiae were grown in YPD or minimal medium lacking
the appropriate nutrient for plasmid selection (Sherman, 1991
). 5-FOA
plates were made by adding 1 g/l 5-FOA to the supplemented minimal
medium. Cells were grown at 30°C unless otherwise specified. Transformations were carried out with the use of a lithium acetate protocol (Schiestl and Gietz, 1989
). The GAL10 galactose
inducible promoter was induced in 2% galactose. These cultures
were then plated onto rich or minimal plates with 2% galactose as the
carbon source.
Oligonucleotide Primers Used in This Study
Primers (5'-3') used in this study were as follows: JB708, RTCDATRTTYTGNGTRTA; JB710, GGNRTNCCNGAYTTYMG; 5'EagI, ATATACTGCAGATGGGCGGCCGTAAAGTGGAGGAGCACGTC; 3'XhoI, CCGTGAAGAGGAATCGTG; T7, TAATACGACTCACTATAGGG; promoter, AAACTGCAGCTACGTAAATTTGGAATTTC; 5'start, ACCGCGTACCGTCAATCAC; 5'us, GTTTACTATCCCATAACGT; his3A, GTAAGAAGAAAGCGATCGATGAG; 5'hst4-ura4, GGATTTTAATATATTTTATTAAGGCACTCAACTTTTTGGATTTAAGAAATTCCAAATTTACGTAGCTTAGTAAGCTTAGCTACAAATCCCACTG; 3'hst4-ura4, CAGGCATTATTTAAACCTCATTTGGGGTAAGAAGGATAAATTGATATTTTTAACATGGTTTATTGAAGCAAGCTTGTGATATTGACGAAAC; ko check, GCAATTAACCAACGCGAC; and ura4B, GATTGGTGTTGGAACAGA.
hst4+ Identification and Plasmid Construction
We used degenerate primers JB708 and JB710 and a touchdown
molecular amplification protocol as described (Brachmann et
al., 1995
) to probe genomic DNA and genomic and cDNA libraries. We obtained evidence for multiple members of the HST family in
S. pombe (Freeman-Cook and Pillus, unpublished results) and
focused our analysis on an ~250-base pair (bp) fragment from a
S. pombe cDNA library (a generous gift of F. LaCroute,
Centre de Genetique Moleculare, Gif-sur-Yvette, France). The
band was purified, labeled, and used to probe a genomic library (Weaver
et al., 1993
). A full-length clone was isolated, and the
gene was cloned from the library vector into Bluescript
pKS+ (Stratagene, La Jolla, CA) and pUC19 (New
England Biolabs, Beverly, MA) in two steps: a 1.7-kilobase (kb)
EcoRI fragment containing the 3' end of the gene was added
to a 1.3-kb PstI/EcoRI fragment containing the
promoter and the 5' end of the gene (pLP554 in pKS+ and pLP553 in pUC19). These clones contain a
125-bp intron in the 5' end of the gene after nucleotide 193 that was
removed with the use of a molecular amplification strategy while
simultaneously creating an EagI site directly downstream of
the start codon to facilitate epitope tagging. Primers
5'EagI and 3'XhoI were used to amplify a spliced
version of the 5' end of the gene from a cDNA library. This 0.5-kb
molecular amplification product was sequenced, digested with
PstI/BglII, and cloned into pLP554 at PstI/BglII to create pLP591. This clone has the
5' intron and the promoter deleted. A three-amino acid insertion (GGR)
was created directly after the starting methionine to create the
EagI restriction site. The genetic map position of
hst4+ was determined by probing an ordered
S. pombe cosmid filter (Hoheisel et al., 1993
).
Epitope Tagging and Expression
hst4+ was epitope tagged by
inserting triple HA- (influenza virus hemagglutinin, from pLP8
[Wilson et al., 1984
]) or protein A (proA) (from pLP580
[Aitchison et al., 1995
]) tags as NotI
fragments into the EagI site of pLP591 to create pLP607 or
pLP744, respectively.
Plasmids for hst4+ expression in S. cerevisiae were constructed with the use of pLP548 in which the
GAL1/GAL10 divergent promoter was cloned into
pRS313 (Sikorski and Hieter, 1989
) as a 0.7-kb EcoRI/BamHI fragment.
SmaI/EcoRV fragments from pLP607 and pLP744, containing the entire hst4+ ORF, were
inserted into the EcoRV site of pLP548. The resulting plasmids have N-terminal HA- (pLP610) and proA- (pLP748 and pLP749) tagged hst4+ under the control of the
GAL10 inducible promoter.
For expression studies in S. pombe with the endogenous
hst4+ promoter, primers T7 and promoter
were used to amplify a 1-kb fragment from pLP554, which was then cut
with PstI and inserted into the PstI site of
pLP744 to create pLP935 (proA). A SacI fragment from pLP935
was then cloned into the S. pombe LEU2 vector pSK248 (Stone
et al., 1993
) to create pLP1093 for the proA tag.
Null Mutant Construction
The hst4
::his3+ null
mutant was created by replacing the core domain of
hst4+ from amino acids 75-162 with a
1.9-kb fragment containing the his3+ gene.
To use the 5' EcoRI site of
hst4+ to insert
his3+, we deleted the 3' EcoRI
site of hst4+. A
PstI/ClaI fragment with the ClaI site
filled with VENT polymerase (New England Biolabs) prepared from pLP553
was ligated into Bluescript pKS+ at
PstI/XhoI with the XhoI site filled to
create pLP1077. This plasmid was digested with
EcoRI/XhoI and filled in, and a 1.9-kb filled-in
BglII his3+ fragment from pAF1
(Ohi et al., 1996
) was inserted to create pLP862.
Approximately 2 µg of a 3.3-kb BsaAI fragment from pLP862 was transformed into LPY3170. Among candidate
his+ transformants, the correct disruption was
verified by molecular amplification with the use of primers 5'start,
3'XhoI, 5'us, and his3A and confirmed by Southern
blot analysis. The hst4
::ura4+
complete null mutant, replacing the entire ORF with a 1.8-kb ura4+ gene fragment, was created with the
use of primers 5'hst4-ura4 and
3'hst4-ura4. Approximately 3 µg of the
molecular amplification product was transformed into LPY3277, and
colonies were selected that could grow on medium lacking uracil but
could no longer grow on medium lacking histidine. The null mutant was
confirmed by molecular amplification with the use of primers 5'us,
his3A, ko check, and ura4B. The two null alleles
were created with different markers to facilitate silencing assays with
either a ura4+ or a
his3+ reporter gene. Both alleles have the
same growth and morphology phenotypes (our unpublished results), and
thus both appear to be complete-loss-of-function alleles.
Sequence Analysis
Alignments were generated with the use of the PILEUP program (Wisconsin Package Version 10.0, Genetics Computer Group, Madison, WI) with homologue sequences obtained from GenBank. Pairwise comparisons were performed with the use of the BESTFIT program from the Genetics Computer Group. Default settings were used for PILEUP, BESTFIT, and BLAST analysis. Database searches were performed with the use of the National Center for Biotechnology Information BLAST network service (www.ncbi.nlm.nih.gov) and the Sanger Center S. pombe database search service (www.sanger.ac.uk). The hst4+ nucleotide sequence has been submitted to GenBank under accession number AF173939.
Cytological Techniques
S. pombe cells were prepared for DAPI staining by
fixing 1 ml of a saturated culture in 1 ml of 30% methanol (MeOH)/70%
acetone for at least 20 min at
20°C. Cells were rehydrated with
5-min washes in 100 µl of 75, 50, and 25% MeOH in PBS. Cells were
then resuspended in 100 µl of PBS, and 6 µl of cells was mixed with 1 µl of DAPI (0.25 µg/ml; Boehringer Mannheim, Indianapolis, IN) on
a slide immediately before viewing. For immunofluorescence, 30 ml of
cells was grown to an optical density of 0.3-0.5, centrifuged, and
resuspended in 10 ml of MeOH at
20°C for 15 min. Cells were then
washed in 1 ml of 60% MeOH/40% PBS, washed in 1 ml of PBS, and
resuspended in 1 ml of PBS plus 1.2 M sorbitol with 0.25 mg/ml zymolyase (70,000 U/g, ICN, Costa Mesa, CA) at 37°C for 30 min. Cells were then resuspended in 1 ml of 1% Triton X-100 in PBS for
1 min, washed three times in 1 ml of PBS, and stored in 500 µl of PBS
plus 1% BSA plus 100 mM lysine-HCl (PBSBL) at 4°C overnight. Multiple-well slides for immunofluorescence were prepared by adding 10 µl of 0.1% poly-L-lysine to each well for 30 min, washing six times with 10 µl of water, and air drying. Ten
microliters of cell suspension was added to each well for 30 min. After
aspirating the remaining liquid, the cells were dried onto the slide.
All antibodies were diluted in PBSBL. Primary antibody incubation was
at room temperature for 16 h in a moist chamber (1:2000 dilution of rabbit immunoglobulin G [Sigma, St. Louis, MO] for proA or 1:100
dilution of anti-Nop1 D77 [Aris and Blobel, 1988
]). Cells were then
washed six times in PBSBL, followed by the addition of secondary
antibody for 20 h at room temperature (1:200
fluorescein-conjugated donkey anti-rabbit antibody [Amersham,
Piscataway, NJ] or 1:300 Texas Red-conjugated goat anti-mouse
antibody [Jackson Immunoresearch, West Grove, PA]). Cells were then
washed four times with 10 µl of PBSBL, incubated in 10 µl of 0.25 µg/ml DAPI for 5 min, and washed six times with 10 µl of PBSBL. The
cells were then dried on the slide and were mounted with Citifluor (Ted
Pella, Redding, CA). Staining was visualized with a Leica (Heidelberg,
Germany) DMRXA microscope with a Cooke (Tonawanda, NY)
Sensicam charge-coupled device camera. Images were captured and
manipulated with the use of SlideBook software (Intelligent Imaging
Innovations, Denver, CO).
Pedigree Analysis
Individual cells from populations grown to stationary phase in
liquid YES were micromanipulated onto YES plates and grown at 32°C.
Three classes of cells were identified for micromanipulation: wild-type
cells, hst4
cells that appeared to be normal in cell size, and hst4
cells that were at least three times as
long as wild-type cells. These cells were then monitored at intervals to determine subsequent divisions. The number of cells examined reflects the number that could be readily micromanipulated and monitored on three plates.
UV Sensitivity Assay
Saturated cultures from a series of fivefold dilutions in a 96-well plate were plated onto YES plates with the use of a pin replicator. The plates were treated with 80 J/m2 UV irradiation with the use of a Stratalinker (Stratagene) immediately after plating and again after 12 h. Control plates were left untreated. Plates were placed in a dark box to prevent photoreactivation and incubated at 30°C.
Silencing Assays
Assays were performed to evaluate the expression level of
reporter genes placed at seven silenced loci: within cnt1,
cnt3, otr1, and imr1, at the telomere
of the linear minichromosome Ch16, at the endogenous telomere of
chromosome I, and adjacent to the silent mating loci (Thon and Klar,
1992
; Allshire et al., 1994
, 1995
; Nimmo et al.,
1994
, 1998
). Saturated cultures from a series of fivefold dilutions
were plated onto YES, supplemented EMM, and 5-FOA plates. Plates were
incubated at 32°C or room temperature (~20°C) until full growth
was achieved (3-10 d). Plates were incubated for extended periods to
ensure that any differences seen were not due simply to the slow growth
of the hst4
mutant strains.
Minichromosome-Loss Assay
LPY3552 and its hst4
derivative, LPY3551,
containing the linear minichromosome Ch16 (Nimmo et al.,
1994
) were used to determine chromosome stability. Ch16 carries the
ade6-216 mutation that complements the ade6-210
allele present at the chromosomal locus. Loss of the minichromosome in
an ade6-210 background results in red color formation on YE
plates supplemented with minimal adenine (12 mg/l). The frequency of
chromosome loss is calculated from the frequency of half-sectored
colonies, as described by Allshire et al. (1995)
. Three
separate isolates were examined for the wild-type strain and four
isolates were examined for the hst4
strain, for a total
of 14,529 and 18,059 colonies, respectively. The chromosome-loss experiments were all performed at 30°C, although it has been noted in
other studies that chromosome loss is further elevated at decreased temperatures (Ekwall et al., 1996
). The results reported
here likely represent a conservative estimate of the severity of the chromosome-loss phenotype.
| |
RESULTS |
|---|
|
|
|---|
Identification of a S. pombe Homologue of SIR2
We used degenerate primers designed from two highly conserved
sequence motifs (Brachmann et al., 1995
) to amplify a 250-bp fragment from a S. pombe cDNA library that was then used to
isolate a full-length genomic clone of the gene that we have named
hst4+.
hst4+ encodes a 416-amino acid predicted
ORF that maps to chromosome I between ras1+
and cdc3+ (see MATERIALS AND METHODS).
hst4+ contains both sequence motifs and the
two pairs of cysteines characteristic of the HSTs (Figure
1). Comparison of cDNA and genomic sequences revealed that
hst4+ contains a single 125-bp intron that
splits the first of the conserved sequence motifs. Table
2 shows expect (E) values from BLAST analysis for S. pombe Hst4p relative to Sir2p and each
of the other S. cerevisiae homologues. The table also shows
percent identity and similarity from BESTFIT analysis of full-length
S. pombe Hst4p to each of the homologues as well as a
comparison of the core domains. The sequence analysis reveals that
hst4+ is a member of the subfamily
represented by HST3 and HST4 and is most closely
related to HST4. Figure 1 shows an alignment of the
full-length S. pombe Hst4p with S. cerevisiae
Hst3p and Hst4p, illustrating the high level of similarity present
throughout the proteins.
|
hst4
Mutants Have Multiple Growth and Morphological Defects
To better understand the function of
hst4+, we created heterozygous null alleles
in diploid cells by replacing a large portion of the core domain
containing both conserved sequence motifs with the
his3+ gene or by replacing the entire ORF
with ura4+. The region of the core deleted
in the his3+ allele is essential for
SIR2 function in S. cerevisiae (Sherman et
al., 1999
). After sporulating the heterozygous diploids, tetrads were dissected and germinated to reveal four viable spore products. Thus, hst4+ is not an essential gene. When
hst4
mutant and wild-type cells were compared by flow
cytometry, both strains looked comparable, indicating that there were
no major defects in cell cycle progression (our unpublished results).
Although viable, hst4
haploid cells have growth defects.
The two hst4
spores produced smaller colonies than the
wild-type spores. Figure 2 shows a
dilution assay in which fivefold dilutions of four spore products from
the same tetrad were plated onto rich medium at 32°C. The two null
strains grew to the same dilution as their wild-type sister strains,
but the colony size was much smaller. This phenotype was observed at
all temperatures tested (14-37°C) (Figure 2 and our unpublished results). After prolonged growth, mutant and wild-type colonies eventually reached the same size.
|
Morphological defects in hst4
cells were present in
logarithmically growing populations. Ordinarily, S. pombe
cells elongate throughout the cell cycle, doubling their size before
cytokinesis. In hst4
mutant cultures, a subset of cells
was significantly longer than normal, and this subpopulation became
more prevalent as cultures reached saturation. In a saturated wild-type
culture grown in rich medium, cells arrest with
G2 DNA content but small cell size (Costello
et al., 1986
). In hst4
mutants, 33% (558 of
1670) of the cells were at least twice as long as saturated wild-type
cells and reached lengths up to seven times that of wild-type cells. In
contrast, only 5% (64 of 1412) of wild-type cells were twice as long
as average wild-type length (Figure 3A). This phenotype was specifically attributable to the null allele because
expression of a proA-tagged hst4+ plasmid
construct restored wild-type morphology (Figure 3A).
|
To determine if the long cells were viable, both wild-type and short
and long cells from a saturated mutant culture were micromanipulated to
follow their subsequent divisions individually. Of 78 normal wild-type
cells micromanipulated, 60 (77%) grew to form colonies. The remainder
failed to divide or divided at most twice after micromanipulation. In
contrast, of 66 apparently normal short hst4
mutant
cells, only 29 (44%) produced colonies. Of 66 long mutant cells, only
3 (5%) continued division to form a colony. Thus, even
normal-appearing mutant cells have decreased viability, and the
abnormally long cells are not viable in most instances. This decreased
viability probably contributes to the modest sporulation and
germination defects of hst4
null mutants that we have
observed (our unpublished results).
Examination of chromatin in the long hst4
mutant cells
with the use of DAPI staining revealed striking differences from
wild-type cells (Figure 3B). At saturation, cells normally arrest with
duplicated DNA that appears as a compact sphere in the center of the
small cells (Costello et al., 1986
). In contrast, the DNA of
the long mutant cells appeared to be fragmented. There was often more
than one focus of DAPI-stained material, and it was frequently
dispersed in the cell (Figure 3B). The fragmented DNA was observed in
17% (225 of 1322) of the mutant cells. Fragmented chromatin may result from one of several situations. For example, the chromosomes could be
intact in a fragmented nucleus, or the chromatin could be fragmented in
an otherwise intact nucleus. To evaluate these possibilities, we
followed the nuclear envelope in cells in which the nuclear pore
component Cut11p was tagged with Green Fluorescent Protein (West et
al., 1998
). In cells in which the DNA had begun to fragment, the
nuclear envelope remained intact and relatively normal. However, in
some cells, the nuclear envelope became exaggerated in size as
fragmentation became more severe. Thus, it is possible that changes in
both nuclear and chromatin integrity contributed to the fragmentation
visible in the DAPI-stained cells. The long cells also had aberrant
septa, with many cells having multiple, wide, or off-center septa or
deposits of septal material that did not appear to bisect the cell (our
unpublished results).
In S. cerevisiae, an hst3
hst4
rad9
triple mutant is hypersensitive to UV irradiation (Brachmann et
al., 1995
). To determine if the S. pombe mutant was UV
sensitive, wild-type and mutant cells were treated with a range of UV
irradiation. A series of fivefold dilutions of cells from four spore
products of a parental ditype tetrad were plated on rich medium and
treated with 80 J/m2 UV immediately after plating
and again after 12 h (Figure 4). At
this intermediate level of radiation, there is little to no sensitivity
of the parent or wild-type spores compared with the untreated control.
However, there was a modest but reproducible UV hypersensitivity seen
in the two mutant spore products.
|
When wild-type cells are treated with UV radiation, they arrest with an
elongated morphology as part of the DNA-damage checkpoint (Saka et al.,
1997
). We examined wild-type and mutant cells that had been treated
with UV. The irradiated hst4
cells arrested comparably to
wild-type cells. Therefore, the mutant's UV sensitivity does not
appear to be due to a defect in the checkpoint response but rather to
some other mechanism.
hst4+ Is Required for Silencing at the Telomeres and Centromeres
Transcriptional silencing has been described in S. pombe at three loci: the telomeres (Nimmo et al.,
1994
), the silent mating loci (Thon and Klar, 1992
; Thon et
al., 1994
), and the centromeres (Allshire et al., 1994
,
1995
). Genes placed within or adjacent to these loci are
transcriptionally repressed. To determine whether hst4+ plays a role in transcriptional
silencing, we crossed the hst4
mutants into strains
containing reporter genes at each of the three loci.
Although a majority of known silencing genes in both S. pombe and S. cerevisiae were identified based on their
phenotypes at the silent mating loci, this did not appear to be the
primary target for hst4+ function.
hst4
mutants had a very modest, if any, effect on silencing the mating loci. Furthermore, the mutant strains did not
exhibit the haploid sporulation phenotype typical of other S. pombe silencing mutants (Lorentz et al., 1992
; Thon and
Klar, 1992
; Thon et al., 1994
; Grewal et al.,
1998
; our unpublished results).
Telomeric silencing was monitored in two ways: at a natural telomere
and with the use of a minichromosome construct. In the natural context,
expression of a his3+ reporter gene
adjacent to the left telomere of chromosome I was evaluated. In
wild-type strains, this reporter is completely silenced and cells
are unable to grow on medium lacking histidine (Nimmo et
al., 1998
). To assess whether derepression of this reporter occurred in an hst4
mutant, we crossed the
hst4
mutant into the marked strain. The null mutant was
unable to restore growth on medium lacking histidine and thus did not
derepress this reporter gene (Figure 5A).
The second assay for telomeric silencing uses a minichromosome that is
marked at the telomere with ura4+. In this
construct, both the reporter gene and the telomeric context of the
minichromosome are distinct from the his3+
marked natural telomere (Nimmo et al., 1994
, 1998
). We
crossed the minichromosome into an hst4
strain and plated
a series of fivefold dilutions onto various media: plates lacking
adenine to select for the minichromosome and to control for the number of cells plated, plates lacking uracil to evaluate the low levels of
ura4+ expressed from the telomeric locus,
and 5-FOA plates to assess expression of the
ura4+ gene from the telomere of the
minichromosome (Figure 5B). Because 5-FOA is toxic to cells expressing
the ura4+ gene product (Boeke et
al., 1984
; Allshire et al., 1994
), cells expressing
ura4+ are unable to grow on medium
containing this compound. In a wild-type background, the
ura4+ gene is epigenetically silenced. That
is, the strains are able to form colonies on medium lacking uracil, but
they are also able to form colonies on medium containing 5-FOA. Thus,
in a wild-type population, some cells express the
ura4+ reporter gene and some repress its
transcription. In this assay, the hst4
mutant cells had a
25- to 625-fold growth defect on 5-FOA (Figure 5B), demonstrating
increased expression of the normally silenced reporter gene.
|
Like previously characterized S. pombe silencing
mutants, an hst4
strain displayed centromeric silencing
defects that varied depending on the location of the reporter gene
within the centromeric repeats. S. pombe centromeres consist
of a central domain that is flanked by large inverted repeats
(Chikashige et al., 1989
; Clarke and Baum, 1990
;
Hahnenberger et al., 1991
; Murakami et al., 1991
;
Takahashi et al., 1992
) (Figure
6A). We examined silencing of a
ura4+ reporter gene placed within the
central domain of centromere 1 (cen1) and centromere 3 (cen3), the imr repeat of cen1, and the otr repeat of cen1. In a wild-type
background, ura4+ inserted at any of these
locations is epigenetically silenced, so the strains are able to form
colonies on both 5-FOA and medium lacking uracil (Allshire et
al., 1994
, 1995
).
|
An hst4
mutant strain exhibited variable growth
defects of up to 625-fold on 5-FOA medium when a
ura4+ gene was located within the
otr repeat of cen1 (Figure 6B). Similar growth
defects were seen when the reporter gene was located within the
imr repeat or the central domain of cen1 (TM1)
(Figure 6, C and D). The growth defect on 5-FOA seen at TM1 was
temperature dependent; when plates were grown at 20°C, the defect
increased to 625-fold (Figure 6D). However, the derepression was
variable. Figure 6D shows an example of a strain that shows strong
derepression and a separate isolate that has apparently wild-type
levels of silencing. There was also dramatic and temperature-dependent
5-FOA sensitivity seen when the reporter was present in the central domain of cen3 (TM3). At 32°C, there was variable 5-FOA
sensitivity similar to that seen at the other loci. At room
temperature, however, the 5-FOA sensitivity was almost complete (Figure
6E). Wild-type cells grew well on 5-FOA at room temperature, but the
mutant strains showed very little growth. This silencing defect was
rescued by expression of the proA-tagged
hst4+ plasmid construct (Figure 6E). Thus,
the hst4
mutant exhibits silencing defects at telomeres
and centromeres.
Increased Chromosome Loss in hst4
Mutants
Because the hst4
mutants had decreased viability
associated with fragmented DNA and centromeric silencing defects, it
seemed possible that the hst4
phenotypes might result
from aberrant chromatin structure, particularly at the centromeres. At
least four previously characterized genes known to be important for centromeric silencing are also important for chromosome maintenance and
thus centromeric function. clr4, rik1,
swi6, and clr6 mutants are reported to have
chromosome-loss rates from 9- to >100-fold greater than wild-type
(Allshire et al., 1995
; Ekwall et al., 1995
,
1996
; Grewal et al., 1998
). To determine if the centromeric silencing defect was associated with a defect in centromeric function in the hst4
mutant, we assayed maintenance of the Ch16
minichromosome using colony color. This minichromosome construct
contains the ade6-216 allele that complements the
chromosomal ade6-210 allele present in the mutant and
wild-type strains. Cells that maintain the minichromosome are ade+ and
give rise to white colonies. Loss of the minichromosome results in red
colony color. When the chromosome-loss event occurs in the first cell
division, colonies arise that are half white and half red. To examine
chromosome maintenance in the hst4
strain, the
hst4
mutation was crossed into a strain containing the
Ch16 minichromosome. The hst4
mutant lost the minichromosome in 1.5% of cell divisions, a rate that was eightfold higher than in the wild-type strain (Figure
7A). Thus, hst4
cells are
defective in chromosome maintenance as well as silencing.
|
Genes that function in regulating centromeric chromatin structure might
be predicted to affect the interaction of microtubules with the
kinetochore during mitosis. In fact, at least three of the
four previously identified S. pombe genes that are required for chromosome maintenance are sensitive to the
microtubule-destabilizing drug thiabendazole (TBZ) and have genetic
interactions with the gene encoding
-tubulin,
nda3+ (Ekwall et al., 1996
). To
determine if hst4+ may function in a
similar way, we assayed TBZ sensitivity in the hst4
mutant and compared it with the previously established sensitivity of a
clr4 mutant and insensitivity of clr2 mutant and
wild-type strains. The parent and wild-type strains and the clr2 mutant strain grew well, as expected. However, the
hst4
mutant was sensitive to TBZ, similar to the
clr4 mutant control strain (Figure 7B). When TBZ-treated
cells were examined microscopically, the arrested hst4
and wild-type cells had the same morphology. Thus, TBZ sensitivity of
the hst4
mutant may reflect either a potential role in
mitotic spindle-chromosome interactions or a more general structural
role in chromatin.
S. pombe Hst4 Is a Nuclear Protein Enriched in the Nucleolus
To determine its subcellular localization, we generated
epitope-tagged constructs of Hst4p. A proA tag was inserted into the N
terminus of Hst4, directly after the initiating methionine, and the
proA-Hst4 protein was expressed from a plasmid under the control of the
endogenous hst4+ promoter. This tagged
construct appeared fully functional in that it was able to rescue the
long-cell phenotype and the TM3 centromeric derepression of the
hst4
mutant (Figures 3A and 6E). Indirect
immunofluorescence of cells expressing this proA-Hst4 construct
demonstrated that Hst4p was nuclear and was concentrated in a condensed
spot within the nucleus. Colocalization of proA-Hst4 and Nop1, a
nucleolar antigen (Aris and Blobel, 1988
), identified this subnuclear
staining as nucleolar (Figure 8). The
nucleolar concentration was observed in cells from all stages of the
cell cycle, and clear colocalization was seen in 90% (159 of 177) of cells examined.
|
S. pombe hst4+ Is a Functional Homologue of S. cerevisiae HST3 and HST4
Because members of the SIR2 gene family share a high
degree of sequence similarity, it was of interest to determine the
extent of their functional conservation. As detailed above,
hst4+ shares molecular and phenotypic
similarities with HST3 and HST4 from S. cerevisiae. Therefore, we asked if
hst4+ could rescue the phenotypes of a
S. cerevisiae sir2
mutant or an hst3
hst4
double mutant. Overexpression of
hst4+ was unable to rescue the silencing
phenotypes of a S. cerevisiae sir2
mutant. This result
was not necessarily surprising because a positive result demands both
cross-species and cross-subfamily complementation, and it was
previously shown that overexpressed HST3 cannot rescue
sir2
mutant phenotypes (Brachmann et al., 1995
). We next asked whether hst4+ could
complement hst3
hst4
double mutant phenotypes, because these three genes are most closely related. Although hst3
and hst4
mutants do not independently have strong
defects, the double mutant displays pleiotropic phenotypes, including
temperature sensitivity for growth at 37°C, decreased chromosome
stability, and hypersensitivity to UV irradiation in combination with a
rad9
mutant (Brachmann et al., 1995
).
Furthermore, HST3 and HST4 are required for
telomeric silencing, because reporter genes placed at the telomere are
derepressed in a double mutant (Brachmann et al., 1995
). To
determine if hst4+ could complement these
phenotypes, we transformed an hst3
hst4
double mutant
with N-terminally epitope-tagged HA-hst4+
or proA-hst4+ overexpressed under the
control of a galactose-inducible promoter.
hst4+ complemented the
temperature-sensitive growth phenotype of the hst3
hst4
double mutant. Figure 9A
shows a wild-type strain and an hst3
hst4
double
mutant transformed with vector, HST3,
HA-hst4+, or
proA-hst4+. The wild-type strain grew
equally well at 30 and 37°C. The double mutant containing vector
alone grew at 30°C but was unable to grow at 37°C. The
HST3 control transformant complemented this temperature
sensitivity, as expected. Both tagged versions of hst4+ were able to rescue the hst3
hst4
temperature-sensitive phenotype, demonstrating functional
conservation between S. pombe and S. cerevisiae
HST genes.
|
hst4+ was also able to relieve the
telomeric silencing defect of the double mutant (Figure 9B). A
wild-type strain containing a telomeric URA3 reporter gene
grew on medium containing 5-FOA, indicative of the transcriptional
silencing of the URA3 gene. An hst3
hst4
double mutant with the same reporter was unable to grow on 5-FOA, and
this derepression of URA3 was complemented by
HST3. The telomeric derepression was also partially rescued by expression of hst4+ (Figure 9B).
hst4+ could not, however, complement the UV
hypersensitivity of an hst3
hst4
rad9
triple mutant
(our unpublished results). Thus, because
hst4+ rescued the temperature-sensitivity
and telomeric silencing defects of the hst3
hst4
mutant, partial function of these genes has been conserved in the two yeasts.
| |
DISCUSSION |
|---|
|
|
|---|
The fission yeast S. pombe and the budding yeast
S. cerevisiae are only distantly related, yet much has been
learned through analysis of both their comparable and contrasting ways
of accomplishing such essential processes as DNA replication and cell
cycle control (for review, see Forsburg, 1999
). Likewise, many
parallels can be drawn between silencing in the two yeasts. In both,
the silent mating-type loci and the telomeres are transcriptionally
silenced (Gottschling et al., 1990
; Aparicio et
al., 1991
; Thon and Klar, 1992
; Nimmo et al., 1994
;
Thon et al., 1994
). In contrast, S. pombe's
larger and more complex centromeres are also silenced (Chikashige
et al., 1989
; Clarke and Baum, 1990
; Hahnenberger et
al., 1991
; Murakami et al., 1991
; Takahashi et
al., 1992
; Steiner et al., 1993
; Allshire et
al., 1994
, 1995
). Even though the two organisms share at least two
silenced loci, to date no homologues of the S. cerevisiae
SIR silencing proteins have been reported in S. pombe.
Here we have described the identification of a S. pombe silencing gene homologue that is a member of the SIR2 silencing gene family. S. pombe hst4+ is most closely related to the S. cerevisiae genes HST3 and HST4. Like these homologues, it plays a role in chromatin structure. Indeed, hst4+ is required for transcriptional silencing, chromatin integrity, and genomic stability. However, it is distinguished from SIR2 and other HSTs by its apparent role in centromeric function. These studies thus functionally extend the SIR2 gene family to S. pombe and demonstrate that similar silencing mechanisms may exist in the two distantly related yeasts.
hst4+ Is Closely Related to the SIR2 Gene Family Both Molecularly and Functionally
S. pombe hst4
mutants are phenotypically similar to
S. cerevisiae hst3
hst4
double mutants. S. pombe
hst4
mutants accumulate large cells that are inviable. The
abnormally long hst4
mutant cells are reminiscent of
those seen in several cell-division-cycle (cdc) mutants in
which cell growth continues after nuclear division arrests (see Nurse
et al., 1976
; Kelly et al., 1993
; Maiorano et al., 1996
; Gould et al., 1998
). If the mutant
cells experience irreparable alteration of their chromatin that
triggers arrest of the nuclear division cycle without halting cell
growth, long cells would arise, as observed in many cdc
mutants. HST3 and HST4 in S. cerevisiae are redundant genes that are together required for cell
cycle progression, telomeric silencing, and chromosome maintenance
(Brachmann et al., 1995
). Parallel to the S. pombe hst4
mutant cell cycle defect, S. cerevisiae hst3
hst4
mutants accumulate as large-budded cells that are larger
than wild-type cells and have reduced viability (Brachmann et
al., 1995
). The growth and morphology phenotypes in both yeasts
may be related to a role for these HST genes in the
maintenance of chromatin structure and integrity.
Additional phenotypes of these family members in both yeasts support
the idea that the genes are important in the maintenance of chromatin
structure. The S. pombe hst4
mutant (Figure 4) and the
S. cerevisiae hst3
hst4
double mutant (in combination
with a rad9
mutation) (Brachmann et al., 1995
)
are sensitive to UV irradiation. In both yeasts, UV sensitivity has
been correlated with mutations in genes thought to play a role in
chromatin structure (Kaufman et al., 1997
; Grewal et
al., 1998
). Alteration of chromatin structure in the
hst mutants could make the DNA more accessible to UV
radiation-induced damage. Additionally, the SIR2 family members in both yeasts, including hst4+,
are required for transcriptional silencing. S. pombe hst4
mutants (Figures 5 and 6) and S. cerevisiae hst3
hst4
mutants (Brachmann et al., 1995
) exhibit decreased
silencing, indicating that these proteins may be involved either
directly or indirectly in chromatin structure.
Direct evidence that these homologues are important for chromatin
structure and integrity comes from chromosome-maintenance assays.
hst4+ is important for chromosome
maintenance, as demonstrated by the fact that a S. pombe
hst4
strain is at least eight times more likely to missegregate
the Ch16 minichromosome per cell division than a wild-type strain. This
quantitative effect is almost certainly an underestimate of the
chromosome-maintenance defect of the null mutant because, in S. pombe, each of the three chromosomes is essential for viability.
Thus, for the assay to detect a chromosome loss, an event must occur
that results in loss of the minichromosome and that leaves the
remaining chromatin intact, allowing the cell to proceed through
several rounds of cell division to form a colony. Because at least 30%
of a population of hst4
cells is aberrantly long and not
capable of giving rise to a colony, these clearly defective cells
cannot be scored and are thus unrepresented in the chromosome-loss
quantitation. Based on the dispersed DNA phenotype seen in many long
cells (Figure 3B), it is likely that chromosome-loss events contribute
to the loss of viability in the mutant cells. If it were possible to
take into account the rate of chromosome loss in these cells, the total
loss rate would be expected to be much higher.
We found that overexpression of hst4+ in
S. cerevisiae rescues a subset of the hst3
hst4
double mutant phenotypes.
hst4+ is able to rescue the temperature
sensitivity for growth and to partially rescue the telomeric silencing
defect of the S. cerevisiae mutants. However,
hst4+ does not rescue the
UV-hypersensitivity phenotype seen in the S. cerevisiae
mutant. Thus, partial function has been conserved in these two yeasts.
The S. cerevisiae genome duplicated
~108 years ago, long after the S. cerevisiae and S. pombe lineages split (Wolfe and
Shields, 1997
). This duplication of the genome may have allowed similar
genes to evolve different functions. Although HST3 and
HST4 lie outside a genomic block that was duplicated between
chromosome XV and chromosome IV (Wolfe and Shields, 1997
), given their
redundant functions and proximity to duplicated blocks it seems
possible that they were part of the duplication event and that
intermediate genes have undergone subsequent rearrangements. Knowledge
of the functions of this subfamily is limited, in part, by the
redundancy of the S. cerevisiae homologues. In S. pombe, hst4+ may fulfill the role of
both S. cerevisiae genes, thus providing a unique
opportunity to learn more about the subfamily.
hst4+ Is Similar to but Distinct from Other S. pombe Silencing Genes That Have a Role in Chromatin Structure
Several genes are already known to be important for
transcriptional silencing in S. pombe.
clr1+, clr2+,
clr3+, clr4+,
clr6+, rik1+,
and swi6+, like
hst4+, are required for wild-type levels of
silencing (Egel et al., 1989
; Lorentz et al.,
1992
, 1994
; Thon and Klar, 1992
; Ekwall and Ruusala, 1994
; Thon
et al., 1994
; Allshire et al., 1995
; Grewal and
Klar, 1997
; Grewal et al., 1998
). These silencing genes fall into two classes based on additional phenotypes. Mutations in the first
class include clr1, clr2, and clr3,
which disrupt silencing but have no additional phenotypes. Mutations in
the second class (clr4, clr6, rik1,
and swi6) result in increased chromosome loss, linking their
centromeric silencing defects with defects in centromeric function
(Allshire et al., 1995
; Ekwall et al., 1995
,
1996![]()