![]() |
|
|
Vol. 10, Issue 11, 3623-3632, November 1999

*Institute of Biotechnology, University of Helsinki, Helsinki,
Finland; and
Department of Biochemistry, Faculty of
Medicine, University of Kuopio, Kuopio, Finland
| |
ABSTRACT |
|---|
|
|
|---|
Severe heat stress causes protein denaturation in various cellular compartments. If Saccharomyces cerevisiae cells grown at 24°C are preconditioned at 37°C, proteins denatured by subsequent exposure to 48-50°C can be renatured when the cells are allowed to recover at 24°C. Conformational repair of vital proteins is essential for survival, because gene expression is transiently blocked after the thermal insult. Refolding of cytoplasmic proteins requires the Hsp104 chaperone, and refolding of lumenal endoplasmic reticulum (ER) proteins requires the Hsp70 homologue Lhs1p. We show here that conformational repair of heat-damaged glycoproteins in the ER of living yeast cells required functional Hsp104. A heterologous enzyme and a number of natural yeast proteins, previously translocated and folded in the ER and thereafter denatured by severe heat stress, failed to be refolded to active and secretion-competent structures in the absence of Hsp104 or when an ATP-binding site of Hsp104 was mutated. During recovery at 24°C, the misfolded proteins persisted in the ER, although the secretory apparatus was fully functional. Hsp104 appears to control conformational repair of heat-damaged proteins even beyond the ER membrane.
| |
INTRODUCTION |
|---|
|
|
|---|
All organisms acquire tolerance toward otherwise lethal high
temperatures if they are first preconditioned at a moderately high
temperature at which their heat shock genes are activated (Parsell and
Lindquist, 1993
). In Saccharomyces cerevisiae, the heat
shock protein Hsp104 is indispensable for acquisition of thermotolerance (Sanchez and Lindquist, 1990
; Sanchez et
al., 1992
). Hsp104 belongs to the HSP100/Clp family of ATPases and has two essential nucleotide-binding sites (Parsell et al.,
1991
; Schirmer et al., 1996
). It promotes survival of yeast
cells exposed to 48-50°C after preconditioning at 37°C by
disaggregating heat-denatured proteins in the cytosol (Parsell et
al., 1994
). Recently, Hsp104 was shown to be able to modulate the
conformational status of the cytoplasmic yeast prion protein (Chernoff
et al., 1995
; Schirmer and Lindquist, 1997
).
The structure of endoplasmic reticulum (ER)-located proteins distorted
by severe heat stress can be repaired by an ATP-dependent mechanism
(Jämsä et al., 1995
). According to the yeast
genome sequence, there is no Hsp104 homologue in the ER; thus, the
repair process in the ER must depend on other chaperones. Indeed, we found that the Lhs1 protein is involved in conformational repair in the
yeast ER (Saris et al., 1997
). Lhs1p belongs to the Hsp110 subgroup of the Hsp70s and shares 24% identical amino acids with the
ER-resident Hsp70 chaperone BiP/Kar2p (Rasmussen, 1994
; Craven et
al., 1997
), which functions in ER translocation and folding of
newly synthesized polypeptides (Vogel et al., 1990
; Simons et al., 1995
; Holkeri et al., 1998
). Under
physiological conditions, Lhs1p assists efficient ER translocation of a
subset of proteins, especially at low temperatures (Baxter et
al., 1996
; Craven et al., 1996
; Hamilton and Flynn,
1996
). In the absence of Lhs1p, previously heat-denatured proteins were
not refolded but degraded. In normal cells, Lhs1p was found in
association with heat-affected but not native reporter proteins,
according to coimmunoprecipitation experiments (Saris et
al., 1997
; Saris and Makarow, 1998
). Mammalian cells harbor an
Lhs1p homologue in the ER (Lin et al., 1993
; Chen et
al., 1996
). In vitro experiments suggest that it is involved in
translocation (Dierks et al., 1996
), whereas no data are
available regarding a role in conformational repair. Also, Lhs1p, like
Hsp104, is dispensable at physiological temperature but is necessary
for the acquisition of thermotolerance (Sanchez and Lindquist, 1990
; Saris et al., 1997
). Lhs1p enhances survival after severe
heat stress by 10-fold, and Hsp104 enhances survival by as much as 1000-fold. Unlike other chaperones, they do not function in de novo
protein folding or suppression of aggregation, but they seem to be
specialized in repair functions after stress. Hsp104 directly disaggregates denatured proteins (Glover and Lindquist, 1998
), whereas
the nature of Lhs1p function is not known. Here we show that refolding
of fully translocated and folded, and thereafter heat-denatured,
artificial and natural secretory yeast proteins in the S. cerevisiae ER requires functional Hsp104.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains and Media
The following yeast strains were used in this study: H1
(Mata ade2-101 ura3-52 leu2-3 leu2-112 suc2
9
gal2), H4 (Mata sec18-1 ura3-52 trp1-289
leu2-3,122), H393 (Mat
sec18-1 ura3-52 trp1-289 leu2-3 112 URA3::HSP150
-
-lactamase)
(Simonen et al., 1994
), H453 (Mata
ura3-1 his3-11,15 leu2-3,112 trp1-2 ade2-1 can1-100
hsp104::LEU2) (Sanchez and Lindquist, 1990
), and H534 (Mat
sec18-1 ade2-1 his3-11,15 trp1
hsp104::LEU2 URA3::HSP150
-
-lactamase) (Saris et al., 1997
). Strains H826 (Mata
ura3-1 his3-11,15 leu2-3,112 trp1-2 ade 2-1 can1-100
hsp104::LEU2 URA3::HSP104) and H836
(Mata sec18-1 ura3-52 trp1-289 leu2-3,112
hsp104::Kan-Cre-Lox URA3::HSP104) were created
by integrating the HSP104 gene in plasmid pKTH4681 (see
below) into the genome of strains H453 and H835, respectively. Strain
H835 (Mata sec18-1 ura3-52 trp1-289 leu2-3,112
hsp104::Kan-Cre-Lox) was obtained by transformation of
strain H4 with an hsp104 disruption cassette (see below).
Strains H835 and H836 were transformed with integrative plasmid
pKTH4660 containing the Hsp150
-
-lactamase gene
(Paunola et al., 1998
) to create strains H850
(Mata sec18-1 ura3-52 trp1-289 leu2-3,112 hsp104::Kan-Cre-Lox URA3::HSP104
LEU2::HSP150
-
-lactamase) and H851
(Mata sec18-1 ura3-52 trp1-289 leu2-3,112
hsp104::Kan-Cre-Lox LEU2::HSP150
-
-lactamase), respectively.
Strains H924 (Mata ura3-1 his3-11
leu2-3,112 trp1-2 ade2-1 can1-100 hsp104::LEU2
URA3::HSP104-K218T) and H941 (Mata sec18-1 ura3-52 trp1-289 leu2-3,112 hsp104::Kan-Cre-Lox
LEU2::HSP150
-
-lactamase URA3::HSP104-K218T) were created by integrating plasmid
pKTH4720 (see below) into yeast strains H453 and H851, respectively.
Transformations were done with the lithium acetate method (Hill
et al., 1991
). Yeast strains were grown at 24°C in shake
flasks overnight to early logarithmic phase in YPD medium or in
synthetic complete (SC) medium lacking methionine and cysteine.
Escherichia coli strain DH5
(Sambrook et al.,
1989
), used as the host for cloning of the HSP104 gene, was
grown on Luria-Bertani medium supplemented with ampicillin (100 µg/ml).
Cloning, Deletion, and Rescue of HSP104
To clone the HSP104 gene, a 3327-base
pair (bp) PCR fragment containing the whole coding region as well as
600 bp upstream from the start codon was amplified from cosmid 1F17
with primers 71526 (5'ATTGTCATCGATTCAAAGGCG3') and 71527 (5'CATCAGACTAGTTAATCTAGGTCATCATC3'). The PCR product was digested with
ClaI and SpeI (Promega, Madison, WI) and ligated
to pKTH4685 cut with the same enzymes to produce plasmid pKTH4780. The
cloning vector pKTH4685 was constructed by cloning the ADC1
transcription terminator from pAAH5 (Ammerer, 1983
) as a 450-bp
HindIII-BamHI fragment to the NotI
site of pBluescript SK+ plasmid (Stratagene, La
Jolla, CA). Standard cloning and transformation methods according to
Sambrook et al. (1989)
were used. Plasmid pKTH4681 was
constructed by first cutting pKTH4680 with SacI and SalI, then isolating the 3.8-kilobase fragment containing
the HSP104 gene and the ADC1 terminator, and
finally ligating the fragment with pFL34 (Bonneaud et al.,
1991
) cut with the same enzymes. Before integration into yeast strain
H453 to construct rescue strain H826, pKTH4681 was linearized with
NcoI. Deletion of the HSP104 gene from the yeast
genome was performed with the use of the loxP-kanMX-loxP
disruption cassette method (Guldener et al., 1996
). The
disruption cassette was amplified from plasmid pUG6 (Guldener et
al., 1996
) with PCR primers 73148 (5'CAACTACACGTACCATAAAATATACAGAATATATGAACG-ACAGCTGAAGCTTCGTACGC3') and 73149 (5'CTTGTTCGAAAG-TTTTTAAAAATCACACTATATTAAATTAGCATAGGCCACTA-GTGGATCTG3') containing 40-bp homologous stretches (boldface
nucleotides) upstream and downstream, respectively, of
HSP104 in the yeast genome. Western analysis, performed as
described previously (Saris et al., 1997
) with the use of
anti-Hsp104 antiserum (1:2000) (Stressgen, Victoria, British Columbia,
Canada), confirmed the absence and presence of Hsp104.
Site-directed mutagenesis of Hsp104 was performed with the use of PCR. Primers 82007 (5'CCAGGTATCGGTACGACCGC3') and 82008 (5'GCGGTCGTACCGATACCTGG3'), hybridizing to opposite DNA strands, were used to introduce mutation K218T into HSP104. The 5' end of HSP104 was amplified with primers 71526 and 82007, and the 3' terminus was amplified with primers 82008 and 71527 with pKTH4680 as a template. The full-length mutant gene was generated by amplifying the hybridized 5' and 3' terminal fragments with primers 71526 and 71527. The PCR fragment was cloned into pKTH4685 like the wild-type gene (see above). The mutation was verified from the resulting plasmid pKTH4719 by sequencing. The HSP104-K218T expression plasmid pKTH4720 was constructed and integrated into the yeast genome like plasmid pKTH4681.
Metabolic Labeling and Immunoprecipitation
For metabolic labeling with
[35S]methionine/cysteine (1000 Ci/mmol;
Amersham Pharmacia Biotech UK, Little Chalfont, England), the
yeast cells were grown in SC medium lacking methionine and cysteine and
labeled in the same medium (25 × 106
cells/0.5 ml). Immunoprecipitation of lysed cell samples or medium samples was performed with
-lactamase antiserum (1:100) or
carboxypeptidase Y antiserum (1:100) and protein A-Sepharose for
2 h at 4°C, as described previously (Saris et al.,
1997
). Protein-bound glycans were labeled with
D-[2-3H]mannose (10.3 Ci/mmol; Amersham Pharmacia Biotech UK) in YPD medium containing 0.1%
glucose. Labeling was stopped by reconstituting the glucose
concentration to 4%. The cell wall was removed by zymolyase digestion,
and the spheroplasts were lysed in 0.1% SDS. To determine
protein-bound 3H radioactivity, the radioactivity
incorporated in the presence of 100 µg/ml cycloheximide was
subtracted from the total incorporated radioactivity.
Other Materials and Methods
For thermotolerance assays, cells were preincubated in
Wassermann tubes for 1 h at 37°C before shifting them to 50°C.
Duplicate samples of 2 × 106 cells were
removed after 20 min, diluted, and plated onto YPD plates. The colonies
were counted after 4 d of incubation at 24°C (Sanchez and
Lindquist, 1990
; Saris et al., 1997
). Determination of the
-lactamase activity was performed according to Simonen et
al. (1994)
, and the Km values
were determined according to Paunola et al. (1998)
. Glucose
consumption by the yeast cells was followed by determining the glucose
concentration in the medium of duplicate cell samples with the use of
the Gluco-quant kit of Boehringer Mannheim (Indianapolis, IN).
| |
RESULTS |
|---|
|
|
|---|
Heat-denatured Hsp150
-
-Lactamase Fails to Be Refolded in the
ER in the Absence of Hsp104
We have shown previously that severe heat shock at 48-50°C,
after preconditioning at 37°C, resulted in aggregation, inactivation, and loss of secretion competence of an ER-confined reporter enzyme, Hsp150
-
-lactamase. Once the cells were returned to physiological temperature (24°C), the aggregates were solubilized and the enzymatic activity and secretion competence of the reporter enzyme were resumed
(Jämsä et al., 1995
; Saris et al.,
1997
; Saris and Makarow, 1998
) (see top of Figure
1 for thermal treatments of cells). Here we show first for reference the reactivation of heat-inactivated Hsp150
-
-lactamase in sec18-1 cells (H393; see Table
1 for strains). The cells were
preincubated at 37°C to condition them to survive a subsequent
thermal insult and to accumulate
-lactamase activity in the ER
(Figure 1A). The temperature-sensitive sec18-1 mutation inhibits transport of exocytic proteins from the ER to the Golgi at
nonpermissive temperature (37°C) (Novick et al., 1981
). A
20-min incubation at 50°C resulted in inactivation of the reporter
enzyme. When the cells were returned to 24°C, 51% of the original
-lactamase activity was recovered in 4-6 h, even though protein
synthesis was inhibited by cycloheximide (CHX) (Figure 1A).
|
|
To study the role of Hsp104 in the refolding events in the ER, the
reactivation experiment was repeated with a strain from which the
HSP104 gene had been deleted (
hsp104 sec18-1).
In the absence of Hsp104,
-lactamase activity accumulated in the ER at 37°C and was inactivated at 50°C, as described above (Figure 1B,
). Pulse-chase experiments confirmed that Hsp150
-
-lactamase was translocated into the ER in
hsp104 mutants as in
normal cells (see below). However, after the cells were shifted to
24°C, very little of the catalytic activity was resumed (Figure 1B,
). When the wild-type HSP104 gene was returned to the
genome of
hsp104 sec18-1 cells, reactivation
of the heat-denatured reporter enzyme was rescued (Figure 1B,
).
Mutation of lysine 218 to threonine of one of the two
nucleotide-binding sites of Hsp104 destroys its ability to confer
thermotolerance to cells (Parsell et al., 1991
). To
determine whether nucleotide binding was required for the effect of
Hsp104 on the refolding events inside of the ER, we replaced the
wild-type HSP104 gene with an HSP104-K218T
variant. Very little heat-denatured
-lactamase activity was
recovered in this mutant (Figure 1C). In none of the strains was
-lactamase activity secreted to the medium during the 6-h recovery
period (data not shown). We conclude that functional Hsp104 was
required for reactivation of heat-inactivated Hsp150
-
-lactamase
inside of the ER.
Metabolic Activity of
hsp104 Cells after Thermal Insult
Most normal cells, when preincubated at 37°C for 30-60 min
followed by 20-30 min at 48-50°C, form colonies in 3-4 d when
plated at 24°C, whereas in the absence of Hsp104, only 0.1-1%
survive (Sanchez and Lindquist, 1990
). In our hands, 0.4% of
hsp104 cells (H453), 0.2% of HSP104-K218T
cells (H924), and 40% of the HSP104 rescue cells (H826)
acquired thermotolerance. Thus, it was important to establish that the
hsp104 deletion strains remained metabolically active
during the experiments described above. This was studied by following
their rate of glucose consumption. sec18-1 (Figure 2A) and
hsp104 sec18-1
mutants (Figure 2B) consumed glucose from the medium equally vigorously
after preconditioning at 37°C and subsequent thermal insult at 48°C
(
) or 50°C (
). In this experiment, we used a fivefold higher
cell density than normal to increase the sensitivity of the assay.
Therefore, in none of the other experiments did the glucose
concentration of the medium become limiting. We conclude that in the
absence of Hsp104 metabolic activity was not compromised for at least
7 h after severe heat stress; thus, lack of reactivation of
Hsp150
-
-lactamase in the experiment described above was not due
to abrupt cell death.
|
Resumption of Secretion Competence of Heat-denatured
Hsp150
-
-Lactamase
In sec18-1 cells, the heat-denatured
-lactamase
fusion protein gradually becomes secretion competent during recovery of
the cells at 24°C (Saris and Makarow, 1998
). Next we studied whether the lack of Hsp104 affected resumption of the secretion competence of
Hsp150
-
-lactamase. The experiment was first performed on sec18-1 cells for reference. To avoid excessively long
recovery periods, a less severe thermal insult (15 min at 48°C) was
applied. The cells were first labeled at 37°C with
[35S]methionine/cysteine, after which the
medium and lysed cells were subjected to immunoprecipitation. SDS-PAGE
analysis revealed the ER form (110 kDa) of the reporter in the lysate
(Figure 3A, lane 2) and no protein in the
medium (lane 1). The ER form carries single mannose residues on serine
and threonine residues, whereas the mature form has extended
O-glycans (Paunola et al., 1998
). When similarly
labeled cells were shifted directly to 24°C for 2 h without any
thermal insult, most of the protein was detected in the medium in fully
O-glycosylated form (145 kDa; lane 3) and very little was
found in the lysate (lane 4). When parallel cells labeled at 37°C
underwent the 48°C treatment, the ER form still persisted in the
cells (lane 6) and no protein was found in the medium (lane 5). After a
shift of parallel cells from 48 to 24°C, less than half of the
molecules were secreted after 2 h (lanes 7 and 8). After 4 h,
most of the Hsp150
-
-lactamase was in the medium (lanes 9 and 10),
and after 8 h, all of the Hsp150
-
-lactamase was in the
medium (lanes 11 and 12). Sodium azide in the recovery mixture
inhibited the appearance of the reporter in the medium (lanes 13 and
14). This experiment was repeated in
hsp104 sec18-1 cells. This time, metabolically labeled Hsp150
-
-lactamase
persisted in the ER form for at least 7.5 h (Figure 3B, lanes 8, 10, and 12) and very little was secreted (lanes 7, 9, and 11). The
secretory apparatus of
hsp104 cells was functional during
the experiment (see below). Thus, Hsp104 was required not only for
reactivation but also for resumption of the secretion competence of
heat-denatured Hsp150
-
-lactamase.
|
To establish a relationship between the folding state and the secretion
competence of Hsp150
-
-lactamase, the protein was again
accumulated in the ER in sec18-1 cells at 37°C and
inactivated by a thermal insult of 20 min at 48°C. CHX was added, and
the cells were shifted to 24°C. During the first hours of recovery, about half of the initial catalytic activity was resumed, but it
remained intracellular (Figure 4,
).
Only after reactivation did the activity start to be slowly secreted to
the medium (
). The Km value for
nitrocefin of the reactivated and thereafter secreted
Hsp150
-
-lactamase molecules was 44 µM, and that of molecules
secreted normally at 24°C in the absence of any thermal treatments
was 47 µM. The Km value of authentic
E. coli
-lactamase is 49 µM (Paunola et al.,
1998
). Thus, the structural features essential for catalytic activity,
which had been destroyed by the thermal insult, were reestablished
during the recovery period. Disulfide bonds were not reduced by the
thermal insult (data not shown). Resumption of the secretion competence
of the
-lactamase activity shown in Figure 4 was slower than that
shown in Figure 3A, apparently because of the more severe thermal
insult. The very slow rate of secretion must have been due to slow
refolding, because the secretion kinetics of copies synthesized during
the recovery period were normal (see below).
|
Resumption of Exocytosis after Severe Heat Stress in the Absence of Hsp104
The experiment described above (Figure 3B) on the secretion
competence of Hsp150
-
-lactamase in the absence of Hsp104 was performed in a sec18-1 mutant to accumulate the reporter
enzyme in the ER before the thermal insult. Irreversible ER retention could thus have resulted in irreversible misfolding of the
temperature-sensitive Sec18 protein, leading to cessation of membrane
traffic. This is why we needed to confirm that exocytosis operated in
heat-treated sec18-1 cells even in the absence of Hsp104.
Parallel
hsp104 sec18-1 cell samples were incubated at
24, 37, and 50°C, and then again at 24°C, and labeled during a 1-h
period at 24°C before the shift to 37°C, as well as during the
indicated 1-h periods during recovery at 24°C (scheme at top of
Figure 5). The lysed cell samples were
subjected to immunoprecipitation followed by SDS-PAGE analysis. At
24°C before heat treatment, most of the newly synthesized reporter
protein molecules were detected in the medium in the fully glycosylated
145-kDa form (Figure 5, sample a, lane 1). Some molecules remained cell
associated in the cytoplasmic (66 kDa; Paunola et al.,
1998
), the ER (110 kDa), and the mature forms (lane 2). When the
labeling was performed after the thermal insult during the first hour
of recovery, some of the cell-associated molecules were cytoplasmic,
some represented the ER form, and some were mature (sample b, lane 4).
A few molecules were detected in the medium (lane 3). This suggests
that translocation and ER exit were retarded immediately after the
thermal insult. However, during the third, fifth, and even seventh
hours of recovery (samples c, d, and e, respectively), very little of
the protein was detected in the cell lysates (lanes 6, 8, and 10),
whereas most of it was detected in the medium (lanes 5, 7, and 9). The
Hsp150
-
-lactamase molecules synthesized during recovery at 24°C
must have been disulfide bonded, because in reduced form the protein
fails to leave the ER (Simonen et al., 1994
). Similar data
were obtained for normal cells that lacked sec mutations and
expressed normal Hsp104 (H335; data not shown). Expression of the
Hsp150
-
-lactamase was driven by the HSP150 promoter,
which confers expression at 24°C but is up-regulated at 37°C (Russo
et al., 1993
).
|
To examine more closely the secretion kinetics of newly synthesized
Hsp150
-
-lactamase molecules, we incubated sec18-1 and
hsp104 sec18-1 cells at 37 and 50°C and then for 4 h at 24°C. The cells were then labeled with 35S
for 5 min and chased with CHX at 24°C (scheme at top of Figure 6). Immunoprecipitation with
-lactamase antiserum showed that most of the Hsp150
-
-lactamase
was in the medium after a chase of 10 min in the case of
sec18-1 cells (Figure 6A). In the case of
hsp104
sec18-1 cells, most of the protein was in the medium after a chase
of 20 min (Figure 6B, lanes 3 and 4), and even after 40 min of chase
some of the reporter protein appeared to reside in the ER (lanes 7 and
8). In both strains, the intracellular forms of Hsp150
-
-lactamase
were barely visible right after the pulse (Figure 6, A and B, lanes 2).
This is probably due to the glycan heterogeneity of the intracellular
forms. We conclude that synthesis, translocation, disulfide bonding,
and O-glycosylation, as well as exocytosis of the reporter,
functioned in most cells for at least 7 h of recovery,
irrespective of the presence of Hsp104 and the sec18-1
mutation.
|
Heat-affected Carboxypeptidase Y Fails to Acquire Secretion Competence without Functional Hsp104
Next we expanded the experiments to a natural yeast glycoprotein,
the vacuolar protease carboxypeptidase Y (CPY). The secretion competence of proCPY has been widely used as a measure of its folding
state (Simons et al., 1995
; Silberstein et al.,
1998
). Normally, preproCPY loses its signal peptide and acquires
in the ER primary N-glycans, which are extended in the
Golgi. The propeptide is removed in the vacuole, yielding mature CPY.
Thus, the biosynthetic state of CPY reveals its intracellular location
(Stevens et al., 1982
). In the experiments described below,
we used cells lacking sec mutations. Wild-type cells were
first incubated at 37°C for 1 h and then labeled for 5 min at
37°C (Figure 7A) to serve as a control.
Immunoprecipitation of the cell lysates and SDS-PAGE analysis revealed
mostly ER-specific proCPY (67 kDa) (lane 1). Similarly labeled parallel
cells were shifted for 20 min to 48°C and then chased at 24°C.
After the thermal insult at 48°C, proCPY persisted (lane 2), and
after 2 h at 24°C, a little proCPY had been processed to mature
CPY (lane 3). After 4 h (lane 4) and 6 h (lane 5) at 24°C,
most of the protein was in the mature form and thus apparently in the
vacuole. When the thermal insult was omitted, proCPY was in the vacuole
in <30 min (Saris and Makarow, 1998
). In the
hsp104
strain, proCPY was detected after the 37°C pulse as described above
(Figure 7B, lane 1). However, after the thermal insult and 2-6 h at
24°C, proCPY persisted (lanes 2-5), showing that it had not acquired
transport competence but remained in the ER. In the
hsp104
HSP104 rescue strain, heat-affected proCPY reached the vacuole
with kinetics similar to those in normal cells (Figure 7C). In cells
expressing Hsp104-K218T instead of Hsp104, proCPY persisted in the ER
form (Figure 7D). These data confirm that permanent ER retention in the
absence of Hsp104 was not caused by irreversible conformational
distortion of the mutant Sec18 protein, or of other components required
for intracellular transport, but by failure of the reporter proteins to
gain a secretion-competent conformation.
|
Hsp104 Is Required for Resumption of Secretion Competence of Bulk Cell Wall Proteins
Finally, to examine the physiological relevance of Hsp104 in
refolding events in the ER, we extended the studies to a number of
authentic cell wall mannoproteins. The S. cerevisiae cell
wall is composed of a glucan polymer and numerous extensively
N- and O-glycosylated mannoproteins. The fate of
heat-affected newly synthesized bulk mannoproteins was studied in the
absence and presence of Hsp104. First we established the assay.
sec18-1 cells were preincubated for 15 min at 37°C and
labeled for 30 min at 37°C with [3H]mannose
in low-glucose medium (0.1%) to achieve efficient incorporation of
radioactivity (scheme at top of Figure
8A). The glucose concentration of the
medium was then increased to 4% to stop labeling, and the cells were
shifted to 24°C to reverse the sec18-1 block. Samples were
withdrawn after different times, the cell walls were removed by
zymolyase digestion, and the 3H radioactivity of
the lysed spheroplasts (
) and the cell wall material (
) was
counted. Most of the radioactivity had reached the cell wall <1 h
after the shift of the cells to 24°C (Figure 8A), thus representing
cell wall mannoproteins. The remaining spheroplast-associated
radioactivity evidently represented resident glycoproteins of the
secretory compartment. Negligible amounts of radioactivity were
detected in the medium (data not shown). Next, similarly
3H-labeled sec18-1 cells were treated
for 20 min at 50°C before being shifted to 24°C (scheme at top of
Figure 8B). The spheroplast-associated radioactivity decreased very
slowly (Figure 8B,
), with a concomitant increase in cell
wall-associated radioactivity (
). The addition of sodium azide to
the recovery mixture inhibited transport of the radioactivity to the
cell wall (
and
). When the experiment was repeated on
hsp104 sec18-1 cells, the 3H
radioactivity remained intracellular (Figure 8C). This finding demonstrates that loss of transport competence as a result of heat-inflicted damage and subsequent Hsp104-dependent refolding apparently affected a large number of different cell wall glycoproteins and was thus a physiologically relevant phenomenon.
|
| |
DISCUSSION |
|---|
|
|
|---|
We show here that repair of heat-damaged glycoproteins inside of
the yeast ER depends on the cytoplasmic chaperone Hsp104. Fully
translocated and folded, and thereafter in vivo heat denatured, Hsp150
-
-lactamase failed to be refolded at physiological
temperature to an active and secretion-competent form in the absence of
Hsp104 and remained in the ER. Similar results were obtained when one of the two ATP-binding sites of Hsp104 was inactivated by site-directed mutagenesis. In control cells harboring an intact HSP104
gene, as well as in rescue strains in which the wild-type
HSP104 gene was returned to a
hsp104 mutant,
Hsp150
-
-lactamase gained back its catalytic activity and was
thereafter slowly secreted to the medium. The
Km value for nitrocefin of the
secreted molecules was the same as that of authentic E. coli
-lactamase. This result shows that the structural features essential
for catalytic activity of the heat-inactivated molecules were slowly
reestablished. The crystal structure of E. coli TEM1
-lactamase is a tight globule with a disulfide bond close to the
active site on the interior of the molecule (Jelsch et al.,
1992
). The role of Hsp104 in refolding events in the ER must be
physiologically relevant, because it controlled the conformational
repair of a number of authentic yeast cell wall mannoproteins as well
as vacuolar CPY. The conformational status of the yeast glycoproteins
was monitored by following their secretion competence, as in studies in
which misfolding was brought about by drugs or mutant ER chaperones
instead of heat (Simons et al., 1995
; Silberstein et
al., 1998
).
Although the
hsp104 deletion strains cannot form colonies
after severe heat stress, they remained viable for a long time, enabling us to study their physiology after severe heat stress. After
preconditioned
hsp104 cells were shifted from 48-50°C
back to physiological temperature (24°C), they were able to
synthesize, translocate, disulfide bond, glycosylate, and secrete
Hsp150
-
-lactamase for at least 7 h. This was true even for
hsp104 cells harboring the sec18-1 mutation
that were used to accumulate the reporters in the ER before thermal
insult in some of the experiments. This finding shows that the
temperature-sensitive secretion block caused by the mutant Sec18
protein was fully reversible after severe heat stress even in the
absence of Hsp104. The death of heat-treated
hsp104
cells, the direct cause of which is unknown (Parsell and Lindquist,
1993
), thus must have been due to later events. We conclude that
irreversible ER retention of heat-damaged secretory Hsp150
-
-lactamase, vacuolar CPY, and cell wall mannoproteins in
the absence of Hsp104 was not due to cell death or cessation of
membrane traffic but more likely was due to irreversible conformational damage of the reporter proteins.
Recently, Hsp104 was shown in vitro to act directly in the
solubilization of previously denatured cytosolic proteins, together with the Hsp70 member Ssa1p and its cochaperone Ydj1p, an Hsp40 member
(Glover and Lindquist, 1998
). The three proteins were suggested to
function as a chaperone machine in which Hsp104 first remodels aggregated proteins, making them accessible for Ssa1/Ydj1p, which then
provide a primary refolding function. Genetic data support the
interaction of Hsp104 and Hsp70 (Sanchez et al., 1993
). Our present observations cannot be explained by current models. To affect
the refolding events in the ER lumen, Hsp104 could transiently interact, directly or indirectly, with the cytosolic portion of a
membrane protein, whose lumenal portion would be involved with the ER
repair mechanism. For example, BiP/Kar2p exerts its effect from the ER
lumen to the cytosolic aspect of the ER membrane via Sec63p, a
membrane-spanning protein with cytosolic and lumenal portions,
to promote protein translocation (Lyman and Schekman, 1995
). Nuclear
fusion, which follows mating of haploid S. cerevisiae cells,
directly requires BiP/Kar2p and another lumen ER protein, Jem1p (Ng and
Walter, 1996
; Brizzio et al., 1999
). Whether Lhs1p, which is
required for conformational repair in the ER (Saris et al.,
1997
), interacts with Sec63p or other membrane-spanning proteins is not
known. Transient interactions are likely to be difficult to preserve
for detection. Indeed, the interaction of Hsp104 with Ssa1p and Ydj1p
is labile as a result of its dynamic nature (Glover and Lindquist,
1998
). In fact, Hsp104's cooperation with Ssa1p and Ydj1p could
provide a link to the ER membrane, because the latter are thought to
function in posttranslational translocation of polypeptides into the ER
(Deshaies et al., 1988
; Caplan et al., 1992
).
One explanation of how Hsp104 could affect the refolding
mechanism in the ER is that it performs its normal cytoplasmic repair function. This scenario holds that the cytoplasmic portion of a
transmembrane protein required for the lumenal repair functions would
be heat damaged. Hsp104 would repair the damage, restoring the activity
of the lumenal portion in the refolding of target proteins. However,
the mechanisms responsible for translocation and modification of
proteins, as well as for exocytosis, involving tens if not hundreds of
cytosolic proteins and cytosol-facing domains of membrane proteins, did
survive the thermal insult in the absence of Hsp104 or were rapidly
refolded by other chaperones. It would be surprising if the chaperone
mechanism involved in repair functions were more vulnerable to heat
than these mechanisms. Another possibility is that the interaction of
Hsp104 with the ER refolding mechanism is more specific. The unfolded
protein response exemplifies the transfer of information from the ER
lumen to the cytosol via the transmembrane protein kinase Ire1p/Ern1p (Cox et al., 1993
; Mori et al., 1993
). In any
case, Hsp104's function in the refolding events in the ER lumen, as in
conferring thermotolerance, requires its ATPase activity. Hsp104
appears to have a pivotal role in the survival of heat-stressed cells,
controlling the repair of damaged proteins not only in the cytosol but
even beyond the ER membrane.
| |
ACKNOWLEDGMENTS |
|---|
We thank Anna Liisa Nyfors for technical assistance, Dr. Leevi Kääriäinen for valuable comments on the manuscript, Dr. Susan Lindquist for yeast strains, and Dr. R. Himmelreich for cosmid 1F17. This work was supported by the Academy of Finland (grants 38017 and 41409). M.M. is a Biocentrum Helsinki fellow.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
marja.makarow{at}helsinki.fi.
| |
REFERENCES |
|---|
|
|
|---|
-Lactamase TEM1 of E. coli crystal structure determination at 2.5 Å resolution.
FEBS Lett.
299, 723-733.
-lactamase in the yeast cytoplasm prior to translocation into the endoplasmic reticulum.
Mol. Biol. Cell
9, 817-827
-lactamase fusion proteins in the endoplasmic reticulum of yeast.
J. Biol. Chem.
269, 13889-13892.This article has been cited by other articles:
![]() |
L. Seppa and M. Makarow Regulation and Recovery of Functions of Saccharomyces cerevisiae Chaperone BiP/Kar2p after Thermal Insult Eukaryot. Cell, December 1, 2005; 4(12): 2008 - 2016. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Song, Q. Wang, and C.-C. H. Li ATPase Activity of p97-Valosin-containing Protein (VCP). D2 MEDIATES THE MAJOR ENZYME ACTIVITY, AND D1 CONTRIBUTES TO THE HEAT-INDUCED ACTIVITY J. Biol. Chem., January 31, 2003; 278(6): 3648 - 3655. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chacinska, M. Boguta, J. Krzewska, and S. Rospert Prion-Dependent Switching between Respiratory Competence and Deficiency in the Yeast nam9-1 Mutant Mol. Cell. Biol., October 1, 2000; 20(19): 7220 - 7229. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Paunola, M. Qiao, A. Shmelev, and M. Makarow Inhibition of Translocation of beta -Lactamase into the Yeast Endoplasmic Reticulum by Covalently Bound Benzylpenicillin J. Biol. Chem., September 7, 2001; 276(37): 34553 - 34559. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Umebayashi, R. Fukuda, A. Hirata, H. Horiuchi, A. Nakano, A. Ohta, and M. Takagi Activation of the Ras-cAMP Signal Transduction Pathway Inhibits the Proteasome-independent Degradation of Misfolded Protein Aggregates in the Endoplasmic Reticulum Lumen J. Biol. Chem., October 26, 2001; 276(44): 41444 - 41454. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||