![]() |
|
|
Vol. 10, Issue 11, 3689-3703, November 1999
Department of Biochemistry and Biophysics, University of California, San Francisco, San Francisco, California 94143-0448
Submitted January 11, 1999; Accepted September 1, 1999| |
ABSTRACT |
|---|
|
|
|---|
We have performed a genetic and biochemical analysis of the SPO12 gene, which regulates meiotic nuclear divisions in budding yeast. When sporulated, spo12 mutants undergo a single meiotic nuclear division most closely resembling meiosis II. We observed that Spo12 protein is localized to the nucleus during both meiotic divisions and that Clb1-Cdc28, Clb3-Cdc28, Clb4-Cdc28, and Clb5-Cdc28 kinase activities during meiosis were not affected by a spo12 mutation. Using two-hybrid analysis, we identified several genes, three of which are meiotically induced, that may code for proteins that interact with Spo12p. We also observed that two genes, BNS1 (Bypasses Need for Spo12p), which has homology to SPO12, and SPO13, whose mutant phenotype is like that of spo12, can partially suppress the meiotic defect of spo12 mutants when overexpressed. We found that Spo12p is also localized to the nucleus in vegetative cells and that its level peaks during G2/M. We observed that a spo12 mutation is synthetically lethal in vegetative cells with a mutation in HCT1, a gene necessary for cells to exit mitosis, suggesting that Spo12p may have a role in exit from mitosis.
| |
INTRODUCTION |
|---|
|
|
|---|
Meiosis is required for the production of haploid gametes from
diploid cells. A unique feature of meiosis is that two rounds of
chromosome segregation
meiosis I and meiosis II
follow DNA synthesis.
In contrast, a single round of nuclear division follows each S phase in
mitosis. Although many of the same genes are required for both mitosis
and meiosis (Simchen, 1973
), their activities must be modified to allow
these distinct patterns of nuclear divisions to occur. The yeast gene
SPO12 regulates the meiotic nuclear divisions and may play a
role in mitosis as well. Mutations in SPO12 cause cells to
undergo a single meiotic division resembling meiosis II (Klapholz and
Esposito, 1980a
,b
). SPO12 mRNA is meiotically induced
(Malavasic and Elder, 1990
), peaking at the time of the meiotic nuclear
divisions (Chu et al., 1998
). SPO12 encodes a small protein of ~20 kDa (Malavasic and Elder, 1990
) that is novel and has no homologies to proteins of known function.
SPO12 mRNA is also present in vegetative cells (Parkes and
Johnston, 1992
). During vegetative growth, SPO12 message is
cell cycle regulated, peaking in M phase (Parkes and Johnston,
1992
; Cho et al., 1998
; Spellman et al., 1998
).
Although SPO12 is expressed in vegetative cells, deletion of
SPO12 causes only a mild vegetative phenotype: mutants
exhibit a slight G2/M delay (Parkes and Johnston, 1992
).
SPO12, however, does exhibit a number of intriguing
genetic interactions with genes required for exit from mitosis. For
example, deletion of SPO12 is synthetically lethal with
deletion of DBF2 (Parkes and Johnston, 1992
), which codes
for a protein kinase believed to be required for mitotic exit (Toyn and
Johnston, 1994
). Based on genetic arguments, Toyn and Johnston (1993)
hypothesized that Spo12p may be a regulatory subunit for the protein
kinases Dbf2 and its relative Dbf20. SPO12 has also been
isolated as a high-copy suppressor of a number of mutations
affecting vegetative growth, e.g., cdc15, dbf2-2,
cdc5-1, and tem1-3 (Parkes and Johnston, 1992
;
Shirayama et al., 1996
; Jaspersen et al., 1998
).
All of these mutant strains arrest late in mitosis, with high Clb-Cdc28 kinase activity. These observations suggest that SPO12 can
facilitate exit from mitosis when overexpressed, perhaps by
antagonizing Clb-Cdc28 kinase activity. How SPO12 functions
during mitosis and meiosis is not known. In this article, we describe
studies on the level and localization of Spo12p during mitosis and
meiosis, two-hybrid partners of Spo12p, high-copy suppression of
spo12 meiotic defects, mutant interactions, and the effects
of SPO12 on Clb-Cdc28 kinase activity during meiosis.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Media and Growth Conditions
Yeast were grown in YEPD (1% Bacto-yeast extract, 2%
Bacto-peptone, 2% dextrose) (complete) or minimal (SD; 10.67%
yeast nitrogen base without amino acids, 2% dextrose, 1× amino acids)
medium, as described by Hicks and Herskowitz (1976)
. Cells were
sporulated in liquid sporulation medium (0.3% potassium acetate and
0.02% raffinose; Kassir and Simchen, 1991
) or on sporulation plates (1% potassium, 25 µg/ml zinc acetate, 2% washed agar, and complete amino acids as for SD). Sporulating cultures were synchronized according to the standard regimen described by Padmore et
al. (1991)
with the following modifications. To identify a clone
of a particular strain with high sporulation efficiency, four colonies from the strain were grown in liquid YEPD and patched onto a
sporulation plate. The sporulation efficiency of each patch was
assessed microscopically after ~24 h. Overnight cultures
corresponding to the most efficient sporulators were used to inoculate
200 ml of YPA (1% potassium acetate, 2% bactopeptone, 1% yeast
extract) cultures (1:100 dilution). After ~15 h of growth in YPA,
cells were collected by filtration, washed twice in 200 ml of
double-distilled water, and resuspended in 200 ml of sporulation
medium. Time zero in each time course is defined as the time of
resuspension in sporulation medium.
Genetic and Molecular Biological Methods
Yeast genetic methods were used as described by Rose et
al. (1990)
. DNA manipulations were performed as described by
Sambrook et al. (1989)
Strains and Plasmids
Yeast strains used in this study are described in Table
1. pGal-SPO12, pGal-SIC1 (Jaspersen
et al., 1998
), pGPD-SPO12, and pGPD-SIC1 were all courtesy
of S. Jaspersen (University of California, San Francisco).
|
Epitope Tagging of Spo12, Spo13, Sic1, and Clb4
Starting plasmids for each construct were the following:
pRS306-SPO12, a 0.8-kilobase (kb) EcoRI fragment (from L. Johnston, National Institute for Medical Research, London,
United Kingdom) cloned into pRS306; pRS306-SPO12(long), a 1.7-kb
PvuII fragment (from S. Jaspersen) cloned into pRS306;
pRS306-SPO13, a 2.6-kb BamHI/NarI fragment
derived from BE806 (from R. Esposito, University of Chicago, Chicago,
IL) cloned into pRS306; pRS306-SIC1, a 2.1-kb EcoRI/BglII genomic fragment (from S. Jaspersen)
cloned into pRS306; and pRS306-CLB4, a 2.7-kb fragment cloned by PCR
amplification with the use of oligonucleotides OMG66
(5'GAAAGCGGCCGCACCGGAATGACCTGGAACCG) and OMG67
(5'GAAAGAATTCGGATACCCAGCATATCAGG). This fragment was cloned into pRS306
with the use of the NotI and EcoRI sites
introduced by PCR amplification. For all of the plasmids listed above,
site-directed mutagenesis was used to introduce an in-frame
BamHI (SPO13, SIC1, and
CLB4) or BglII (SPO12) site. For
N-terminal epitope tagging, the new site was introduced just downstream
of the translational start. For C-terminal tagging of reading frames,
the site was introduced immediately upstream of the translational stop
codon. A BamHI fragment containing two copies of an 11-amino
acid HA epitope (YPYDVPDYSAL; Wilson et al., 1984
) or a
multimerized Myc epitope (EQKLISEEDLN; Evan et al., 1985
)
was inserted into the introduced site.
Construction of CLB3HA
Starting with a pGal-CLB3HA clone constructed by S. Jaspersen, a
BamHI/XbaI fragment containing the
CLB3HA reading frame was cloned into pRS306. PCR was used to
amplify a 1-kb 5' flanking sequence (with the use of oligonucleotides
OMG60 [5'CCGGAAATTCACCACGTTTGACAC] and OMG61
[5'CCGGGGATCCAGTCCTGTGTTTAAG]) and a 1-kb 3' flanking sequence (with
the use of oligonucleotides OMG62 [5' CCGGTCTAGAAAAGCCTCAGCTCGAGACAT] and OMG63 [5'GAAAGCGGCCGCGAACTAATCG-TCCTGTTACC]). These
fragments were sequentially cloned upstream (5' flanking sequence) and
downstream (3' flanking sequence) of the ORF in pRS306 with the use of
the restriction sites introduced by PCR amplification. Finally, a 2.2-kb EcoRI/BglII fragment derived from genomic
clone A5 (Fitch et al., 1992
) was used to substitute for the
equivalent fragment in the CLB3HA genomic clone; thus, only sequences
3' to the HA epitope tag were derived from PCR-amplified DNA.
Construction of CLB1HA in pRS306
A 2.5-kb fragment including the CLB1HA gene was PCR amplified with the use of oligonucleotides OMG55 (5'GAAAGAGCTCGATTTCCTCATTCGTCTTCC) and OMG56 (5'GAAAGTCGACGTCGAAGGAATTAGGAAGGC) from a strain containing CLB1HA (from M. Tyers, Mount Sinai Hospital, Toronto, Ontario, Canada). The resulting fragment was then cloned into pRS306 with the use of SpeI and SacI sites introduced by PCR amplification.
Disruption of SPO12
Starting with the spo12::TRP1 construct of
Parkes and Johnston (1992
; courtesy of L. Johnston), an
XbaI/BamHI fragment containing the
hisG-URA3-hisG cassette (Alani et al., 1987
) was
substituted for the XbaI/BamHI fragment of
spo12::TRP1, which contained most of the
TRP1 sequence, yielding
spo12::hisG-URA3-hisG.
Disruption of BNS1
A 1.5-kb genomic fragment containing the BNS1 ORF and
flanking sequences was PCR amplified from genomic DNA with the use of oligonucleotides OMG23 (5'CCGGGAATTCGTGCTTTAGGGCTTGGTGCC) and OMG24
(5'CCGGACTAGTTCGCCAGAGTTTACGAACGC) and cloned into pBluescript KS+ with the use of EcoRI and
SpeI sites introduced in the oligonucleotides. Oligonucleotides OMG25
(5'GGCCGGATCCCGCAAATCTGTTACTTTTTTTTAGC-GC) and
OMG26 (5'GGCCGGATCCTTTAACGGATGATGATCATAAATTGGC) were then used to
amplify sequences 5' and 3' to the ORF as well as the pBluescript backbone. This fragment was then cut with BamHI
(introduced in OMG25 and OMG26) and religated, resulting in a
circularized plasmid in which a BamHI site was present in
place of the BNS1 ORF. The resulting plasmid was then cut
with BamHI, and the BamHI/BglII fragment of pNKY51 (Alani et al., 1987
) containing the
hisG-URA3-hisG cassette was inserted, resulting in the
bns1::hisG-URA3-hisG construct.
Construction of pLexA-SPO12
A pRS306-SPO12 clone containing a BglII site introduced immediately downstream of the translational start (see above) was cut with Asp718 (filled in with the Klenow fragment of DNA polymerase) and BglII and cloned into pEG203 cut with XhoI (filled in with the Klenow fragment of DNA polymerase) and BamHI to yield pLexA-SPO12.
Immunofluorescence and DAPI Staining
Cells were processed for immunofluorescence as described
by Sil and Herskowitz (1996)
. DAPI staining of sporulating cells was
carried out by fixing cells in 70% ethanol or formaldehyde, rinsing
once in 1× PBS, incubating for 12 min in 1 µg/ml DAPI, washing once
in 1× PBS, and spotting on a slide for microscopic examination.
Cell Extracts and Immunoblot Analysis
Cell extracts were prepared for immunoblot analysis
essentially as described by Sanders and Herskowitz (1996)
with the
following modifications. Samples were fractionated with 12.5%
SDS-polyacrylamide gels and dry blotted with the use of a dry blot
apparatus (E&K Scientific Products, Saratoga, CA) according to
the manufacturer's instructions. Filters were blocked for 1-16 h in
TBS containing 0.1% Triton X-100 and 2% nonfat dry milk and decorated
with a 1:1000 dilution of HA11 or 12CA5 anti-HA antibodies (Babco,
Richmond, CA). A 1:2000 dilution of goat anti-mouse
immunoglobulin G heavy and light chain coupled to HRP (Bio-Rad,
Richmond, CA) was used as the secondary antibody. Spo12-HA protein was
visualized with the use of the Amersham (Arlington Heights, IL) ECL
protein detection kit.
Synchronization of Cells with
-Factor
A total of 200 ml of a SPO12-HA cells
(YMG530) were grown to OD600 = 0.3 at 30°C and
arrested with 20 µg/ml
-factor (Bio-Synthesis, Lewisville, TX) for
3-3.5 h. Cells were collected by filtration and washed twice with 200 ml of 30°C YEPD. Cells were resuspended in 200 ml of 30°C YEPD and
allowed to reenter the cell cycle. Samples (10 ml) were taken every 10 min. One milliliter was fixed for microscopic examination of budding
index, and the remainder was processed for immunoblot analysis.
Two-Hybrid Analysis
Two-hybrid analysis was performed as described by Gyuris
et al. (1993)
. Yeast strain EGY48 containing the reporter
plasmid pSH18-34 was cotransformed with pLexA-SPO12 and a library of
Saccharomyces cerevisiae genomic plasmids in a pJG4-5 vector
containing transcriptional activation domain fusions (courtesy of R. Brent, Massachusetts General Hospital, Boston, MA). Of 385,000 independent transformants screened, 886 colonies were identified that
allowed growth on SD-LEU as a result of the activation of the
LexAop::LEU2 reporter construct. These were colony purified
and tested for the ability to activate Gal-inducible transcription of
two reporter constructs (LexAop::LEU2 and pSH18-34; Gyuris
et al., 1993
) in the presence of pLEXA-SPO12. Fourteen
clones were able to do so. The specificity of the interaction of these
clones with pLexA-SPO12 was tested by analyzing the activation
potential of these clones when coexpressed with an unrelated LexA
DNA-binding domain fusion (pRFHM1; Gyuris et al., 1993
). DNA
sequencing of plasmids was done with the use of an Applied Biosystems
(Foster City, CA) sequencing machine (Biomolecular Resource
Center facility, University of California, San Francisco).
High-Copy Suppression Analysis
A library of S. cerevisiae genomic plasmids in the
2-µm vector YEp13 (Nasmyth and Reed, 1980
) was transformed into a
strain homozygous for spo12::hisG-URA3-hisG.
Individual transformants were patched onto selective medium to select
for the library plasmid and replica plated to sporulation medium. Cells
from each patch of sporulating cells were microscopically examined for
tetrads. Approximately 8,000 independent transformants were analyzed.
Plasmids with suppressing activity were rescued from yeast and
retransformed into a spo12 deletion mutant. All five
positive clones were tested for the presence of SPO12 or
BNS1 by PCR. For the two clones that did not contain
SPO12 or BNS1, end sequencing was performed to map the genomic inserts. The inserts of these clones were found to
overlap in a small region containing just two complete ORFs, SPO13 and ARD1. SPO12,
BNS1, and SPO13 were each subcloned into pRS425
and tested for the ability to suppress spo12 or
spo13 mutations.
Histone H1 Kinase Assays from Sporulating Cultures
Ten-milliliter aliquots were collected from 200-ml cultures of
cells undergoing synchronous meiosis at 30- or 60-min intervals after
resuspension in sporulation medium. One milliliter was fixed for DAPI
analysis, and the remainder was processed for kinase assays as
described below. Cells were collected by centrifugation, washed once
with water, and frozen in liquid nitrogen until processing. Pellets
were then allowed to thaw on ice and were resuspended in 500 µl of IP
buffer (20 mM Tris, pH 7.4, 100 mM NaCl, 50 mM NaF, 50 mM
-glycerophosphate, 5 mM EDTA, 0.2% Triton X-100, 1 mM PMSF, 2 µg/ml aprotinin, 2 mM benzamidine, 0.1 mM
Na3VO4). Cells were lysed
by bead beating twice for 1 min in a Biospec Products (Bartlesville,
OK) mini bead beater according to the manufacturer's
instructions. Supernatant was collected and centrifuged for 10 min at
4°C. Supernatant was then transferred to a fresh tube, and protein
concentration was determined by the Bradford assay (Bio-Rad).
ClbHA-Cdc28p kinase complexes were immunoprecipitated from 500 µg of
total protein per sample with 1 µl of 12CA5 antibody (Babco) and 40 µl of a 1:1 slurry of protein A-CL4B Sepharose (Pharmacia,
Piscataway, NJ) equilibrated in IP buffer by rocking for 1-3 h at
4°C. Immunoprecipitates were collected by centrifugation and washed
three times in IP buffer. Immunoprecipitates were then washed once in
50 mM HEPES, pH 7.4, 1 mM DTT. Excess liquid was removed, and
immunoprecipitates were resuspended in 20 µl of kinase assay reaction
mixture (50 mM HEPES, pH 7.4, 2 mM MgCl2, 100 µM ATP, 1 mM DTT, 5 µg of histone HI [Fluka Chemical, Buchs,
Switzerland], 2.5 µCi [32P]
ATP) and
incubated at room temperature for 20 min. Reactions were stopped with
10 µl of 4× sample buffer. Samples were boiled for 10 min and
fractionated on a 12.5% SDS-polyacrylamide gel. Gels were fixed for 20 min in destain (25% methanol, 7.5% glacial acetic acid), dried, and
exposed for ~16 h.
| |
RESULTS |
|---|
|
|
|---|
Localization and Levels of Spo12p during Meiosis
To characterize Spo12p during meiosis, we constructed both Myc and HA epitope-tagged versions of Spo12p, which were used for immunofluorescence and immunoblotting, respectively. Both epitope-tagged versions of Spo12p were able to complement the meiotic defect of a homozygous spo12 deletion mutant when integrated in single copy (our unpublished results).
Immunofluorescence was used to determine the cellular localization of
Spo12p during meiosis. Progress through meiosis in these experiments
was monitored by DAPI staining. By immunolocalization, we saw Spo12p
staining predominantly in cells that were undergoing meiosis I or
meiosis II (Figure 1A). Cells with small,
round nuclei that exhibited Spo12p staining were occasionally observed
(data not shown). It was not possible to determine by
immunofluorescence whether these were sporulating cells or vegetative
cells that had not yet entered the sporulation program (Spo12p is also
expressed during the mitotic cell cycle; see below). In all cases,
Spo12p colocalized with DAPI staining, indicating that it is
predominantly if not exclusively nuclear. By the time the meiotic
nuclear divisions were complete, Spo12p was no longer detectable.
|
We used immunoblot analysis to determine the time course of
Spo12p expression during meiosis (Figure 1B). For these experiments, we
used the SKI strain background, which progresses through meiosis relatively synchronously (Padmore et al., 1991
). Progress
through meiosis was monitored by DAPI staining. Spo12p first became
detectable as cells started to enter the meiotic divisions (~5 h) and
was most prominent when the cells were in meiosis I or meiosis II. Once
meiosis was complete, Spo12p was no longer detectable. The lack of
Spo12p at the beginning of the meiotic time course and in cells
arrested in YPA medium suggests that the cells observed by
immunofluorescence with small round nuclei that contained Spo12p are
likely to be residual vegetative cells in the sporulating culture.
Localization and Presence of Spo12p during Vegetative Growth
Although the phenotype of spo12 mutants is most
striking in sporulating cells, SPO12 does have a role in
vegetative growth; spo12 mutants exhibit a slight G2/M delay
(Parkes and Johnston, 1992
). SPO12 mRNA is present in
vegetative cells, and its message is one of many genes known to exhibit
cell cycle periodicity, peaking in M phase (Cho et al.,
1998
; Spellman et al., 1998
). Using the same epitope-tagged
constructs as in the meiotic studies, we determined the localization of
Spo12p during vegetative growth and its expression throughout the
mitotic cell cycle (Figure 2). As in
meiosis, Spo12p was predominantly nuclear during vegetative growth.
Staining was most prominent in large-budded cells that were going
through mitosis, although staining was also observed in unbudded cells
and in cells with small buds.
|
To obtain a more precise profile of the level of Spo12p throughout the
mitotic cell cycle, we used
-factor to synchronize a population of
cells containing epitope-tagged Spo12p in G1. The cells were then
released from
-factor arrest, and aliquots were taken every 10 min
and analyzed for Spo12p by immunoblotting. Progress
through the cell cycle was monitored by scoring budding index (Figure
2B). We found that Spo12p was expressed with some periodicity, peaking
as cells were in G2/M and at its lowest levels during G1 and S (Figure
2C). The pattern of protein expression parallels the cell cycle
regulation of SPO12 mRNA observed by Parkes and Johnston
(1992)
. In addition, Spo12p levels are at their highest at the same
point in the cell cycle that seems to be affected in the
spo12 deletion mutant, i.e., G2/M.
Two-Hybrid Analysis
Two-hybrid analysis was used to identify proteins that may
physically interact with Spo12p. We constructed an in-frame fusion of
the entire SPO12 ORF to the LexA DNA-binding domain and
demonstrated that this construct (pLexA-SPO12) had no intrinsic
transcriptional activity when transformed into strains containing
reporter constructs regulated by LexA DNA-binding sites (not shown). To
identify proteins that can interact with LexA-Spo12p to activate
transcription, a library of S. cerevisiae genomic clones in
the pJG4-5 vector (courtesy of R. Brent) was transformed into EGY48,
which contained pLexA-SPO12 and appropriate reporter constructs.
Because a genomic library was used in this study, in principle it
should have been possible to identify both meiotic and vegetative
partners of Spo12p. Of 385,000 independent transformants, 14 were able
to activate transcription of two independent reporter constructs in the
presence of pLexA-SPO12. These same clones were unable to induce
transcription when coexpressed with an unrelated LexA DNA-binding
domain fusion (pRFHM1; Gyuris et al., 1993
), indicating that
the interaction with LexA-SPO12 was specific. All 14 clones were
sequenced to determine the nature of the library activation domain
fusion proteins.
Three of the 14 clones contained very short fusion protein products
that did not correspond to identified ORFs in the S. cerevisiae genome. The remaining 11 corresponded to novel or known
genes (Table 2). Ten of the clones were
isolated only once in the screen; the plasmid containing the fusion to
YDR267C was isolated twice. Three of the genes identified in the
two-hybrid screen are induced during meiosis (Chu et al.,
1998
). They are MEC3, which plays a role in a DNA damage
checkpoint gene in mitotic cells (Weinert et al., 1994
);
YLR132C, a novel ORF; and FUR1, which encodes uracil phosphoribosyltransferase (Kern et al., 1990
).
|
High-Copy Plasmid Suppression of a spo12 Mutation during Meiosis
To identify genes that can function in place of or
downstream of SPO12 during meiosis, we carried out a screen
for high-copy plasmids that could compensate for a complete deletion of
SPO12. A library of S. cerevisiae genomic clones
in the 2-µm vector YEp13 (Nasmyth and Reed, 1980
) was transformed
into a strain homozygous for a spo12 deletion (YMG270).
Individual transformants were patched onto selective medium to select
for the library plasmid and then replica plated to sporulation medium.
Cells from each patch of sporulating cells were microscopically
examined for the presence of tetrads, which indicated restoration of
SPO12-like activity. Of ~8000 independent transformants, 7 clones allowed the spo12 deletion strain to form some
tetrads (9-80% of total asci; Table 3).
Homozygous spo12 mutants carrying YEp13 formed virtually no
tetrads (<0.3%; Table 3). Plasmids with suppressing activity were
rescued from yeast and retransformed into the spo12 deletion strain. Of these, five retained the ability to suppress the
spo12 deletion at least partially. These clones were
analyzed further to determine the sequences responsible for the
suppressing activity.
|
The two clones with the strongest ability to suppress the deletion
phenotype, 21-36 and 47-32, encoded SPO12 itself (Table 3).
A third clone, 32-1, contained YGR230W, an ORF with homology to
SPO12 (Figure 3). We have
named this ORF BNS1 for Bypasses Need for
Spo12p. In addition, two independent clones contained SPO13, another gene required for progression through the
meiotic nuclear divisions (see below). Each of these three ORFs
(SPO12, BNS1, and SPO13) was subcloned
into another high-copy vector (pRS425) to determine whether they were
responsible for the complementing activity. Suppression was observed in
each case, but the magnitude of suppression was 1.5- to 3-fold lower
than that of the original library clone. The reduced suppression may
have been due to a slightly lower copy number of clones in pRS425 than
in YEp13 or to the presence of additional ORFs on the original plasmids
that contribute to the suppression, although this seems unlikely. In any case, it is clear that overexpression of SPO12,
SPO13, and BNS1 allows a homozygous
spo12 deletion strain to sporulate to form some tetrads
instead of dyads.
|
In an attempt to understand how BNS1 and SPO13
can partially compensate for the lack of Spo12p, we characterized these
ORFs further. BNS1 mRNA is not induced during meiosis (Chu
et al., 1998
). BNS1 is predicted to encode a
137-amino acid protein of 15.8 kDa that is homologous to Spo12p (40%
identical over 80 amino acids; Figure 3A). Like Spo12p, the protein
encoded by BNS1 is very basic (predicted isoelectric point
of 11.22 compared with an isoelectric point of 10.19 for Spo12p).
Neither Spo12p nor Bns1p contains any recognizable structural motifs,
nor are they similar to Spo13p. The highest degree of identity between
Spo12p and Bns1p is a segment of 19 amino acids that is also homologous to at least three other hypothetical ORFs, one from
Schizosaccharomyces pombe, one from Caenorhabditis
elegans, and, intriguingly, an expressed sequence tag isolated
from a human testis cDNA library (Figure 3B). The functional
significance of this homology is not known.
To determine whether BNS1 plays a role during meiosis or
vegetative growth, we replaced its coding sequence with the
hisG-URA3-hisG cassette (Alani et al., 1987
).
Strains homozygous for the bns1 deletion were fully viable
and sporulated as efficiently as wild-type strains. We also determined
the phenotype of a spo12
bns1
double mutant. These strains were also viable and did not display any obvious
vegetative growth defects. Furthermore, when sporulated, the
spo12
bns1
double mutant formed dyads with the same
efficiency as a spo12 single mutant. Thus, although
BNS1 can partially compensate for a lack of SPO12
function when overexpressed, it does not appear to play any role in
controlling meiotic nuclear divisions.
Analysis of Spo13p
SPO13, like SPO12, is clearly important for
programming the meiotic nuclear divisions. A homozygous
spo13 deletion mutant sporulates to form dyads with high
efficiency, and as in spo12, the single meiotic division
observed in spo13 most closely resembles meiosis II
(Klapholz and Esposito, 1980a
,b
). To gain some additional information
regarding when and where Spo13p might act, we epitope tagged the
SPO13 ORF with the Myc epitope. This protein was able to
complement the meiotic defect of a homozygous spo13 deletion mutant when integrated at single copy (our unpublished results). We
found that like Spo12p, Spo13p is also predominantly nuclear (Figure
1C). However, Spo13p was detectable only before meiosis I and not
during meiotic nuclear divisions. Spo13p was seen in mononucleate cells
with large nuclei with diffuse DAPI staining. We hypothesize that these
correspond to cells immediately before meiosis I, probably in the late
stages of or after the completion of premeiotic DNA synthesis. Because
we were unable to detect Spo13p in vegetative cultures, it is unlikely
that the Spo13p-staining cells in sporulating cultures were
contaminating vegetative cells. The temporal profiles of Spo13p and
Spo12p during meiosis suggest that SPO13 acts upstream of
SPO12.
Because of the similarity between Spo12p and Bns1p, we tested the hypothesis that SPO13 was able to high-copy suppress spo12 mutants by activating BNS1. If this were true, overexpression of SPO13 should not be able to suppress a spo12 bns1 double mutant. High-copy SPO13, however, was able to suppress the double mutant as efficiently as it suppressed spo12 single mutants (our unpublished results).
Because high-copy SPO13 was able to partially suppress the phenotype of a spo12 deletion mutant, we tested whether the reciprocal was also true, i.e., whether overexpression of SPO12 could suppress the phenotype of a spo13 mutant. High-copy plasmids encoding SPO12 or BNS1 were transformed into a homozygous spo13 deletion mutant, and the strains were sporulated (Table 3). Empty-vector and high-copy SPO13 plasmids were used as controls. High-copy SPO13 was, as predicted, the strongest suppressor. High-copy SPO12 could weakly suppress the spo13 mutant phenotype. Although the total number of tetrads seen in high-copy suppression of the spo13 mutant by SPO12 was comparable to that seen by high-copy suppression of spo12 by SPO13, the magnitude of the suppression was quite different (~3-fold versus ~37-fold; Table 3) as a result of differences in the background number of tetrads observed in spo12 versus spo13 mutants. In spo12 mutants, one virtually never sees any tetrads formed, whereas in spo13 mutants, we observed a background level of tetrads that could reach as high as ~8%. High-copy BNS1 did not cause statistically significant suppression of a spo13 deletion. Thus, overexpression of BNS1 can partially bypass the need for SPO12 but not SPO13 function.
Genetic Interactions of spo12 with hct1 and sic1
Overexpression of SPO12 can suppress the late mitotic
arrest phenotype of a number of mutants that arrest with high Clb-Cdc28 kinase activity (Parkes and Johnston, 1992
; Shirayama et
al., 1996
; Jaspersen et al., 1998
), suggesting that
SPO12 may play a role in exit from mitosis. To determine
whether Spo12p may act to decrease Clb-Cdc28 kinase activity, we tested
whether deletion of SPO12 was synthetically lethal with
hct1 or sic1 mutants. HCT1 encodes a
substrate-specific regulator of the anaphase-promoting complex (APC)
and is required for degradation of Clb2p during exit from mitosis
(Schwab et al., 1997
; Visintin et al., 1997
). SIC1 encodes a cyclin-dependent kinase inhibitor (CKI) that
is expressed from late mitosis into G1 (Donovan et al.,
1994
). Although a strain containing deletion of HCT1 or
SIC1 alone is viable, hct1 sic1 double mutants
are inviable. This result has been interpreted to mean that as long as
at least one of the two pathways for inactivating Clb-Cdc28 kinase
activity is intact (through proteolysis mediated by Hct1p or by
inhibition of Clb-Cdc28 by Sic1p), cells are able to progress through
the cell cycle relatively normally. Inactivation of both pathways
simultaneously, however, causes cells to arrest with large buds,
presumably with high Clb-Cdc28 kinase activity (Schwab et
al., 1997
). We found that whereas spo12 sic1 double mutants were viable, spo12 hct1 double mutants were inviable
(Table 4). Thus, if Spo12p inhibits
Clb-Cdc28 kinase activity, it does so in an APC-independent manner and
may facilitate the activity of a CKI, presumably Sic1p.
|
To investigate this hypothesis further, we found by
immunoblot analysis that Spo12p and Sic1p show similar
levels throughout the mitotic cell cycle (data not shown). We also
tested whether the ability of SPO12 to suppress
cdc15-2 when overexpressed (Jaspersen et al.,
1998
) was dependent on SIC1 function. Although
overexpression of SPO12 did suppress the growth defect of a
cdc15-2 mutant, it did not suppress the defect of a
cdc15-2 sic1 double mutant (Figure 4A). In addition, the ability of
SIC1 to suppress cdc15 when overexpressed (Mendenhall, 1993
; Schwob et al., 1994
; Toyn et
al., 1997
; Jaspersen et al., 1998
) was dependent on
having an intact copy of SPO12 in the genome (Figure 4B).
These results suggest that Spo12p and Sic1p may act together in
vegetative cells to facilitate exit from mitosis.
|
Effect of Spo12p on Clb-Cdc28 Kinase Activity during Meiosis
We examined the levels of Sic1p during meiosis to test the
hypothesis that Spo12p might interact with Sic1p during meiosis to
modulate Clb-Cdc28 kinase activity and thus control progress through
the meiotic nuclear divisions. We were unable to detect any Sic1p in
meiotic cells, although high levels of Sic1p were found in cells
arrested in YPA presporulation medium (Dirick et al., 1998
;
our unpublished results). Thus, if Spo12p interacts with a CKI during
meiosis, it is unlikely to be Sic1p.
To test more directly the hypothesis that Spo12p modulates Clb-Cdc28
kinase activity during meiosis, we followed levels of kinase activity
during meiosis in the wild type and in spo12 mutants (Figure 5). For this experiment, we
constructed HA epitope-tagged versions of the five Clb proteins
expressed during meiosis
Clb1p, Clb3p, Clb4p, Clb5p, and Clb6p
(Grandin and Reed, 1993
; Chu and Herskowitz, 1998
; Stuart and
Wittenberg, 1998
)
and introduced them individually as homozygous gene
replacements into wild-type SK1 cells or homozygous spo12
deletion mutants in the SK1 strain background. These strains were then
sporulated synchronously, and aliquots were taken at intervals of
30-60 min over a period of 9 h, at which point most of the cells
had completed the meiotic divisions. Progress through meiosis was
monitored by DAPI staining (Table 5).
Clb-associated kinases were immunoprecipitated from the same amount of
total protein from each culture, and in vitro kinase assays were
performed with histone H1 as substrate. We were unable to detect any
H1-associated kinase activity in wild-type or spo12 mutant
strains containing Clb6-HA (data not shown). For the remaining strains,
no significant differences between the wild type and the
spo12 mutants in the timing or the level of activation of
the specific Clb-Cdc28 kinases were detected (Figure 5).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Spo12p plays an important role in meiosis and appears to have a role in the mitotic cell cycle as well. We have made several observations on SPO12 that bear on its meiotic and mitotic roles.
Presence and Localization of Spo12p
We found that Spo12p is localized to the nucleus during meiosis
and mitosis. Spo12p is present during the meiotic nuclear divisions but
is not detectable by immunoblot or immunofluorescence at
other times, making it unlikely that it is present but delocalized in
these cells. SPO12 mRNA levels have a similar profile during meiosis (Malavasic and Elder, 1990
; Chu et al., 1998
).
Immunoblot analysis of a synchronized vegetative cell
population showed that Spo12p is present throughout the mitotic cell
cycle and peaks in G2/M. SPO12 mRNA levels have also been
shown to peak at this stage of the cell cycle (Parkes and Johnston,
1992
; Cho et al., 1998
; Spellman et al., 1998
).
Proteins That Interact with Spo12p
Candidate proteins that interact with Spo12p were
identified with the use of the two-hybrid system. At least three of the genes identified in this screen are induced to some level during meiosis (Chu et al., 1998
) and clearly warrant further
study. They are YLR132C, MEC3, and FUR1. YLR132C
is a novel ORF with no known homologies. Its transcript exhibits an
expression pattern during sporulation that is similar to that of
SPO12 (Chu et al., 1998
), suggesting that their
proteins may be present at the same time during sporulation and have
the opportunity to interact physically.
MEC3 is required for the DNA damage checkpoint response in
mitosis and is probably required for the meiotic recombination checkpoint (Weinert et al. 1994
; Lydall et al.,
1996
; Lydall and Weinert 1997
). Transcription of MEC3 is
induced twofold when cells enter the meiotic divisions (Chu et
al., 1998
). Perhaps interaction between Spo12p and Mec3p signals a
meiotic cell that recombination is complete and that the cell can
execute meiosis I.
FUR1 encodes uracil
phosphoribosyltransferase, which produces UMP from uracil (Kern
et al., 1990
). Transcription of FUR1 is induced
when cells enter meiotic divisions (Chu et al., 1998
). Although a link between Spo12p and pyrimidine metabolism is not obvious, FUR1 is notable because of a previous functional
connection between FUR1 and SPO12: overexpression
of either gene can suppress mitotic arrest resulting from
overexpression of stabilized Clb2 (Glotzer, 1993
). Overexpression of
SPO12 or FUR1 suppresses point mutations but not
deletions in the CLB2 destruction box.
The other candidate partners for Spo12p might function with Spo12p during vegetative growth. Whether any of these proteins physically interact with Spo12p remains to be determined
Overexpression of BNS1 and SPO13 Can Partially Suppress the spo12 Meiotic Phenotype
We used high-copy suppression of a spo12 deletion to identify proteins that can drive the two meiotic nuclear divisions in the absence of Spo12p. The rationale was that these proteins might be downstream targets of Spo12p or might bypass the requirement of Spo12p for the meiotic divisions. We found two genes, BNS1 and SPO13, that could partially compensate for a complete lack of Spo12p during meiosis.
BNS1 is the only ORF in the yeast genome with
significant homology to SPO12. Their proteins are 40%
identical over ~80 amino acids, with one segment containing 14 of 19 identical residues and 4 of 19 conservative changes. Proteins
containing this segment are also found in a number of other organisms,
including S. pombe, C. elegans, and humans. The
degree of similarity with Spo12p does not extend significantly beyond
this region. In at least one other circumstance, BNS1 can
function like SPO12: both BNS1 and
SPO12 can suppress the arrest phenotype of
cdc15-2 mutants when overexpressed (Jaspersen et
al., 1998
). Despite the similarity between SPO12 and
BNS1, BNS1 does not appear to have a role in
meiosis: BNS1 mRNA is not induced during meiosis (Chu
et al., 1998
), null mutants for bns1 exhibited no
meiotic phenotype, and spo12 bns1 double mutants were viable
with no obvious growth defects. Spo12p protein has been proposed to be
a cofactor for the protein kinase Dbf2p (Toyn and Johnston, 1993
).
Perhaps Bns1p acts to facilitate the activity of the Dbf2-related
protein kinase Dbf20p.
Although both Spo12p and Spo13p are nuclear, Spo13p is present before
Spo12p. How then can suppression of spo12 by
SPO13 be explained? Overexpression of SPO13
during meiosis has been reported to delay meiosis I (McCarroll and
Esposito, 1994
). spo12 mutants skip meiosis I and execute
only meiosis II (Klapholz and Esposito, 1980a
,b
). Perhaps
overexpression of SPO13 in spo12 mutants delays meiotic divisions long enough that a compensatory mechanism can trigger
meiosis I. Another possibility is that overexpression of
SPO13 in spo12 mutants somehow promotes a second
round of nuclear division that follows the meiosis II-like division
that normally occurs in spo12 mutants. Assessment of the
patterns of chromosome segregation or spore viability under conditions
of suppression might make it possible to distinguish between these two possibilities.
We have also observed that SPO12 can partially suppress spo13 mutants when overexpressed. This suppression can be explained if SPO12 acts downstream of SPO13, as is indicated by their temporal patterns of expression. The magnitude of suppression might be low because Spo13p activates targets other than Spo12p for efficient sporulation.
Synthetic Lethality of spo12 and hct1 Further Supports a Role for SPO12 in Exit from Mitosis
A critical event for exit from mitosis is the inactivation of
Clb-Cdc28 kinase activity. Although the phenotype of spo12
mutants in vegetative cells is subtle, overexpression of
SPO12 can suppress late mitotic arrest of several different
mutants. All of these mutants arrest with high Clb-Cdc28 kinase
activity, leading to the hypothesis that Spo12p inhibits Clb-Cdc28
kinase activity in some way (Shirayama et al., 1996
). The
fact that Spo12p is expressed in late mitosis and that spo12
mutants experience a G2/M delay indicates that SPO12
normally has a role at this time.
We observed that spo12 and hct1 are synthetically
lethal. HCT1 is a component of the APC that is required for
degradation of Clb2p and subsequent inactivation of Clb-Cdc28 kinase
activity (Schwab et al., 1997
; Visintin et al.,
1997
). Synthetic lethality of spo12 with hct1, a
known component of the APC, suggests that if Spo12p acts to inhibit
Clb-Cdc28 kinase activity, it does not do so via an APC-dependent mechanism.
One possibility is that Spo12p activates a CKI. Sic1p is present from
late M into G1 and is required to keep Clb5- and Clb6-Cdc28 kinases
inactive until cells are ready to replicate their DNA (Donovan et
al., 1994
). Sic1p may also play a role in exit from mitosis
(Donovan et al., 1994
; Toyn et al., 1997
). Thus,
one attractive possibility is that Spo12p may facilitate Sic1p activity
during vegetative growth. Genetic observations indicate that this
hypothesis may be correct. The ability of SPO12 when
overexpressed to suppress cdc15-2, which arrests late in
mitosis with high Clb-Cdc28 kinase activity, requires functional
SIC1. In addition, the ability of SIC1 to
suppress cdc15-2 requires functional SPO12.
Therefore, these proteins may act together. For example, interaction
between Spo12p and Sic1p may stabilize Sic1p and allow it to decrease Clb-Cdc28 kinase activity. Another possibility is that Spo12p acts to
inhibit SCF, which is required for degradation of Sic1p (Feldman
et al., 1997
; Skowyra et al., 1997
).
Spo12p Does Not Affect Clb1-, Clb3-, Clb4-, or Clb5-Cdc28 Kinase Activity during Meiosis
The experiments in mitotic cells described above lead to the
possibility that Spo12p might regulate Clb-Cdc28 kinase activity during
meiosis. Five of the six B-type cyclins are expressed during meiosis
(all but CLB2), and deletion of the CLB genes
either alone or in combination can lead to the reduction or complete
absence of the meiotic nuclear divisions, depending on the mutant
combination (Grandin and Reed, 1993
; Dahmann and Futcher, 1995
; Chu and
Hersko-witz, 1998
; Stuart and Wittenberg, 1998
). Because Spo12p may
inhibit Clb-Cdc28 kinase activity in vegetative cells, and because of the clear importance of the Clb proteins for meiosis, we hypothesized that Spo12p might modulate Clb-Cdc28 kinase levels during meiosis.
We first considered the possibility that Spo12p regulates Clb-Cdc28 kinase activity during meiosis through Sic1p; however, Sic1p was not detectable in meiosis after the very early stages and in particular was absent during the meiotic divisions, when Spo12p is believed to be required. Our observations provide no support for the hypothesis that Spo12p acts via Sic1p in meiosis. We then examined Clb1-, Clb3-, Clb4-, Clb5-, and Clb6-Cdc28 kinase activities directly in the wild type and in spo12 mutants. The levels and timing of specific Clb-Cdc28 kinase activities (as assayed by measuring histone H1 kinase activity in vitro) were indistinguishable for wild-type and spo12 mutant strains, indicating that Spo12p does not regulate these species.
So what is Spo12p doing? It remains an open question whether Spo12p regulates Clb-Cdc28 activity during meiosis. Perhaps Spo12p acts with Sic1p during mitosis, but during meiosis its relevant partner is an as yet unidentified meiotic CKI. Another possibility is that Spo12p alters Clb-Cdc28 kinase activity phosphorylation. We cannot exclude the possibility that Spo12p regulates meiotic divisions via a completely distinct mechanism. For example, perhaps Spo12p (and Spo13p) are required to ensure cosegregation of sister chromatids during meiosis I.
In summary, SPO12 is crucial for the proper regulation of the meiotic nuclear divisions and possibly exit from mitosis as well. The observations described here should provide information that will ultimately contribute to the understanding of the function of Spo12 protein.
| |
ACKNOWLEDGMENTS |
|---|
We thank Sue Jaspersen, Roger Brent, Rochelle Esposito, Bruce Futcher, Leland Johnston, Wolfgang Seufert, Dave Stuart, and Mike Tyers for reagents and Sue Jaspersen, Julia Charles, and members of the Herskowitz laboratory for valuable discussions. This work was supported by grants from the National Institutes of Health to I.H. and a Damon Runyon-Walter Winchell postdoctoral fellowship to M.E.G.
| |
FOOTNOTES |
|---|
* Present adress: Incyte Pharmaceuticals, 3160 Porter Drive, Palo Alto, CA 94304.
Corresponding author. E-mail address:
ira{at}cgl.ucsf.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. L. Auld, A. L. Hitchcock, H. K. Doherty, S. Frietze, L. S. Huang, and P. A. Silver The Conserved ATPase Get3/Arr4 Modulates the Activity of Membrane-Associated Proteins in Saccharomyces cerevisiae Genetics, September 1, 2006; 174(1): 215 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Huang, H. K. Doherty, and I. Herskowitz The Smk1p MAP kinase negatively regulates Gsc2p, a 1,3-{beta}-glucan synthase, during spore wall morphogenesis in Saccharomyces cerevisiae PNAS, August 30, 2005; 102(35): 12431 - 12436. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Visintin, F. Stegmeier, and A. Amon The Role of the Polo Kinase Cdc5 in Controlling Cdc14 Localization Mol. Biol. Cell, November 1, 2003; 14(11): 4486 - 4498. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Benjamin, C. Zhang, K. M. Shokat, and I. Herskowitz Control of landmark events in meiosis by the CDK Cdc28 and the meiosis-specific kinase Ime2 Genes & Dev., June 15, 2003; 17(12): 1524 - 1539. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Shonn, R. McCarroll, and A. W. Murray Spo13 protects meiotic cohesin at centromeres in meiosis I Genes & Dev., July 1, 2002; 16(13): 1659 - 1671. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Borgne, H. Murakami, J. Ayte, and P. Nurse The G1/S Cyclin Cig2p during Meiosis in Fission Yeast Mol. Biol. Cell, June 1, 2002; 13(6): 2080 - 2090. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. van Hemert, G. E. M. Lamers, D. C. G. Klein, T. H. Oosterkamp, H. Y. Steensma, and G. P. H. van Heusden From the Cover: The Saccharomyces cerevisiae Fin1 protein forms cell cycle-specific filaments between spindle pole bodies PNAS, April 16, 2002; 99(8): 5390 - 5393. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Shah, S. Jensen, L. M. Frenz, A. L. Johnson, and L. H. Johnston The Spo12 Protein of Saccharomyces cerevisiae: A Regulator of Mitotic Exit Whose Cell Cycle-Dependent Degradation Is Mediated by the Anaphase-Promoting Complex Genetics, November 1, 2001; 159(3): 965 - 980. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. Rutkowski and R. E. Esposito Recombination Can Partially Substitute for SPO13 in Regulating Meiosis I in Budding Yeast Genetics, August 1, 2000; 155(4): 1607 - 1621. [Abstract] [Full Text] |
||||
![]() |
S. R. Chaves and G. Blobel Nuclear Import of Spo12p, a Protein Essential for Meiosis J. Biol. Chem., May 18, 2001; 276(21): 17712 - 17717. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. van Hemert, G. E. M. Lamers, D. C. G. Klein, T. H. Oosterkamp, H. Y. Steensma, and G. P. H. van Heusden From the Cover: The Saccharomyces cerevisiae Fin1 protein forms cell cycle-specific filaments between spindle pole bodies PNAS, April 16, 2002; 99(8): 5390 - 5393. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||