![]() |
|
|
Vol. 10, Issue 11, 3909-3926, November 1999

and
*Max-Planck-Institut of Neurobiology and
Department of Molecular Biology, Max-Planck-Institut of
Biochemistry, D-82152 Martinsried, Germany
| |
ABSTRACT |
|---|
|
|
|---|
Alternative pre-mRNA splicing patterns can change an extracellular stimulus, but the signaling pathways leading to these changes are still poorly characterized. Here, we describe a tyrosine-phosphorylated nuclear protein, YT521-B, and show that it interacts with the nuclear transcriptosomal component scaffold attachment factor B, and the 68-kDa Src substrate associated during mitosis, Sam68. Northern blot analysis demonstrated ubiquitous expression, but detailed RNA in situ analysis revealed cell type specificity in the brain. YT521-B protein is localized in the nucleoplasm and concentrated in 5-20 large nuclear dots. Deletion analysis demonstrated that the formation of these dots depends on the presence of the amino-terminal glutamic acid-rich domain and the carboxyl-terminal glutamic acid/arginine-rich region. We show that the latter comprises an important protein-protein interaction domain. The Src family kinase p59fyn-mediated tyrosine phosphorylation of Sam68 negatively regulates its association with YT521-B, and overexpression of p59fyn dissolves nuclear dots containing YT521-B. In vivo splicing assays demonstrated that YT521-B modulates alternative splice site selection in a concentration-dependent manner. Together, our data indicate that YT521-B and Sam68 may be part of a signal transduction pathway that influences splice site selection.
| |
INTRODUCTION |
|---|
|
|
|---|
The members of the signal transduction and activation of RNA
(STAR) or GRP33/SAM68/GLD1 domain-containing protein family are proposed mediators connecting signal transduction pathways and RNA
metabolism (Vernet and Artzt, 1997
). The prototype of these proteins is
Sam68, the 68-kDa Src substrate associated during mitosis (Taylor and
Shalloway, 1994
). Sam68 and its related protein family members contain
an RNA binding domain that has been referred to as the STAR domain
(Vernet and Artzt, 1997
), GSG (GRP33/SAM68/GLD1) (Jones et
al.), or SGQ (SAM68/GLD1/Quaking homology domain) (Lin et
al., 1997
). This domain contains an RNA binding KH domain
module flanked by two Qua1 and Qua2 domains that are required for
high-affinity RNA binding. In addition, Sam68 contains an RGG box that
has been implicated in RNA binding (Kiledjian and Dreyfuss, 1992
), as
well as proline- and tyrosine-rich regions involved in binding to Src homology 3 (SH3) and SH2 domains. Sam68 thus associates with a variety
of signaling molecules, including members of the Src family tyrosine
kinases, growth factor receptor-bound protein 2 (GRB-2), and
phospholipase C
-1 (Richard et al., 1995
). The RNA binding ability (Wang et al., 1995
) and oligomerization of Sam68 are
inhibited by p59fyn (Chen et al.,
1997
), a member of the Src family of kinases. These data suggest that
Sam68 functions as a multifunctional SH3 and SH2 adapter protein with
the ability to link cytosolic signaling pathways to downstream effects
involved in RNA metabolism, such as alternative splicing.
Alternative splicing is an important mechanism for creating different
protein isoforms from a single gene. In many cases, stop codons are
introduced by alternative splicing, which usually changes the carboxyl
terminus of proteins. This can affect the physiological function of a
protein, as shown by several examples: 1) creation of soluble instead
of membrane-bound receptors (Baumbach et al., 1989
; Eipper
et al., 1992
; Toksoz et al., 1992
; Zhang et
al., 1994
; Hughes and Crispe, 1995
; Tabiti et al.,
1996
); 2) altered ligand affinity (Sugimoto et al., 1993
;
Xing et al., 1994
; Suzuki et al., 1995
); 3)
protein truncations producing inactive variants (Swaroop et
al., 1992
; van der Logt et al., 1992
; Duncan et
al., 1995
; Sharma et al., 1995
; Eissa et
al., 1996
); and 4) changes of endocytotic pathways (Wang and Ross,
1995
). In addition, inclusion or skipping of alternative exons can add
or delete protein modules that change the affinity toward ligands
(Danoff et al., 1991
; Giros et al., 1991
;
Guiramand et al., 1995
; Strohmaier et al., 1996
),
modulate enzymatic activity (O'Malley et al., 1995
), create
different hormones (Amara et al., 1982
; Courty et
al., 1995
), and change properties of ion channels (Sommer et
al., 1990
; Kuhse et al., 1991
). Finally, numerous
transcription factors are subject to alternative splicing, which
contributes to control of gene expression (reviewed by Lopez,
1995
).
Alternative splicing pathways are not static, because the use of
alternative exons can change during development (for summary, see Stamm
et al., 1994
), or in response to outside stimuli. For example, insulin administration influences the incorporation of the
alternative exon 11 of the insulin receptor (Sell et al., 1994
) and activates exon
II inclusion in the PKC gene (Chalfant et al., 1998
); serum deprivation alters usage of the
serine/arginine-rich protein 20 (SRp20) exon 4 (Jumaa and Nielsen,
1997
); and neuronal activity changes the alternative splicing pattern
of clathrin light chain B, NMDA receptor 1, and c-fos (Daoud et
al., 1999
). Concanavalin A has been shown to change
splicing patterns of the splicing factor htra2-beta1 (Beil et
al., 1997
), as well as the splicing patterns of the class 1b major
histocompatibility complex molecule Qa-2 (Tabaczewski et
al., 1994
). However, the pathways that transduce the signal to the
splicing machinery have yet to be established, despite numerous
examples that demonstrate a change in alternative splicing in response
to external stimuli.
Our aim was to look for novel components of the spliceosomal complex;
hence we used known splice factors as baits in a yeast two-hybrid
approach (Fields and Song, 1989
). Using the human tra2-beta1 protein,
we identified a nuclear protein, YT521-B, and demonstrate that it can
change alternative splicing patterns in a concentration-dependent manner. Furthermore, we show that YT521-B partially resides in subnuclear compartments, and we identified the protein domains necessary for this localization. Further yeast two-hybrid screens identified Sam68 as a YT521-B interacting protein, and we verified this
interaction in vivo by coimmunoprecipitation experiments and the
subnuclear colocalization of Sam68 and YT521-B. Because the association
and localization of YT521-B and Sam68 were influenced by
p59fyn-induced tyrosine phosphorylation, we
suggest that the activity of Src family kinases could influence
alternative splicing through Sam68 and its interaction with YT521-B.
This is the first report of a nuclear Sam68-associated protein that is involved in RNA splicing, and our findings suggest that Sam68 may influence RNA metabolism not only by means of its RNA binding domain but also through its interaction with other nuclear proteins.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Two-Hybrid Screen and Cloning
Molecular cloning was performed using standard protocols
(Sambrook et al., 1989
), and RT-PCR was performed as
described (Hartmann and Stamm, 1997
). A matchmaker two-hybrid rat brain
postnatal day 5 as well as an embryonic day 16 library (Stratagene, La
Jolla, CA) were screened using htra2-beta pGBT9 (Beil et
al., 1997
) as bait. The yeast Gal4 two-hybrid screen was performed
according to the method of Fields and Song (1989)
using the strain
HF7c. For each screen, ~6 × 106
transformants were screened with 100 µg of bait DNA and 50 µg of
prey DNA. To test interaction of YT521-B with other proteins, 1 µg of
YT521-B fused to the Gal4 activation domain and 1 µg of scaffold
attachment factor B (SAF-B), htra2-beta, heterogeneous nuclear
ribonuclear protein G (hnRNP-G), Sam68, and YT521-B fused to the
Gal4 binding domain were cotransformed and plated onto triple dropout
plates lacking leucine, tryptophane, and histidine. Surviving colonies
were restreaked on triple dropout plates supplemented with 10 mM
3-amino-triazole.
DNA was isolated from the His-autotrophic and lacZ-positive colonies
(Hoffman and Winston, 1987
), electroporated into HB101, and selected on
ampicillin plates. Resistant colonies were restreaked onto M9 plates
without leucine to remove bait plasmids (Hollenberg et al.,
1995
). DNA from the autotrophic bacteria was isolated and sequenced
using an Applied Biosystems (Foster City, CA) sequencer. DNA sequences
were analyzed with the Genetics Computer Group (Madison, WI) Wisconsin
package (Genetics Computer Group, 1994
).
Two cDNA clones, YT521TH-pADgal4 and YT521
N10-pADgal4, were
obtained. Because neither the clone YT521TH-pADgal4 nor
YT521
N10-pADgal4 contained the complete cDNA, rapid amplification of
cDNA ends (RACE) was used to amplify the missing 5' end (Marathon cDNA
amplification kit; Clontech, Cambridge, United Kingdom). Comparison
with the full-length RACE clones showed that YT521TH-pADgal4 lacked the first 253 amino acids, whereas YT521
N10-pADgal4 lacked the first 10 amino acids.
YT521TH-B and YT521
N10 were cloned as an
EcoRI-SacII fragment into pEGFP-C2 (Clontech)
and as an EcoRI-PstI fragment into pGBT9
(Clontech). Restriction sites were introduced by PCR amplification with
the oligonucleotides yt521eco-f1 (ccgaattctatgaacaggatgagagagatc), yt521-sacII-r (ccccgcggacattatcttcgataacgacctctttcc), and yt521pstI-r (tctgcagggtttttctggttgact). Deletion variants were generated either by
PCR (primers available upon request; deletion clones are indicated in
Figure 1) and subcloned into PCR-topo vector (Invitrogen, San Diego,
CA) or by using a unique KpnI site (YT521-B
NLS4, YT521-B TH
NLS4).
RNA Isolation and PCR
RNA from whole-tissue homogenates was isolated according
to the method of Feramisco et al. (1982)
. Briefly, frozen
tissue was homogenized in guadinium thiocyanate/phenol solution at
60°C. RNA was precipitated from the aqueous phase after several
phenol/chloroform extractions. Oligonucleotides for amplification of
insertion A were pht6exr1 (cactcattcctgctggaagc) and pht6exf1
(gagctcgaggcatatcaccca) and for insertion B were phtexbr1
(ccgggtaaggaggcattcct) and phtexbf1 (ggcgtcgaccagaagattat). PCR was
performed with a touchdown program (Don et al., 1991
)
(denaturation, 1 min, 94°C; annealing, 1 min, 65-55°C, lowering
0.5°C in each cycle; extension, 2 min, 72°C; 20 cycles, followed by
10 cycles with annealing at 55°C). After analyzing the products on
2% ethidium bromide-stained agarose gels, they were subcloned into
pCR2.1-vector (Invitrogen) and sequenced.
Northern Blot
YT521TH (Figure 1) cDNA was labeled with
[
32P]dCTP using the random priming method
(Amersham, Arlington Heights, IL). A human multiple-tissue Northern
blot (Clontech) was probed according to the manufacturer's instructions.
In Situ Hybridization
One nanogram of the cloned YT521-B probe was PCR amplified using primers specific for the C terminus of YT521-B, anchored by either the T7 or Sp6 RNA-polymerase recognition sequence. A 12.5-µl PCR mix with 0.2 ng of plasmid was performed for 28 cycles with 94°C denaturing for 10 s, 52°C annealing for 10 s, and 74°C elongation for 20 s. PCR product was purified using QiaQuick (Qiagen, Hilden, Germany). Transcription using either T7 or Sp6 RNA-polymerase was performed according to the manufacturer's protocol (Boehringer Mannheim, Indianapolis, IN), using 250 ng of the respective PCR product as template. Dried cryostate sections were fixed for 20 min in paraformaldehyde in PBS and washed three times for 5 min in PBS. After treatment with protease (10 µg/ml in 50 mM Tris-HCl and 5 mM EDTA, pH 7) for 10 min at 37°C, the fixation (5 min) and subsequent wash steps were repeated. The sections were acetylated (0.25% acetic anhydride and 0.1 M triethanolamine-HCl) for 10 min, rinsed twice in PBS for 5 min, dehydrated through a graded ethanol dilution, and air dried. Sections were incubated with 2 × 106 cpm of the 35S-UTP (Amersham)-labeled probe in 100 µl of hybridization mix (50% formamide, 0.3 M NaCl, 20 mM Tris-HCl, pH 7, 5 mM EDTA, 10 mM phosphate buffer, 10% dextran sulfate, 1× Denhardt's solution, 0.2% Nonidet-P40, 50 µg/ml tRNA, and 200 µg/ml single-strand salmon sperm DNA) overnight at 57°C. After hybridization, sections were washed in 5× SSC with 10 mM DTT at 55°C for 2 min, followed by a stringent wash in 2× SSC with 10 mM DTT at 65°C for 30 min. For RNase treatment, sections were first rinsed in RNase buffer (0.5 M NaCl, 10 mM Tris-HCl, and 1 mM EDTA, pH 7) for 5 min at room temperature, incubated with 1 µg/ml RNase in RNase buffer for 30 min at 37°C, and washed again in RNase buffer for 5 min at 37°C. After two additional washes in 2× and 0.1× SSC for 10 min each at room temperature, sections were dehydrated through graded ethanol solutions containing 0.3 M ammonium acetate, air dried, covered with a thin sheet of film emulsion (NBT-2; Eastman Kodak, Rochester, NY), and exposed at 4°C for 5-7 d. They were developed in Kodak D19 developer and fixed in 24% sodium thiosulfate. Sections were counterstained with Hemalaune, dehydrated, and mounted in DePeX (Gurr; BDH, Poole, United Kingdom).
Immunofluorescence
Immunofluorescence was performed using amino-terminal enhanced green fluorescent protein (EGFP) or Flag-tagged YT521-B cDNA constructs. Two micrograms of the constructs were transfected overnight in 100,000 baby hamster kidney (BHK) cells using Superfect (Qiagen) according to the manufacturer's protocol. Counterstaining was performed using (4-(4-(dihexadecylamino)styryl)-N-methylquinolinium iodide (Molecular Probes, Eugene, OR) for 2 h in fresh medium. Cells were fixed in 4% paraformaldehyde for 20 min, washed twice with 1× PBS for 10 min, and analyzed with laser confocal fluorescence microscopy. For the Flag construct, a polyclonal rabbit anti-Flag (Santa Cruz Biotechnology, Santa Cruz, CA) antibody was diluted 1:250 in 1× PBS and 3%BSA and incubated overnight at 4°C. The secondary antibody (Cy3-conjugated rabbit anti-goat immunoglobulin G; Sigma, St. Louis, MO) was incubated at room temperature for 4 h.
Cell Culture and Immunoprecipitation
The day before transfection, 3.0 × 105 HEK293 cells per 3.5-cm plate were seeded in
3 ml of DMEM and 10% FCS and incubated at 37°C in 5%
CO2 for 17-24 h. Transient transfections of
adherent HEK293 cells with 1 µg of total cDNA (EGFP-YT521-B,
pRK5-p59fyn,
pRK5-p59fynK299A, and
pRK5-p59fynY531F) constructs were performed using
the calcium phosphate method (Chen and Okayama, 1987
). Cells were lysed
in 200 µl of radioimmunoprecipitation assay (RIPA) buffer (1% NP40,
1% sodium deoxycholate, 0.1% SDS, 150 mM NaCl, 10 mM Na-phosphate, pH
7.2, 2 mM EDTA, 50 mM NaF, 5 mM
-glycerolphosphate, and freshly
added 4 mM sodium orthovanadate, 1 mM DTT, 1 mM PMSF, 20 µg/ml
aprotinin, and 100 U/ml benzonase) for 30 min on ice. Precipitates were
cleared by centrifugation. Fifty microliters of this total cellular
lysate were transferred into a 1.5-ml tube, mixed with an equal amount
of 1× Laemmli buffer, boiled, and stored at
20°C overnight. One
hundred fifty microliters of the lysate were diluted fourfold in RIPA
rescue (10 mM Na-phosphate, pH 7.2, 1 mM NaF, 5 mM
-glycerolphosphate, 20 mM NaCl, and freshly added 2 mM sodium
orthovanadate, 1 mM DTT, 1 mM PMSF, and 20 µg/ml aprotinin).
Immunoprecipitations were performed overnight at 4°C with agitation
using anti-GFP antibody (Boehringer Mannheim) and protein A-Sepharose
(Pharmacia, Piscataway, NJ; protein A-Sepharose:Sepharose, 1:1,
resuspended in RIPA rescue buffer), followed by three washes in 50 mM
HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 0.1% Triton
X-100, and freshly added 2 mM sodium orthovanadate, 100 mM NaF, 1 mM
PMSF, and 20 µg/ml aprotinin (Nayler et al., 1997
). The
proteins were subsequently analyzed on SDS-PAGE followed by Western
blotting and ECL (New England Nuclear, Boston, MA) using anti-tra2
(Daoud et al., 1999
), anti-SF2 (Ak96; Oncogene Science,
Uniondale, NY), anti-mAb 104 (American Type Culture Collection, Manassas, VA), anti-p62 (Santa Cruz), anti-GFP (mono-clonal,
Boehringer Mannheim; polyclonal, Clontech), and antiphosphotyrosine
4G10 (Santa Cruz) antibodies.
In Vivo Splicing Assays
In vivo splicing was performed essentially as described by
Cáceres et al. (1994)
. Briefly, 2 µg of the reporter
gene were transfected together with an increasing amount (0, 0.5, 1, 1.5, and 2 µg) of YT521-B-constructs in 300,000 HEK293 cells using the calcium phosphate method (see above). Empty vector (pEGFP-C2; Clontech) was added to ensure that equal amounts of DNA were
transfected. Transfection was performed at 37°C in 3%
CO2 overnight. RNA was isolated 17-24 h after
transfection using an RNeasy mini kit (Qiagen), following the
manufacturer's instructions. RNA was eluted in 40 µl of RNase-free
H2O. For reverse transcription, 2 µl of
isolated RNA were mixed with 5 pmol of antisense minigene-specific
primer in 0.5 µl H2O, 2 µl of 5× RT buffer,
1 µl of 100 mM DTT, 1 µl of 10 mM dNTP, 3 µl of
H2O, 0.25 µl of RNase inhibitor, and 0.25 µl
of H
reverse transcriptase. The tubes were
incubated for 45 min in a 42°C water bath.
Two microliters of the RT reaction were mixed with 2.5 pmol of sense and antisense primer each, 10× PCR reaction buffer, 200 µM dNTP, 2 mM MgCl2, and 0.1 µl Taq-polymerase. For the SRp20 minigene, the PCR conditions were initial denaturation for 2 min at 94°C; 30 cycles: 30 s denaturation at 94°C, annealing at 55°C for 1 min, extension at 72°C for 1 min, after 30 cycles a final extension at 72°C for 20 min, and cooling to 4°C in a Biometra (Göttingen, Germany) trio block thermocycler.
For the tra2-minigene, the conditions were 20 s denaturation at 94°C, 20 s annealing at 65°C, 40 s extension at 72°C for 33 cycles, followed by a final extension at 72°C for 20 min, and cooling to 4°C in a Perkin-Elmer (Norwalk, CT) thermocycler.The PCR reaction products were analyzed on a 0.3- to 0.4-cm-thick 2% agarose Tris borate-EDTA gel.
| |
RESULTS |
|---|
|
|
|---|
Cloning of YT521-B
To identify novel components of the spliceosomal complex
(Corden and Patturajan, 1997
), we have been performing yeast two-hybrid screens using known splicing factors as baits. Recently, we isolated a
human homologue of the Drosphila transformer-2 splicing
factor (Dauwalder et al., 1996
), htra2-beta1 (Beil et
al., 1997
; Nayler et al., 1998a
). We then
performed yeast two-hybrid screens using htra2-beta1 as bait and
isolated two overlapping cDNAs from a postnatal day 5 rat brain
library. A similar cDNA, YT521, was recently isolated by Imai et
al. (1998)
using rat transformer-2-beta1 (RA301) as a bait. Both
our cDNAs still lacked the start codon, and the complete 5' end of the
gene was isolated using the RACE method. Comparison with the
full-length sequence revealed that one clone lacked the first 253 amino
acids (YT521TH; Figure 1), and the other
(YT521
N10) lacked the first 10 amino acids. Our isolates differ from
the previously published YT521 clone and several mouse expressed
sequence tags (Lennon et al., 1996
) (AA646154 and AA183061)
by the presence and absence of two sequence elements that we termed
insertion A and insertion B, respectively (Figure 1). We therefore
named our cDNA clone YT521-B. Both insertions are probably generated by
alternative splicing. Database searches detected the presence of four
putative nuclear localization signals, and sequence inspection revealed
an amino-terminal glutamic acid-rich region and a carboxyl-terminal
proline-rich stretch. In addition, the carboxyl-terminal domain
contains a region that is rich in arginine and glutamic acid residues.
The overall domain structure of YT521-B is illustrated in Figure 1. The
charges of the protein display a bipolar distribution. The region
encompassing the start codon to the end of the glutamic acid-rich
region is acidic (pI = 4.5), whereas the remaining protein is
basic (pI = 9). Overall, the protein is acidic, with an
isoelectric point of 5.6.
|
Alternative Variants
Because the sequence of our full-length YT521-B clone differs from
the previously published clones by two insertions (Figures 1 and Figure
2, A and B), we asked whether the
expression of these isoforms is tissue specific. Using RNA derived from
different rat tissues, we performed RT-PCR with primers flanking either insertion A or insertion B (Figure 2, C and D). We found that RNA
lacking insertion A is predominantly expressed in brain. Interestingly, the exclusion of insertion A is developmentally regulated in the brain
and increases as development proceeds. In contrast, cDNAs containing or
lacking insertion B are equally distributed in various tissues and are
not developmentally regulated. We conclude that the YT521 gene
generates several different isoforms using alternatively spliced exons,
one of which seems to be developmentally regulated.
|
Expression in Various Tissues
To analyze the expression of YT521-B RNA quantitatively, we
performed Northern Blot analysis using poly(A+)
mRNA. As shown in Figure 3A, we detected
a band of ~4.0 kb in all tissues examined. In addition, a smaller
form of 3 kb can be seen in testis, and a larger variant of 7.5 kb is
seen in spleen, lung, and kidney. This larger transcript is also seen
in all other tissues upon longer exposure (our unpublished results). We
suspect that the minor transcripts of 3 and 7.5 kb are derived by
alternative splicing or by the use of different transcriptional start
or termination sites, respectively. These experiments indicate that
YT521 RNA is ubiquitously expressed.
|
However, because Northern blot analysis is limited to whole-tissue
homogenates, and YT521 was shown to be regulated by ischemia in the
brain (Imai et al., 1998
), we sought to obtain a more
detailed picture of YT521-B expression within the brain. We therefore
performed RNA in situ hybridization on serial rat brain sections. As
shown in Figure 4, YT-521-B could be
detected in all brain regions (Figure 4, A and B), but at higher
magnification, a cell type-specific expression was observed (Figure 4,
C and D). Silver grains accumulated preferentially over large cells,
e.g., in the CA3 region (Figure 4, C and D, large arrows) that, given
their morphology and location, are most likely neurons. In contrast, no
specific hybridization signal was detected over cells with small, dark
blue-stained nuclei, which are most likely epithelial cells (Figure 4,
C and D, small arrows). In summary, we conclude that YT521-B is widely
expressed and shows a cell type-specific expression in the brain.
|
Intracellular Localization and Domain Structure
To characterize the YT521-B protein further, we investigated
its intracellular localization using transiently expressed EGFP-YT521-B fusion proteins in BHK cells. Cells were analyzed by confocal microscopy. The full-length YT521-B protein is exclusively nuclear and
is characteristically concentrated in 5-20 evenly distributed dots. In addition, the YT521-B protein is diffusely located throughout the nucleoplasm, excluding the nucleoli (Figure
5A). Sequence inspection revealed four
nuclear localization signals located throughout the molecule and four
other major motifs within the protein: the N-terminal glutamic
acid-rich region, the glutamic acid/arginine-rich region, and a
proline-rich region, both located at the C terminus of the protein. To
investigate these domains in the context of YT521-B localization, we
analyzed several deletion variants that are schematically shown in
Figure 1.
|
First, we deleted the glutamic acid-rich region (amino acids 197-253)
and found that the resulting protein YT521
E was still nuclear,
although the number of intensely stained dots was reduced and the dots
became smaller (Figure 5B). Often, the cells contained nuclear
structures that looked like dissolving dots (Figure 5B, arrows). Next,
we deleted the glutamic acid/arginine-rich region together with the
nuclear localization signal 4 (NLS4; amino acids 631-730). The
resulting construct, YT521
NLS4, is again exclusively expressed in
the nucleus. Again, we observed a decrease in the number of dots, and,
as seen with the YT521
E variant, many cells contained nuclear
structures resembling dissolved dots (Figure 5C, arrows). A deletion
construct including NLS4 (deletion of amino acids 688-730) was
indistinguishable from the YT521
NLS4 construct (our unpublished results).
To address the function of the proline-rich region, we removed amino
acids 601-631. The resulting protein, YT521
Pro, was no longer
detected in nuclear dots. The staining was now uniform, and the protein
was also detected in nucleoli (Figure 5D).
To investigate the role of the nuclear localization signals, four
more constructs were used. First, we deleted the two most carboxyl-terminal nuclear localization signals, NLS3 and NLS4 (amino
acids 535-601), and found that the resulting protein, YT521
NLS3, is
uniformly distributed in the nucleus and is also present in the cytosol
(Figure 5E). This indicates that NLS1 and 2 alone are not sufficient
for exclusive nuclear localization. We then deleted the first 253 amino
acids of the protein, removing NLS1 and the glutamic acid-rich stretch.
The protein made by this clone, YT521TH, is exclusively in the nucleus
(Figure 5F), and the nuclear staining contains structures resembling
the dissolving dots observed with the YT521
E variant.
We then combined amino- and carboxyl-terminal deletion variants and
removed amino acids 631-730 of YT521TH. The resulting protein,
YT521TH
NLS4, lacks the amino-terminal part including NLS1, the
glutamic acid/arginine-rich region, and the fourth nuclear localization
signal and yields a nuclear staining pattern (Figure 5G) resembling
that of YT521TH. Finally, we tested the carboxyl-terminal domain alone
(amino acids 568-730) containing the proline-rich region, NLS4, and
the glutamic acid/arginine-rich domain and found that this protein,
YT521
N568, is exclusively nuclear, excluding the nucleoli (Figure
5H).
In summary, our deletion analysis demonstrates that the intracellular localization of YT521-B is governed by several domains. The exclusive nuclear localization is due to the NLS3 and NLS4, whereas the subnuclear localization is dependent on several domains, notably the glutamic acid-rich and glutamic acid/arginine-rich regions, which act in concert to localize the protein into 5-20 dots, and the proline-rich region, which appears to be involved in the nucleolar exclusion of the protein.
To exclude the possibility of an EGFP-mediated effect on the cellular localization, we tested the intracellular localization of a Flag-tagged YT521-B construct and analyzed transfected cells by immunofluorescence. Again, nuclear dots were observed, indicating that their formation is independent of either EGFP or a Flag tag (Figure 5I). However, the dots observed with the Flag-tagged construct are slightly smaller than the ones seen with an EGFP-tagged protein, which is most likely a result of the stronger signal to background ratio of GFP detection.
Interaction with Other Proteins in Yeast
To obtain information on the possible function of the YT521-B
protein, we determined its binding properties to other nuclear proteins
in the yeast two-hybrid system. YT521 and YT521-B were originally
isolated owing to their interaction with htra2-beta1, an RS
domain-containing spliceosomal protein. To find other
YT521-B-interacting proteins, we used YT521-B as a bait in yeast
two-hybrid screens and tested a postnatal day 5 and an embryonic day 16 brain library. To our surprise, 70 of 110 interacting clones contained
the rat homologue of the Sam68 (Richard et al., 1995
) or
brain-specific cDNAs highly similar to Sam68 (Stoss, Hartmann, and
Stamm, unpublished results). All these interactors are members
of the STAR protein family (Vernet and Artzt, 1997
). Additional clones
included SAF-B (Nayler et al., 1998c
),
transformer2-
(Dauwalder et al., 1996
), and hnRNP-G
(Soulard et al., 1993
). Based on these initial yeast two-hybrid experiments, we concluded that YT521-B might interact with
various components of the spliceosomal complex as well as with members
of the STAR protein family.
To define the interaction domains of YT521-B, we used the yeast
two-hybrid system and compared the interactions of the full-length YT521-B protein, the deletion mutant YT521TH, which lacks the acidic
amino terminus, and YT521TH
NLS3, which lacks the acidic amino
terminus, as well as the glutamic acid/arginine-rich and proline-rich
domains, with the newly identified interacting proteins (Figure
6). We found that deletion of the
amino-terminal domain had no effect on the protein-protein
interactions with YT521-B, Sam68, and rSAF-B but reduced the
interaction with htra2-beta1 and hnRNP-G. In contrast, removing the
glutamic acid/arginine-rich domain abolished binding to htra2-beta1,
hnRNP-G, Sam68, and rSAF-B, indicating that it is necessary for these
observed protein-protein interactions in yeast.
|
Coimmunoprecipitation of Proteins with YT521-B
We next investigated the observed protein-protein interactions in
a mammalian cell system using coimmunoprecipitation experiments. To
this end, EGFP-YT521-B constructs were transiently expressed in HEK293
cells, and protein complexes were precipitated with an anti-EGFP
antibody. Because the proteins of interest displayed nucleic acid
binding activity, we included benzonase in our lysis buffer to avoid
nonspecific or indirect interactions. The precipitates were analyzed by
Western blotting using antibodies against endogenous proteins. When we
used antibodies against Sam68 (Richard et al., 1995
) or
SAF-B (Nayler et al., 1998c
), we were able to
demonstrate that these proteins specifically coprecipitate with
EGFP-YT521-B under our experimental conditions (Figure
7, A and B). Moreover, deletion of the
glutamic acid/arginine-rich domain of YT521-B, as seen with the
construct YT521
NLS4 (Figure 1C), dramatically reduced the binding to
Sam68 (Figure 7A) and to SAF-B (Figure 7B), which is in accordance with
our initial findings in yeast (Figure 6). In contrast, deletion of the
glutamic acid-rich region alone (YT521
E; Figure 1B) had no visible
effect (Figure 7, A and B).
|
Using the pan SR protein antibody mAB104 (Figure 7C) (Fu, 1995
) and
specific antibodies against SF2/ASF (AK96; our unpublished results) and
htra2-beta1 (Figure 7D) (Nayler et al., 1998a
), we were unable to detect coimmunoprecipitation with YT521-B under these
conditions (Figure 7, C and D). This contradicts our initial finding in
yeast (Figure 6), and the previously found association of recombinant
SC35, SF2/ASF and rtra2-beta1 with YT521 in far-Western blot analysis
(Imai et al., 1998c
). However, using the same experimental conditions, we previously demonstrated an in vivo association between
SAF-B and RS domain-containing proteins (Nayler et al., 1998)
. Furthermore, no interaction between RS domain-containing proteins and YT521-B was detected when magnesium was added to the
buffer or when a Triton X-100-based lysis buffer was used (Nayler
et al., 1997
) (our unpublished results). In addition, EGFP-YT521-B did not coimmunoprecipitate with Flag-tagged YT521-B (our
unpublished results), indicating that a YT521-B multimerization might
not take place under in vivo conditions.
The Association of YT521-B and Sam68 Is Negatively Regulated by Tyrosine Phosphorylation
Because YT521-B interacted with Sam68 in the yeast two-hybrid
system and in coimmunoprecipitation experiments, we asked whether the
phosphorylation status of Sam68 influenced its binding to YT521-B. To
address this question, we immunoprecipitated overexpressed EGFP-YT521-B
and analyzed the tyrosine phosphorylation status of the endogenous
coimmunoprecipitating Sam68 using anti-phosphotyrosine-specific antibodies. However, we were unable to detect any tyrosine
phosphorylation of Sam68 in these experiments (our unpublished
results). We then suspected that the endogenous levels of
tyrosine-phosphorylated Sam68 were too low, and, accordingly, we
increased the phosphorylation levels of Sam68 by cotransfecting the Src
family kinase p59fyn or the constitutively active
mutant p59fynYF. As a control, the catalytically
inactive p59fynKA construct was used. As can be
seen in Figure 8A, left panel, p59fyn and p59fynYF caused
tyrosine phosphorylation of Sam68, which is in agreement with earlier
findings (Chen et al., 1997
; Di Fruscio et al.,
1999
). In contrast, the catalytic inactive variant
p59fynKA had no effect.
|
Even under those conditions, no detectable levels of tyrosine-phosphorylated Sam68 were observed when overexpressed EGFP-YT521-B was immunoprecipitated (Figure 8B, left panel), although the reblot clearly showed that Sam68 bound to YT521-B (Figure 8B, middle panel). Interestingly, p59fyn and p59fynYF induced tyrosine phosphorylation of EGFP-YT521-B (Figure 8B, left panel), suggesting that YT521-B itself is a tyrosine-phosphorylated protein and a possible substrate of p59fyn or an activated downstream kinase. Together, these data suggest that the heteromerization of YT521-B and Sam68 is inhibited by tyrosine phosphorylation through p59fyn.
Colocalization of YT512-B and Sam68
To test whether the observed binding of YT521-B to Sam68 and SAF-B
can take place in vivo, we performed double staining of EGFP-YT521-B-transfected cells with these nuclear proteins (Figure 9). As seen in Figure 9A, Sam68
colocalized with YT521-B. Both proteins are concentrated in nuclear
dots and are also present at lower concentrations in the nucleoplasm.
Furthermore, because the association of Sam68 and YT521-B is negatively
regulated by p59fyn (see above), we asked whether
overexpression of p59fyn also affects the
intracellular localization of these proteins. We observed (Figure 9B)
that p59fyn completely abolished the nuclear dots
formed by YT521-B and Sam68, suggesting that the association between
YT521-B and Sam68 is truly influenced by p59fyn
activity in vivo. To rule out a disintegration of Sam68 and YT521-B nuclear dots through protein sequestration, we performed the same experiment with the catalytic inactive mutant
p59fynKA and found no influence of this protein
on the nuclear dots (Figure 9C).
|
We then investigated the relationship of YT521-B nuclear dots and
SAF-B, which is localized in the nucleoplasm and concentrated in
nuclear speckles (Nayler et al., 1998c
). As shown in
Figure 9D, YT521-B dots have frequently contact with SAF-B-containing speckles at their periphery (Figure 9D, arrows), indicating a partial
colocalization of YT521-B and SAF-B. However, the majority of the
SAF-B-containing speckles do not overlap with YT521-B nuclear dots.
YT512-B Can Change Splice Site Selection in a Concentration-dependent Manner
The nucleoplasmatic localization of YT521-B and its
interaction with SAF-B suggest a role for YT521-B in a transcriptosomal complex (Corden and Patturajan, 1997
; McCracken et
al., 1997
; Nayler et
al., 1998c
). The cellular concentration of YT512 in cells
seems to be regulated by several mechanisms. First, we observed that
YT521-B is not expressed in every cell (Figure 4). Second, overexpression of p59fyn leads to a
disintegration of YT512 nuclear dots and a subsequent increase of
YT521-B concentration in the nucleoplasm, indicating a possible
regulation of local protein concentration through kinases (Figure 9B).
We therefore asked whether YT521-B could modulate splice site selection
in vivo in a concentration-dependent manner, analogous to several
proteins involved in splicing, such as SR proteins (Cáceres
et al., 1994
; Wang and Manley, 1995
), hnRNPs (Cáceres et al., 1994
), and also SAF-B (Nayler et al.,
1998c
). To investigate this possiblity, we used an SRp20
reporter gene, consisting of the constitutive exons 3 and 5, as well as
the alternative exon 4 (Jumaa and Nielsen, 1997
). This reporter was
transfected with increasing amounts of EGFP-YT521-B in HEK293 cells.
Vector DNA (pEGFP) was added to ensure that comparable amounts of DNA
were transfected in each experiment. Increasing the amount of
transfected EGFP-YT521-B construct led to a decreased incorporation of
exon 4, as shown in Figure 10A, left,
suggesting a protein concentration-dependent modulation of splice site
selection by YT521-B. Our binding studies (Figures 6 and 7) indicated
that the glutamic acid/arginine-rich domain located at the
carboxyl-terminal domain of YT521-B is necessary for binding to SAF-B,
a factor we had previously shown to be involved in splice site
selection (Nayler et al., 1998c
). We therefore repeated the experiment using YT521
NLS4 (Figure 1C), a deletion mutant lacking the glutamic acid/arginine-rich region. This protein no
longer binds to Sam68 or SAF-B (Figure 7). As shown in Figure 10A,
right, this deletion variant had no effect on SRp20 splice site
selection. A similar result was obtained with a minigene containing the
first four exons of htra2-beta (Nayler et al., 1998c
). An increasing amount of EGFP-YT521-B blocked the
formation of the beta4 isoform, containing all four exons, in favor of
the formation of the beta1 isoform, consisting of exons one, three, and
four (Figure 10B, left). Again, no effect was observed when the
YT521
NLS4 variant was used (Figure 10B, right).
|
These results indicate that the relative concentration of YT521-B can influence specific alternative splicing decisions, possibly through the binding to transcriptosomal components, such as SAF-B via the glutamic acid/arginine-rich domain.
| |
DISCUSSION |
|---|
|
|
|---|
Expression and Sequence Analysis
In this report, we describe the molecular cloning and analysis of the nuclear protein YT521-B. Northern blot analysis indicated that YT521-B is expressed ubiquitously, and, upon closer examination using RNA in situ techniques on serial rat brain slices, we detected that not all cells express YT521-B. From these experiments, we conclude that YT521-B expression in the brain is restricted to certain cell types. Furthermore, at least two regions of the protein are subject to alternative splicing, and one of these regions is subject to developmental control. It remains to be analyzed whether YT521-B isoforms are also controlled in a cell type-specific manner. Sequence inspection shows that YT521-B contains several domains, namely four NLS sequences, a proline- and glutamic acid-rich domain, as well as a glutamic acid/arginine-rich domain.
We tested several deletion clones to analyze the contribution of
various domains to the intracellular localization. YT521-B is
concentrated in 5-20 nuclear dots and is also present throughout the
nucleoplasm, excluding the nucleoli. Removing the proline-rich region
(amino acids 601-631) in the deletion clone YT521
Pro (Figure 5D)
resulted in staining of the nucleoli. In addition, a short construct
containing amino acids 568-643, which include the proline-rich stretch, was absent from the nucleoli (our unpublished results). Taken
together, these data indicate that the proline-rich region is necessary
to exclude YT521-B from the nucleoli.
The exclusive nuclear localization of YT521-B is due to the presence of
several nuclear localization signals. We tested them independently and
found that NLS1 and NLS2 alone are insufficient for nuclear
localization (YT521
NLS3; Figure 5E), whereas the presence of NLS4 or
NLS3 results in nuclear staining (YT521
N568; Figure 5H). This
indicates that the nuclear localization is mainly achieved by sequence
elements in the carboxyl-terminal part of the protein.
The most striking feature of the observed YT521-B localization is the accumulation of the protein in 5-20 nuclear dots. These dots have sharp borders (Figure 5A) and are dependent on the glutamic acid-rich region (Figure 5B) and the glutamic acid/arginine-rich region (Figure 5C). Both domains appear to act in concert, because deletion of either domain results in fuzzy borders and dissolving dots. We observed these dots in several cell lines (HeLa, HEK293, COS, and BHK; Figure 5; our unpublished results) using variable amounts of transfected DNA and various incubation times after transfection (our unpublished results). In addition, a Flag-tagged construct (Figure 5I) displayed a staining pattern similar to that of EGFP-tagged constructs. We therefore suggest that the observed nuclear dots might represent a genuine nuclear compartment and not a nonspecific assembly of protein aggregates.
Glutamic Acid/Arginine-rich Domain
The most prominent motif of the YT521-B protein is the glutamic
acid/arginine-rich region located at its carboxylterminal end.
This domain seems to be important for YT521-B function, because its
deletion abolished any detectable binding to the other identified interacting proteins (Figures 6 and 7). In addition, we found that it
contributes to the subnuclear localization of YT521-B and that it is
involved in the YT521-B induced changes of the SRp20 and tra2-beta
reporter gene splicing pattern (Figures 5C and 10). Database searches
showed that several other proteins contain a domain with alternating ER
or DR repeats (Figure 11). Some of them, such as the RD gene (Surowy et al., 1990
), U170K
(Spritz et al., 1990
), SAF-B (Nayler et al.,
1998c
), the Drosophila shuttle craft protein
(Stroumbakis et al., 1996
), Caenorhabditis
elegans SRp20 (Wilson et al., 1994
), tobacco
U2 auxiliary factor (Domon et al., 1998
), and several RNA
helicases (Sukegawa and Blobel, 1995
; Ohno and Shimura, 1996
), are
involved in pre-mRNA splicing or in the formation of the
transcriptosomal complex. The alternation of negative and positive
charges of the amino acid residues is reminiscent of phosphorylated RS
domains. In contrast to SR proteins, in which the RS domain is usually
located at the carboxyl-terminal end of the proteins, the position of
glutamic acid/arginine-rich regions is variable (Figure 11A). Moreover,
RS domains are subject to phosphorylation, thus influencing the
subnuclear localization of those proteins (Colwill et al.,
1996
; Misteli et al., 1997
). It is not clear whether the
charge distribution of glutamic acid/arginine-rich domains is altered
as well. Nevertheless, we suggest that the glutamic acid/arginine-rich
region might fulfill an important role in protein-protein interaction.
|
Comparison with Other Subnuclear Structures
The striking nuclear staining pattern observed with YT521-B
resembled the nuclear dots observed with wild-type ataxin-1 and, more
strongly, mutant ataxin-1 (Skinner et al., 1997
). However, colocalization studies revealed that the dots formed by YT521-B and
ataxin-1 are similar in size, shape, and number but do not overlap (our
unpublished results). It is interesting to note that the formation of
YT521-B dots is at least in part dependent on the presence of a
polyglutamic acid region within the molecule. This region does not
appear to be created by a recent trinucleotide (GAA) expansion, because
the third codon position is variable. Therefore, the formation of
nuclear dot structures is not just confined to proteins such as
ataxin-1 (Skinner et al., 1997
) or mutant huntingtin (Roizin
et al., 1979
) but is in fact a rather normal structure in
nuclei. It remains to be seen whether other glutamic acid-rich
region-containing proteins might give a similar intranuclear distribution.
Sam68 Binds to YT521-B
Based on the amount of positive clones obtained in our yeast
two-hybrid screens that are supported by our immunoprecipitation and
immunolocalization results (Figures 7 and 9), we suggest that Sam68 is
an interactor of YT521-B. Sam68 is a member of the STAR family of
proteins (Vernet and Artzt, 1997
). Sam68 is phosphorylated by
p59fyn (Chen et al., 1997
) and by Src
during mitosis (Taylor et al., 1995
). Self-association of
Sam68, as well as association with other KH domain-containing
proteins such as GRP33, GLD-1, and Qk1, are inhibited by tyrosine
phosphorylation (Chen et al., 1997
). To study the influence
of phosphorylation on the association of Sam68 and YT521-B, we
overexpressed p59fyn and its mutant forms,
p59fynKA and p59fynYF,
together with YT521-B. In these experiments (Figure 8) we found that no
detectable tyrosine-phosphorylated Sam68 was bound to YT521-B. However,
non-tyrosine-phosphorylated Sam68 did bind to YT521-B. Again, it
should be pointed out that all immunoprecipitations were performed in
the presence of endonuclease (benzonase) to avoid nucleic acid-mediated
coimmunprecipitation. Furthermore, and to our surprise, YT521-B itself
was tyrosine phosphorylated upon p59fyn
overexpression, although it is not clear whether YT521-B is a p59fyn substrate or a substrate of a
p59fyn-activated downstream kinase (Figure 8).
However, phosphorylation of YT521-B itself did not seem visibly to
affect the binding to unphosphorylated Sam68. Together, these data show
that p59fyn or a p59fyn
activated downstream kinase phosphorylate YT521-B, and that tyrosine phosphorylation of Sam68 by p59fyn negatively
regulates its association with YT521-B.
The Nuclear Localization of YT521-B Changes upon p59 fyn Overexpression
Immunoflourescence experiments showed a colocalization of YT521-B
and Sam68 in nuclear dots (Figure 9A). When investigated in the absence
of YT521-B, Sam68 shows a variable nuclear staining pattern that is
diffuse nucleoplasmatic in most cells but becomes punctuate upon
treatment with transcription inhibitors (McBride et al.,
1998
; our unpublished results). These Sam68 nuclear structures are
smaller than the ones observed upon YT521-B coexpression. Therefore,
the localization of Sam68 in the larger YT521-B dots could be a result
of the transient expression of YT521-B and a subsequent stabilization
of the interaction between the two proteins. This further supports an
in vivo interaction between YT521-B and Sam68 and underlines the
dynamic behavior of Sam68. Our biochemical analysis (Figure 8)
indicated that Sam68 and YT521-B interacted in a tyrosine
phosphorylation-dependent manner. Therefore, we determined the
influence of p59fyn overexpression on the
subnuclear structure of Sam68 and YT521-B. As shown in Figure 9, B and
C, p59fyn, but not its catalytically inactive
mutant p59fynKA, dissolved the nuclear dots
formed by Sam68 and YT521-B. p59fyn-induced
phosphorylation seems to specifically affect YT521-B, because no change
of ataxin-1 and SAF-B localization was observed (our unpublished
results), arguing against a general effect on nuclear architecture. The
regulation of the shape and size of Sam68- and YT521-B-containing dots
is reminiscent to the control of SR protein-containing speckles by
CDC2-like SR protein kinases. Here, overexpression of CDC2-like SR
protein kinases dissolves nuclear speckles, the proposed storage
compartments of splicing components (Colwill et al., 1996
;
Nayler et al., 1997
, 1998b
). It is currently debated
whether a release of splicing components from speckles through
phosphorylation might be a mechanism to regulate splice site selection
(Misteli et al., 1997
). Similar to nuclear speckles, the
YT521-B dots might serve to concentrate the YT521-B protein to be
released upon a phosphorylation signal. As a result, the local nuclear
concentration of YT521-B could be regulated by well-characterized
signal transduction pathways.
YT521-B Is Involved in Splice Site Selection
The cellular concentration of YT521-B is regulated by its cell
type-specific expression and possibly by a phosphorylation-dependent change in local concentation in the nucleoplasm. The cell type specificity is reminiscent of htra2-beta1 (Daoud et al.,
1999
) and several hnRNPs (Kamma et al., 1995
), which were
shown to exhibit cell type-specific expression patterns when studied in
situ. We therefore performed in vivo splicing experiments to study the effects of increased relative amounts of YT521-B on two reporter gene
constructs. In both cases, we observed repression of an alternatively spliced exon when the YT521-B concentration was increased.
We were able to show that YT521-B interacts with the nuclear protein
SAF-B (Figures 6 and 7), which has been shown to bind to SR proteins
and which was implied in the regulation of alternative splicing (Nayler
et al., 1998c
). In addition, SAF-B-containing speckles are frequently located at the periphery of YT521-B nuclear structures, which could suggest a cross-talk between these
compartments. Therefore, YT521-B could change splice site selection
through sequestration of nucleoplasmic molecules such as SAF-B that
directly bind to SR proteins necessary for pre-mRNA splicing. This
model would also explain that a YT521-B variant lacking the glutamic acid-arginine domain, necessary for the protein-protein interaction, had no visible effect on splicing. It is likely that the nuclear concentration of YT521-B, and hence its ability to sequester proteins, is regulated by p59fyn. In summary, our findings
suggest that YT521-B can mediate splice site selection in response to
cellular kinase activity and could be a molecular basis for the
observed dependency of alternative splicing patterns upon outside stimuli.
| |
ACKNOWLEDGMENTS |
|---|
We thank Claudia Cap for sequencing, James Chalcroft for artwork, Peter Nielsen for providing the SRp20 minigenes, H. Orr for providing ataxin-1 clones, and Gregor Eichele for helping to analyze the in situ hybridizations. This work was supported by the Max-Planck Society and the Human Frontier Science Program (grant RG562/96 to S.S.). We are grateful to Axel Ullrich for financial support and reagents (to O.N.). Sequences from this study were deposited in GenBank (accession number AF144731).
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
stamm{at}pop1.biochem.mpg.de.
| |
ABBREVIATIONS |
|---|
Abbreviations used: BHK, baby hamster kidney; EGFP, enhanced green fluorescent protein; hnRNP, heterogeneous nuclear ribonuclear protein; NLS, nuclear localization signal; RACE, rapid amplification of cDNA ends; RIPA, radioimmunoprecipitation assay; SAF-B, scaffold attachment factor B; SH, Src homology region; SR protein, protein with serine/arginine-rich domain; STAR, signal transduction and activation of RNA.
| |
REFERENCES |
|---|
|
|
|---|
tissue-specific regulation and induction by cytokines.
J. Biol. Chem.
271, 27184-27187
2 subunit of the inhibitory glycine receptor.
FEBS Lett.
283, 73-77[Medline].This article has been cited by other articles:
![]() |
M.-E. Huot, G. Vogel, and S. Richard Identification of a Sam68 Ribonucleoprotein Complex Regulated by Epidermal Growth Factor J. Biol. Chem., November 13, 2009; 284(46): 31903 - 31913. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Heinrich, Z. Zhang, O. Raitskin, M. Hiller, N. Benderska, A. M. Hartmann, L. Bracco, D. Elliott, S. Ben-Ari, H. Soreq, et al. Heterogeneous Nuclear Ribonucleoprotein G Regulates Splice Site Selection by Binding to CC(A/C)-rich Regions in Pre-mRNA J. Biol. Chem., May 22, 2009; 284(21): 14303 - 14315. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zhou, A. C. Ou, A. Cho, E. J. Benz Jr., and S.-C. Huang Novel Splicing Factor RBM25 Modulates Bcl-x Pre-mRNA 5' Splice Site Selection Mol. Cell. Biol., October 1, 2008; 28(19): 5924 - 5936. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Stamm Regulation of Alternative Splicing by Reversible Protein Phosphorylation J. Biol. Chem., January 18, 2008; 283(3): 1223 - 1227. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Novoyatleva, B. Heinrich, Y. Tang, N. Benderska, M. E.R. Butchbach, C. L. Lorson, M. A. Lorson, C. Ben-Dov, P. Fehlbaum, L. Bracco, et al. Protein phosphatase 1 binds to the RNA recognition motif of several splicing factors and regulates alternative pre-mRNA processing Hum. Mol. Genet., January 1, 2008; 17(1): 52 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Smida, A. Posevitz-Fejfar, V. Horejsi, B. Schraven, and J. A. Lindquist A novel negative regulatory function of the phosphoprotein associated with glycosphingolipid-enriched microdomains: blocking Ras activation Blood, July 15, 2007; 110(2): 596 - 625. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Sergeant, C. F. Bourgeois, C. Dalgliesh, J. P. Venables, J. Stevenin, and D. J. Elliott Alternative RNA splicing complexes containing the scaffold attachment factor SAFB2 J. Cell Sci., January 15, 2007; 120(2): 309 - 319. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cardelli, F. Marchegiani, L. Cavallone, F. Olivieri, S. Giovagnetti, E. Mugianesi, R. Moresi, R. Lisa, and C. Franceschi A Polymorphism of the YTHDF2 Gene (1p35) Located in an Alu-Rich Genomic Domain Is Associated With Human Longevity J Gerontol A Biol Sci Med Sci, June 1, 2006; 61(6): 547 - 556. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-H. Chen, Y.-C. Wang, and M.-J. Fann Identification and Characterization of the CDK12/Cyclin L1 Complex Involved in Alternative Splicing Regulation Mol. Cell. Biol., April 1, 2006; 26(7): 2736 - 2745. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Delaney, R. Xu, J. Zhang, Q. Q. Li, K.-Y. Yun, D. L. Falcone, and A. G. Hunt Calmodulin Interacts with and Regulates the RNA-Binding Activity of an Arabidopsis Polyadenylation Factor Subunit Plant Physiology, April 1, 2006; 140(4): 1507 - 1521. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Paronetto, F. Zalfa, F. Botti, R. Geremia, C. Bagni, and C. Sette The Nuclear RNA-binding Protein Sam68 Translocates to the Cytoplasm and Associates with the Polysomes in Mouse Spermatocytes Mol. Biol. Cell, January 1, 2006; 17(1): 14 - 24. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Lukong, D. Larocque, A. L. Tyner, and S. Richard Tyrosine Phosphorylation of Sam68 by Breast Tumor Kinase Regulates Intranuclear Localization and Cell Cycle Progression J. Biol. Chem., November 18, 2005; 280(46): 38639 - 38647. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Haegebarth, D. Heap, W. Bie, J. J. Derry, S. Richard, and A. L. Tyner The Nuclear Tyrosine Kinase BRK/Sik Phosphorylates and Inhibits the RNA-binding Activities of the Sam68-like Mammalian Proteins SLM-1 and SLM-2 J. Biol. Chem., December 24, 2004; 279(52): 54398 - 54404. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Rafalska, Z. Zhang, N. Benderska, H. Wolff, A. M. Hartmann, R. Brack-Werner, and S. Stamm The intranuclear localization and function of YT521-B is regulated by tyrosine phosphorylation Hum. Mol. Genet., August 1, 2004; 13(15): 1535 - 1549. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Stoilov, R. Daoud, O. Nayler, and S. Stamm Human tra2-beta1 autoregulates its protein concentration by influencing alternative splicing of its pre-mRNA Hum. Mol. Genet., March 1, 2004; 13(5): 509 - 524. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. B. Fredj, J. Grange, R. Sadoul, S. Richard, Y. Goldberg, and V. Boyer Depolarization-induced translocation of the RNA-binding protein Sam68 to the dendrites of hippocampal neurons J. Cell Sci., March 1, 2004; 117(7): 1079 - 1090. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, I. C. Hawkins, C. D. Harvey, J. L. Jennings, A. J. Link, and J. G. Patton Regulation of Alternative Splicing by SRrp86 and Its Interacting Proteins Mol. Cell. Biol., November 1, 2003; 23(21): 7437 - 7447. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Trembley, D. Hu, C. A. Slaughter, J. M. Lahti, and V. J. Kidd Casein Kinase 2 Interacts with Cyclin-dependent Kinase 11 (CDK11) in Vivo and Phosphorylates Both the RNA Polymerase II Carboxyl-terminal Domain and CDK11 in Vitro J. Biol. Chem., January 17, 2003; 278(4): 2265 - 2270. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Coyle, B. W. Guzik, Y.-C. Bor, L. Jin, L. Eisner-Smerage, S. J. Taylor, D. Rekosh, and M.-L. Hammarskjold Sam68 Enhances the Cytoplasmic Utilization of Intron-Containing RNA and Is Functionally Regulated by the Nuclear Kinase Sik/BRK Mol. Cell. Biol., January 1, 2003; 23(1): 92 - 103. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Itoh, I. Haga, Q.-H. Li, and J.-i. Fujisawa Identification of cellular mRNA targets for RNA-binding protein Sam68 Nucleic Acids Res., December 15, 2002; 30(24): 5452 - 5464. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wu, Z. Yu, and S.-H. Shen SKAP55 Recruits to Lipid Rafts and Positively Mediates the MAPK Pathway upon T Cell Receptor Activation J. Biol. Chem., October 18, 2002; 277(43): 40420 - 40427. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, D. C. Barnard, and J. G. Patton A Unique Glutamic Acid-Lysine (EK) Domain Acts as a Splicing Inhibitor J. Biol. Chem., October 11, 2002; 277(42): 39485 - 39492. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Scott, F. Zappacosta, E. Y. Kim, R. S. Annan, and W. T. Miller Identification of Novel SH3 Domain Ligands for the Src Family Kinase Hck. WISKOTT-ALDRICH SYNDROME PROTEIN (WASP), WASP-INTERACTING PROTEIN (WIP), AND ELMO1 J. Biol. Chem., July 26, 2002; 277(31): 28238 - 28246. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Denegri, I. Chiodi, M. Corioni, F. Cobianchi, S. Riva, and G. Biamonti Stress-induced Nuclear Bodies Are Sites of Accumulation of Pre-mRNA Processing Factors Mol. Biol. Cell, November 1, 2001; 12(11): 3502 - 3514. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Adams, L. van der Weyden, A. Mayeda, S. Stamm, B. J. Morris, and J. E.J. Rasko ZNF265--a novel spliceosomal protein able to induce alternative splicing J. Cell Biol., July 9, 2001; 154(1): 25 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Nayler, A. M. Hartmann, and S. Stamm The ER Repeat Protein Yt521-B Localizes to a Novel Subnuclear Compartment J. Cell Biol., September 4, 2000; 150(5): 949 - 962. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hofmann, C. L. Lorson, S. Stamm, E. J. Androphy, and B. Wirth Htra2-beta 1 stimulates an exonic splicing enhancer and can restore full-length SMN expression to survival motor neuron 2 (SMN2) PNAS, August 6, 2000; (2000) 160181697. [Abstract] [Full Text] |
||||
![]() |
O. Stoss, M. Olbrich, A. M. Hartmann, H. Konig, J. Memmott, A. Andreadis, and S. Stamm The STAR/GSG Family Protein rSLM-2 Regulates the Selection of Alternative Splice Sites J. Biol. Chem., March 16, 2001; 276(12): 8665 - 8673. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Chen, J. Cote, H. V. Carvajal, and S. Richard Identification of Sam68 Arginine Glycine-rich Sequences Capable of Conferring Nonspecific RNA Binding to the GSG Domain J. Biol. Chem., August 10, 2001; 276(33): 30803 - 30811. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chai, L. Wu, J. D. Griffin, and H. L. Paulson The Role of Protein Composition in Specifying Nuclear Inclusion Formation in Polyglutamine Disease J. Biol. Chem., November 21, 2001; 276(48): 44889 - 44897. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hofmann, C. L. Lorson, S. Stamm, E. J. Androphy, and B. Wirth Htra2-beta 1 stimulates an exonic splicing enhancer and can restore full-length SMN expression to survival motor neuron 2 (SMN2) PNAS, August 15, 2000; 97(17): 9618 - 9623. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||