![]() |
|
|
Vol. 10, Issue 12, 4149-4161, December 1999
Department of Cell Biology, Yale University School of Medicine, New Haven, Connecticut 06520-8002
Submitted May 26, 1999; Accepted October 4, 1999| |
ABSTRACT |
|---|
|
|
|---|
Fusion of post-Golgi secretory vesicles with the plasma membrane in yeast requires the function of a Rab protein, Sec4p, and a set of v- and t-SNAREs, the Snc, Sso, and Sec9 proteins. We have tested the hypothesis that a selective interaction between Sec4p and the exocytic SNAREs is responsible for ensuring that secretory vesicles fuse with the plasma membrane but not with intracellular organelles. Assembly of Sncp and Ssop into a SNARE complex is defective in a sec4-8 mutant strain. However, Snc2p binds in vivo to many other syntaxin-like t-SNAREs, and binding of Sncp to the endosomal/Golgi t-SNARE Tlg2p is also reduced in sec4-8 cells. In addition, binding of Sncp to Ssop is reduced by mutations in two other Rab genes and four non-Rab genes that block the secretory pathway before the formation of secretory vesicles. In an alternate approach to look for selective Rab-SNARE interactions, we report that the nucleotide-free form of Sec4p coimmunoprecipitates with Ssop. However, Rab-SNARE binding is nonselective, because the nucleotide-free forms of six Rab proteins bind with similar low efficiency to three SNARE proteins, Ssop, Pep12p, and Sncp. We conclude that Rabs and SNAREs do not cooperate to specify the target membrane.
| |
INTRODUCTION |
|---|
|
|
|---|
Eukaryotic cells contain a dynamic network of membrane-bound
organelles that are constantly remodeled by the budding and fusion of
transport vesicles and tubules as well as the homotypic fusion of like
organelles. The specificity of membrane fusion events must be carefully
regulated to allow proper communication between the organelles of the
secretory and endocytic pathways while avoiding inappropriate fusion
events that might degrade the organization of membranes within a cell.
The identification by genetic and biochemical means of proteins
involved in membrane trafficking led to the realization that many
proteins required only for a specific trafficking step are members of
protein families and have homologues localized to diverse sites within
the cell and to diverse cell types in multicellular organisms (Bennett
and Scheller, 1993
; Ferro-Novick and Jahn, 1994
). It has been proposed that although the general mechanism for intracellular membrane fusion
is conserved, specific interactions between particular members of
protein families ensure that membranes fuse only with an appropriate
target. The Rabs and the SNAREs are the largest of the protein families
involved in membrane trafficking, and both have been proposed to ensure
the fidelity of fusion (Botstein et al., 1988
; Rothman and
Warren, 1994
).
Rabs are guanine nucleotide-binding proteins whose conformation is
regulated by GTPase-activating proteins, which stimulate GTP
hydrolysis, and by nucleotide exchange proteins, which promote the
disassociation of GDP and subsequent binding of GTP (Bourne et
al., 1990
; Novick and Zerial, 1997
; Schimmoller et al.,
1998
). Rab effectors bind exclusively to the GTP-bound conformation of Rab proteins (Novick and Zerial, 1997
). Sec4p, the first Rab protein to
be implicated in secretion, is found on post-Golgi secretory vesicles
in yeast and is required for their fusion with the plasma membrane
(Goud et al., 1988
). After fusion, Sec4p-GDP is extracted from the plasma membrane by the cytosolic protein Gdi1p and recycled for subsequent rounds of transport (Garrett et al., 1994
).
Complete sequencing of the Saccharomyces cerevisiae genome
has revealed 11 Rab proteins, including 9 that have been associated
with a specific membrane trafficking step (Table
1) (Jedd et al., 1995
; Lazar
et al., 1997
). Although some Rabs such as Ypt51p, Ypt52p, and Ypt53p have overlapping distributions and functions, in general each membrane transport step requires the participation of a specific Rab protein (Lazar et al., 1997
).
|
SNAREs were originally identified as membrane proteins that bind to the
in vitro fusion factors N-ethylmaleimide-sensitive factor
(NSF) and
soluble NSF attachment protein (
SNAP) and NSF (Sollner
et al., 1993b
). In situations in which fusion occurs between a transport vesicle and a larger organelle, the SNAREs can be
classified as v-SNAREs on vesicles or t-SNAREs on fusion targets.
SNAREs are now known to assemble into a thermodynamically stable,
parallel four-helix bundle known as a SNARE complex, which bridges the
gap between opposing membranes before fusion (Nichols et
al., 1997
; Sutton et al., 1998
). SNARE complex assembly
either directly catalyzes membrane fusion or recruits other factors
required for fusion (Ungermann et al., 1998b
; Weber
et al., 1998
). SNARE complexes can be disassembled by the
ATPase activity of NSF (Sollner et al., 1993a
).
NSF also has a priming activity that is necessary before the docking
stage in an in vitro fusion assay (Mayer et al., 1996
). All
SNARE complexes identified to date include a SNARE protein homologous
to the synaptic t-SNARE syntaxin 1. In yeast, the eight syntaxin
homologues are each involved in fusion with a distinct subset of
membranes (Table 2) (Holthuis et
al., 1998a
,b
). The exocytic SNARE complex in yeast is composed of
a secretory vesicle v-SNARE, Snc1p or Snc2p, and the plasma membrane
t-SNAREs, Sec9p and Sso1p or Sso2p (Brennwald et al., 1994
).
Because the Snc1p and Snc2p v-SNAREs are 83% identical and
functionally redundant (Protopopov et al., 1993
), they will
be referred to collectively as Snc proteins. Similarly, because the
syntaxin-like t-SNAREs Sso1p and Sso2p are 72% identical and have a
redundant function during exocytosis (Aalto et al., 1993
),
we will refer to them as Sso proteins.
|
Neither Rabs nor SNAREs are, by themselves, sufficient to ensure the
fidelity of membrane fusion. For the Rab proteins, a single Sec4p/Ypt1p
chimeric Rab protein can fulfill the essential functions of both Ypt1p
and Sec4p without allowing fusion of vesicles derived from the
endoplasmic reticulum (ER) with the plasma membrane (Brennwald and
Novick, 1993
). In addition, a single Rab, Ypt1p, is required for at
least two distinct transport steps: transport between the ER and Golgi
and intra-Golgi transport (Jedd et al., 1995
). For SNAREs,
it has been shown that multiple v-SNAREs are often present in a single
class of transport vesicle (Chilcote et al., 1995
; Grote
et al., 1995
), and the same v-SNARE often participates in
both anterograde and retrograde vesicle traffic between two organelles
(Gotte and von Mollard, 1998
). Conversely, when vesicles originating
from different sources fuse with a common target organelle, a single
t-SNARE must bind to diverse v-SNAREs (Gotte and von Mollard, 1998
).
Finally, a recent study has documented that there are no preferential
high-affinity interactions between particular combinations of v- and
t-SNARE proteins (Yang et al., 1999
).
The insufficiency of either Rabs or SNAREs acting alone to ensure the
fidelity of membrane fusion stimulated us to consider the hypothesis
that the specificity of membrane fusion is mediated via combinatorial
interactions between Rab and SNARE proteins. Genetic evidence suggests
that SNAREs may be Rab effectors, because Rab mutations can often be
suppressed by overexpression of SNAREs (Dascher et al.,
1991
; Brennwald et al., 1994
), and Rab activity is required
for the assembly of a SNARE complex (Lian et al., 1994
;
Sogaard et al., 1994
). Recently, a direct interaction has been reported between a Rab, Ypt1p, and the syntaxin-like t-SNARE Sed5p
(Lupashin and Waters, 1997
). The authors suggest that Ypt1p may
activate Sed5p to allow its subsequent binding to Sec22p. An extension
of this model is that specific and direct interactions between Rabs and
t-SNAREs regulate the assembly of SNARE complexes. We have tested this
model by examining the effect of Rab mutations on different
v-SNARE/t-SNARE pairs and by testing the specificity of the direct
Rab-t-SNARE interaction. We report that several mutations that blocks
membrane transport upstream of SNARE complex assembly can prevent
coimmunoprecipitation of v- and t-SNAREs. Furthermore, we find that the
binding of Rab proteins to t-SNAREs involves the presumably inactive,
nucleotide-free state of the Rab and is inefficient and nonspecific.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid and Strain Constructions
Strains used are listed in Table
3. Construction of the
GAL1p-SNC2-HA3 yeast integrating plasmid
pNRB841 and the GAL1p-SNC2-HA
SNC1 sec18-1 strain NY1643
has been previously described (Abeliovich et al., 1998
).
The myc-SSO2 SSO1::LEU2 sec18-1 strain NY1727 was created by a three-step process. First, the SSO2 gene of
NY605 was modified with an N-terminal myc3 tag by
the method of Schneider et al. (1995)
to create EGY244.
Second, the SSO1 disruption from H826 [MAT
SSO2::leu2::(GAL1p-SSO1 HIS3) SSO1::LEU2
ade2-1 can1-100 his3-11,15 leu2-3, 112 trp1 ura3-1; a gift from S. Keranen, VTT] was crossed into EGY244 to create EGY248. Third,
the sec18-1 gene from NY1228 (MAT
sec18-1 leu2-3,
112) was crossed into EGY248 to yield NY1727.
|
NY1726, the
PEP12 GAL1p-SNC2-HA strain, was created by
digesting pNRB841 with EcoRI to direct integration of the
GAL1p-SNC2-HA3 gene at the LEU2
locus of RPY106 (Robert Piper, University of Iowa). The NSY222
and NSY348 strains were a generous gift from Nava Segev (University of
Chicago) (Jedd et al., 1995
, 1997
). EGY375 was
created by transformation of NY605 with pBEB19
(GAL1p-GFP-SEC2 in a 2µ URA3 vector; a gift
from N. Barry Elkind, Yale Unversity). NY1724 was created by
transformation of NY605 with pNRB632
(myc3-DSS4 in the 2µ URA3
vector pRS426); 2µ plasmids containing the DSS4, HSC82, SSO2, and HSC82 + SSO2 genes
transformed into NY1088 were a gift from J. Shannon (Yale University).
NY1725 (GAL1p-sec4-N133I
DSS4) was created by dissecting
a cross of NY1088 with NY929 (MATa leu2-3112
ura3-52 DSS4::URA3).
The hemagglutinin (HA)-tagged Rab protein expression vectors
pNRB829-pNRB840 were created by PCR-based subcloning and mutagenesis using 6HIS-tagged bacterial expression vectors (Du et al.,
1998
) as templates. A BamHI site and the HA epitope
YPYDVPDYA were fused to the N terminus of each coding sequence using a
primer beginning with the sequence
GGATCCACCATGTACCCATACGATGTCCCAGACTACGCTATG, where the final ATG
corresponds to the start of the open reading frame. The PCR products
were inserted between the BamHI and HindIII (YPT 1, YPT32, YPT51, and YPT7) or
PstI (SEC4 and YPT6) sites of pNB529
to create plasmids pNRB829-pNRB840. Nucleotide sequencing confirmed
the presence of asparagine to isoleucine mutations where appropriate
and revealed several differences between the pNRB529 subclones and
sequences available from the Saccharomyces Genomic Database.
A total of six missense mutations were found, and each mutation was
present in both the wild-type and N
I mutant plasmids. Because three
of the mutations did not affect the protein sequence, it seems likely
that the source of the mutations is natural variation between the
strains used by Novagen (Madison, WI) (Du et al., 1998
) and the yeast genomic sequencing consortium. The remaining three
mutations resulted in the following changes to the protein sequence:
K111E in YPT51, D81G in YPT6, and D51E in
YPT7. PNRB529 and pNRB829-pNRB840 were digested with
ClaI to direct integration into the LEU2 gene of
NY605 to create strains NY1705-NY1717. NY1720 (a/
myc3-SSO2) and NY1719 (a/
myc3-SSO2 HA3-sec4-N133I) were created by crossing EGY244 to NY871 (MAT
leu2 his4)-
and to pNRB834 (HA-sec4-N133I)-transformed NY871. Strain
NY1718 (sec18-1 HA-sec4-N133I) was created by transforming
NY1217 (MATa sec18-1 leu2-3112 ura3-52)
with pNRB834 (HA-sec4-N133I).
Antibodies
Antiserum against purified Sso1p (a gift from Axel
Brunger, Yale University) was generated by Cocalico. The anti-Ssop
serum was affinity purified using glutathione
S-transferase-Ssop (Rice et al., 1997
) bound to
glutathione-agrose beads (Amersham Pharmacia Biotech, Uppsala, Sweden).
Biotinylated anti-Sso for immunoblotting was prepared
using NHS-LC-Biotin (Pierce, Rockford, IL) according to the
manufacturer's protocol. Affinity-purified anti-Pep12p and anti-Vam3p
antibodies were from Robert Piper (University of Iowa, Iowa City, IA).
Anti-Sed5p and anti-Tlg2p sera were from Susan Fero-Novick (Yale
University). Anti-HA and biotinylated anti-HA monoclonal antibodies
(12CA5) were purchased from Boehringer Mannheim (Indianapolis, IN). The
anti-Sncp antibody has been previously described (Rossi et
al., 1997
). HRP-conjugated Goat anti-mouse and Goat anti-rabbit
antibodies were purchased from Jackson ImmunoResearch (West Grove, PA)
and Streptavidin-HRP was purchased from Amersham Pharmacia Biotech.
Lysis, Immunoprecipitation, and Western Blotting
Under standard conditions, early log phase yeast cultures grown at 25°C in YPD were collected by centrifugation and washed with 20 ml of ice-cold TAF buffer (20 mM Tris, pH 7.5, 20 mM NaN3, 20 mM NaF). The cells were then transferred to 2-ml screw capped tubes in 1 ml of TAF buffer and pelleted. Ice-cold immunoprecipitation (IP) buffer (20 mM HEPES, pH 7.4, 150 mM KCl, 1 mM DTT, 0.5% N-P40, 1 mM EDTA), proteinase inhibitors (1 mM PMSF, 1 µM pepstatin A) and 2 g of zirconia-silica beads were added, and the tubes were completely filled with liquid and sealed. The cells were lysed by homogenization in a mini-Bead Beater (Biospec Products, Bartlesville, OK) at full power for 4 min and then returned to an ice-water bath.
When temperature shifting was required, cultures at elevated temperatures were diluted 1:10 in ice cold TAF buffer, and cells were collected by centrifugation at 4°C. When appropriate, SNARE complex disassembly was promoted by collecting cells in ice-cold 20 mM Tris buffer, pH 7.5, without NaN3 or NaF and homogenizing in IP buffer supplemented with an ATP-regenerating system (1 mM ATP, 5 mM creatine phosphate, 10 µg/ml creatine phosphokinase, 3 mM MgCl2).
The lysates were diluted with IP buffer into 1.4-ml, 2-mg/ml aliquots and spun for 5 s in a microfuge to remove unbroken cells and cellular debris and then for 30 min at 16,000 × g. The cleared lysate was transferred to a fresh tube, an aliquot was reserved, and then primary antibody was added. After incubating on a rocking platform at 4°C for 2-16 h, protein G-Sepharose beads (Amersham Pharmacia Biotech) were added, and the incubation was continued for an additional 45 min. The immunoprecipitates were collected by centrifugation, and an aliquot of the supernatant was reserved. The immunoprecipitates were washed five to eight times with IP buffer, boiled for 5 min in gel-loading buffer with 1% SDS, run on either 12 or 15% SDS-polyacrylamide gels, and transferred to nitrocellulose membranes. The membranes were stained with Ponceau S to observe the quality of the transfer. Antigens on the membrane were detected by incubating the filter with blocking buffer (5% nonfat dry milk in PBS, 0.05% Tween 20), adding primary antibodies in blocking buffer, washing five times, adding HRP-conjugated detection reagent in blocking buffer, washing five times, incubating in chemiluminescent substrate (ECL from Amersham Pharmacia Biotech or BLAZE from Pierce), and then exposing the filter to BioMax MR film (Eastman Kodak, Rochester, NY). Lysates and depleted supernatant fractions from each immunoprecipitation were also assessed by immunoblotting. SNARE expression and immunoprecipitation efficiencies were identical for wild-type and mutant strains.
GTP Overlays
Lysates or anti-HA immunoprecipitates were run on 15%
SDS-polyacrylamide gels and transferred to nitrocellulose. The blots were preincubated for 30 min in GTP buffer (50 mM
NaH2PO4, pH 7.5, 2 mM DTT, 10 µM
MgCl2, 0.2% Tween 20, 4 µM ATP) to allow renaturation of low-molecular-weight GTP-binding proteins, probed with
1 µCi/ml [
-32P]GTP for 2 h in GTP
buffer, washed five times over 1 h with GTP buffer, air dried, and
exposed to film overnight at
80°C with an intensifying screen.
| |
RESULTS |
|---|
|
|
|---|
Sncp Binds to Many t-SNAREs
The Snc proteins Snc1p and Snc2p are best known as the v-SNAREs on
secretory vesicles that interact with the plasma membrane t-SNAREs
Sso1p, Sso2p, and Sec9p (Protopopov et al., 1993
; Brennwald et al., 1994
). More recently, Sncp has been shown to bind to
two other t-SNAREs, Tlg1p and Tlg2p (Abeliovich et al.,
1998
; Holthuis et al., 1998a
), which are localized to
endosomal and/or Golgi membranes. We tested whether Snc2p binds to
additional t-SNAREs by looking for coimmunoprecipitation of t-SNAREs
with HA-tagged Snc2p. The three Ssop homologues tested, Pep12p, Vam3p,
and Sed5p, each coimmunoprecipitated with HA-Snc2p but were not present
in control immunoprecipitations either without the anti-HA antibody or
from an untagged strain (Figure 1A).
Although these interactions are specific, only ~1% of the total
amount of each t-SNARE in the lysate coimmunoprecipitated with
HA-Snc2p. A similar small percentage of the total amount of Sncp
coimmunoprecipitated with Ssop, Tlg2p, or Pep12p. The observation that
only a small percentage of each t-SNARE protein coimmunoprecipitates
with Sncp is consistent with the proposal that assembled SNARE
complexes are transient intermediates in the process of membrane
fusion.
|
The original SNARE hypothesis proposed that the formation of specific
v-SNARE/t-SNARE pairs ensures the fidelity of vesicle targeting
(Rothman and Warren, 1994
). Our observation that Sncp binds to multiple
t-SNAREs, like similar observations for the v-SNAREs Sec22p and Vti1p
(Lewis et al., 1997
; von Mollard et al., 1997
),
was not predicted by this early model. One interpretation of these
results is that nonspecific SNARE pairs assemble during homogenization
or in the lysate. To test this possibility, we have used a "mixing"
assay that examines the binding of tagged proteins expressed in
different cell populations. We first examined the interaction between
Snc and Sso proteins (Figure 1B). A mixed lysate was prepared from
cells expressing myc-Sso2p and native Snc proteins (NY1643) and cells
expressing native Sso proteins and HA-Snc2p (NY1643). Both native and
myc-tagged Sso proteins precipitated in an anti-Sncp
immunoprecipitation, demonstrating that myc-Sso2p can bind to Sncp.
However, myc-Sso2p was absent from an anti-HA immunoprecipitate.
Therefore, Sncp and Ssop do not assemble into a SNARE complex during or
after homogenization. Because Sncp does not bind to Ssop in lysates,
the Sncp/Ssop complex we have observed must have assembled in vivo. The
two strains in the experiment shown have a mutation in Sec18p, the
yeast NSF homologue, which enhances the recovery of SNARE complexes.
Comparable results have been obtained in experiments with strain
expressing wild-type Sec18p (Carr et al., 1999
).
A similar experiment was performed to examine the interaction between
HA-Snc2p and Pep12p (Figure 1C). Pep12p coimmunoprecipitated with
HA-Snc2p if the two proteins were expressed in the same cells. However,
if HA-Snc2p expressed in a
pep12 strain was mixed with Pep12p from an untagged strain during homogenization of the yeast, the
two proteins did not coimmunoprecipitate. We conclude that the
Pep12p-HA-Snc2p interaction forms in vivo before homogenization and is
stable in the lysate. A third mixing experiment indicated that HA-Sncp
binds Tlg2p in vivo but not in lysates (Abeliovich et al.,
1998
). In summary, log phase yeast cells have SNARE complexes involving
Snc2p binding to Ssop, Pep12p, Tlg2p, and possibly also Tlg1p, Vam3p,
and Sed5p. Therefore, although Sncp is normally required for fusion of
secretory vesicles with the plasma membrane, it is unlikely to play a
role in secretory vesicle targeting, because Sncp can bind to t-SNAREs
present on a variety of potential target organelles.
Three Rab Mutations Inhibit Membrane Traffic Upstream of Sncp-Ssop SNARE Complex Assembly
Because a selective interaction between Sncp and Ssop cannot be
responsible for targeting secretory vesicles to the plasma membrane, we
considered the hypothesis that the mechanism of secretory vesicle
targeting involves a selective interaction between the secretory vesicle protein Sec4p and the plasma membrane protein Ssop
that promotes the assembly of a SNARE complex between Sncp and Ssop.
Sogaard et al. (1994)
reported that mutations in the ER to Golgi Rab protein Ypt1p inhibited coimmunoprecipitation of a
SNARE complex between the appropriate v- and t-SNARE proteins, Sec22p
and Sed5p. This result was interpreted as evidence that Ypt1p activates
Sec22p/Sed5p complex formation. We examined the effect of the
sec4-8 mutation on Sncp/Ssop SNARE complex assembly and
found that coimmunoprecipitation of Ssop with Sncp was reduced in a
sec4-8 mutant strain. To test whether this result reflects a
specific interaction between Sec4p and Ssop, we examined the effect of
mutations in three different Rab genes, SEC4, YPT1, and
YPT32, on the association between Sncp and two different
t-SNAREs, Ssop and Tlg2p. The sec4 and ypt1
mutant strains accumulate Golgi to plasma membrane vesicles and ER to
Golgi vesicles, respectively, when shifted to temperatures >30°C
(Novick et al., 1981
; Segev et al., 1988
).
YPT32 has a functionally redundant homologue,
YPT31. If both Ypt31p and Ypt32p are mutated, secretory
vesicles fail to bud from the Golgi (Jedd et al., 1997
). The
ypt1, ypt31 and sec4 mutant alleles
used for Figure 2A are similar to each
other, because each results in an aspartate for alanine (or glycine) substitution at a conserved position in the nucleotide binding domain
that causes a recessive loss of function.
|
If the Sncp/Ssop assembly defect in sec4-8 cells reflects a specific interaction between Sec4p and Ssop, one would predict that the sec4-8 mutation would not affect the binding of Sncp to Tlg2p. Perhaps Sncp/Tlg2p binding would be inhibited by loss of Ypt31p and Ypt32p activity. In contrast to this prediction, the results show that instead of each Rab mutation affecting assembly of a specific SNARE complex, there was reduced coprecipitation of Sncp with both Ssop and Tlg2p in all three Rab mutant strains (Figure 2A). Based on these results, we cannot conclude that inactivation of Rab proteins affects the interaction of Sncp with specific t-SNAREs.
One explanation for the observation that all three rab mutations affect
both Sncp-containing SNARE complexes is that these mutations are acting
upstream to block flux through several pathways involving
Sncp-dependent fusion. A prediction from this model is that any
mutation that blocks the secretory pathway upstream of the fusion of
secretory vesicles with the plasma membrane will inhibit assembly of
the Sncp/Ssop complex. To test this prediction, we examined several
temperature-sensitive strains with early blocks in the secretory
pathway and compared them with a sec4-8 strain. The mutant
strains used include sec16-2, which is defective in budding
from the ER (Kaiser and Schekman, 1990
); sec21-1 (COPI), defective in assembly of a coat required for the budding of retrograde transport vesicles from the Golgi that fuse to the ER and also in
selective aspects of anterograde ER to Golgi transport (Hosobuchi et al., 1992
; Letourneur et al., 1994
; Orci
et al., 1997
); sec19-1 (gdi1), which
is inhibited at multiple steps in the secretory pathway including ER to
Golgi transport because of a defect in Rab protein recycling (Garrett
et al., 1994
); and sec14-3 (phophatidyl inositol/phosphatidyl choline transfer protein), which is
unable to bud secretory vesicles from the Golgi (Bankaitis et
al., 1989
). As predicted, there was a reduction in the amount of
Ssop coprecipitating with Sncp in each of the mutant strains if the
cells were shifted to 37°C before lysis (Figure 2B). Notably, for
ypt1-3 cells no reduction in the amount of Ssop associated
with Sncp was observed until 30 min after the shift to 37°C. The
difference between the ypt1-A131D and ypt1-3
alleles after 10 min at 37°C can be explained by supposing that the
Ypt1-3 mutant protein is slowly inactivated. Also notable is the
reduced association of Ssop with Sncp at 25°C in the
sec4-8 mutant strain. This observation is consistent with the reduced abundance of the Sec4-8 protein and the reduced growth rate
of sec4-8 cells under these nominally permissive conditions (our unpublished observation). The association of Ssop with Sncp is
also reduced in wild-type yeast strains if they are grown in synthetic
media or in rich media with a nonfermentable carbon source. Assuming
that the rate of secretion correlates with the reduced doubling in
suboptimal growth media, these observations are all consistent with the
model that SNARE complex assembly depends on flux through the secretory pathway.
Nucleotide-free Sec4p Binds to Ssop
Because experiments performed with the Rab mutants do not provide
evidence for a specific functional interaction between Sec4p and Ssop,
we chose to look for a physical interaction between the two proteins by
coimmunoprecipitation as an alternative test of our hypothesis that
combinatorial interactions between Rabs and SNAREs ensure correct
vesicle targeting. In preliminary experiments with wild-type yeast,we
failed to detect Sec4p coprecipitating with Ssop either by probing an
immunoblot with anti-Sec4p antibodies or with an
[
-32P]GTP overlay assay. We then looked for
binding to Ssop of wild-type and mutant forms of Sec4p expressed at
high levels under control of a galactose-regulated promotor (Walworth
et al., 1989
). As a GTPase, Sec4p is thought to act as a
molecular switch with three conformations regulated by GTP binding,
hydrolysis, and release. Mutations were engineered in Sec4p based on
well-known mutations in the Ras oncogene that affect its nucleotide
binding and hydrolysis cycle. These mutations include
sec4-S34N, which is predicted to be locked in its GDP-bound
conformation, sec4-N133I, which fails to bind nucleotide,
and sec4-Q79L, which is defective in GTP hydrolysis (Walworth et al., 1989
, 1992
; Collins et al.,
1997
). Growth is inhibited by overexpression of the
sec4-S34N and sec4-N133I alleles (Walworth
et al., 1989
; Collins et al., 1997
). These
dominant negative effects are thought to occur because the mutant Sec4 proteins bind and sequester factors that are essential for secretion. Cells were shifted to media containing 3% galactose for 6 h to induce expression of the Sec4 proteins without killing the cells.
Among the Sec4 proteins, the nucleotide-free Sec4-N133I mutant protein
coimmunoprecipitated most efficiently with Ssop (Figure 3A). The significance of this result is
strengthened by the observation that Sec4-N133Ip was expressed at lower
levels than wild-type Sec4p and the other mutant Sec4 proteins. We also
examined the effect of Sec4 proteins on the Ssop/Sncp SNARE complex.
Expression of the two dominant-negative Sec4 proteins, Sec4-S34Np and
Sec4-N133Ip, reduced the amount of Ssop coprecipitating with Sncp. This
result was anticipated because these mutants reduce flux through the secretory pathway. Ssop/Sncp coimmunoprecipitation was also slightly reduced by overexpressing wild-type Sec4p. High levels of Sec4p expression (behind the GAL1 promotor on a high-copy-number
plasmid) are known to have a dominant negative growth phenotype
(Kabcenell et al., 1990
). Similarly, overproduction of Ypt1p
has been reported to reduce the coimmunoprecipitation of Sec22p with
Sed5p (Lupashin and Waters, 1997
). In contrast to the results with the
other Sec4 proteins, expression of Sec4-Q79Lp did not reduce Sncp/Ssop
coimmunoprecipitation or have a dominant-negative growth phenotype.
|
In addition to Ssop, two other proteins, Dss4p and Sec2p, are
known to bind Sec4-N133Ip. These other proteins regulate the nucleotide
binding status of Sec4p. Dss4 promotes GDP release, and Sec2p promotes
both GDP release and GTP binding (Moya et al., 1993
;
WalchSolimena et al., 1997
). We were intrigued by the
possibility that Ssop might also function as a nucleotide exchange
factor. As a preliminary test of this idea, we compared the binding of Dss4p, Sec2p, and Ssop to Sec4-N133Ip by mixing cells expressing HA-Sec4-N113Ip (see below) with cells expressing either myc-Dss4p or
GFP-Sec2p and then immunoprecipitating with antibodies against myc,
GFP, or Ssop. We found that >10% of the HA-Sec4-N133Ip coprecipitated with myc-Dss4p, 2% coprecipitated with GFP-Sec2p, and 0.05%
coprecipitated with Ssop (Figure 3B). The extremely inefficient binding
of Ssop to Sec4-N133Ip suggests that Ssop is unlikely to regulate
Sec4p's nucleotide binding state. A second indication that Ssop is not a Sec4p exchange factor is that, unlike Dss4p and Sec2p (Collins et al., 1997
; Walch-Solimena et al., 1997
), Ssop
does not bind to the Sec4-S34N mutant protein, which mimics the
GDP-bound state of Sec4p.
We were able to examine the relationship between Sec4-N133Ip
binding to Ssop, Sncp/Ssop SNARE complex assembly, and growth inhibition in Sec4-N133Ip expressing strains by comparing Sec4-N133Ip and Sncp binding to Ssop in a variety of genetic backgrounds (Figure 3C). Dss4p binds to the Sec4-N133I mutant protein and, when
overproduced, will suppress the dominant-negative growth phenotype of
Sec4-N133Ip expression (Collins et al., 1997
).
Overproduction of Dss4p reduced the binding of Sec4-N133Ip to Ssop but
did not restore normal levels of Sncp/Ssop binding (Figure 3C). Because
overproduction of Dss4p in Sec4-N133Ip-expressing cells results in a
normal growth rate with reduced levels of Sncp/Ssop SNARE complexes,
the absolute number of Sncp/Ssop SNARE complexes cannot be rate
limiting for growth. Deletion of DSS4, a nonessential gene
(Moya et al., 1993
), from sec4-N133I yeast had no
effect on growth or binding of either Sncp or Sec4-N133Ip to Ssop.
A second suppressor of the dominant-negative growth phenotype of Sec4-N133Ip was isolated in a multicopy genomic DNA library screen (Shannon and Novick, unpublished results). This plasmid contained two genes, HSC82 and SSO2, that are adjacent to each other on chromosome XIII. The HSC82 gene codes for a constitutively expressed homologue of the heat shock-induced chaperonin, Hsp70p. Sec4-N133Ip-overexpressing cells containing this plasmid have a wild-type growth rate and have partially restored binding of Sncp to Ssop. However, cooverexpression of Hsc82p and Sso2p does not prevent binding of Sec4-N133Ip to Ssop (Figure 3C). Thus, binding of Sec4-N133Ip to a small fraction of the total Ssop does not prevent Ssop/Sncp SNARE complex assembly when excess t-SNARE is available.
Individually, SSO2 and HSC82 are poor suppressors of the dominant negative sec4-N133I growth phenotype (Shannon, unpublished results). Hsc82p overexpression has no effect on the binding of Sncp or Sec4-N133Ip to Ssop. In contrast, although Sso2p overproduction does not restore growth, the amount of both Sncp and Sec4-N133Ip bound to Ssop increases, presumably by mass action (Figure 3C). Therefore, restoration of Sncp/Ssop binding is not sufficient to suppress the growth defect of Sec4-N133Ip-overexpressing cells. In summary, Sec4-N133Ip overexpression reduced both the amount of Sncp bound to Ssop and the growth rate, but these two phenotypes are not intimately related, because Ssop overexpression restores SNARE binding but not growth, whereas Dss4p overexpression restores growth but not SNARE binding.
All Nucleotide-free Rab Proteins Bind to v- and t-SNAREs
If Rabs interact with t-SNAREs to ensure the fidelity of
transport, one would expect that each Rab would interact with specific t-SNAREs. To address the specificity of the coimmunoprecipitation of
Sec4-N133Ip with Ssop, we constructed a series of strains with genes
coding for a representitive selection of N-terminally HA-tagged Rab
proteins integrated at the LEU2 locus of a wild-type yeast strain
behind a galactose-regulated GAL1 promotor. These Rab
proteins were either wild-type or carried an Asn to Ile mutation at a
position in their sequence analogous to the N133I mutation of
sec4-N133I. The plasmids containing the HA-tagged Rab genes
were sequenced to confirm the presence of the mutations and that no
errors were introduced during the PCR-based subcloning and mutagenesis
(see MATERIALS AND METHODS). Expression was confirmed with an anti-HA immunoblot of lysates prepared from cultures grown
overnight in YP galactose media (Figure
4A). An
[
-32P]GTP overlay assay of proteins in the
lysate (Figure 4A) and in anti-HA immunoprecipitates confirmed that the
wild-type, but not the mutant, Rab proteins bound GTP. Because
overproduction of several of the HA-tagged Rab proteins inhibited
growth, the HA-Rab-transformed strains were maintained in YP raffinose
media and grown for 6 h in YP galactose media to induce HA-Rab
expression before lysis.
|
To assay for specificity in the binding interactions of Rabs and t-SNAREs, we looked for coimmunoprecipitation of each of the wild-type and nucleotide-free mutant HA-Rab proteins with Ssop (Figure 4A). All of the nucleotide-free mutant Rabs coimmunoprecipitated with Ssop, but their wild-type counterparts did not. As a negative control, we confirmed that the nucleotide-free HA-Rab proteins do not bind to protein G-agarose beads in the absence of immunoprecipitating antibody. The quantity of each mutant HA-Rab protein in the anti-Ssop immunoprecipitates was approximately proportional to its expression level. We conclude that there are not significant differences in the efficiency with which of each of the Rab proteins, in their nucleotide-free conformations, binds Ssop.
We also compared the binding of each of the HA-Rab mutant proteins to
Pep12p, the t-SNARE on the prevacuolar compartment (Figure 5A). Pep12p might be predicted to have a
specific interaction with the Rab protein Ypt51p, because Pep12p and
Ypt51p are both involved in fusion to the prevacuolar compartment.
Ypt51-N120Ip did coimmunoprecipitate with Pep12p, but there was not
significantly more Ypt51-N120Ip in the Pep12 immunoprecipitate than the
amount that bound to Ssop. Furthermore, in addition to Ypt51-N120Ip, the other mutant HA-tagged Rab proteins coimmunoprecipitated with Pep12p in amounts approximately proportional to their expression levels. Thus, Rab proteins do not preferentially bind to those t-SNAREs
with which they functionally interact.
|
Because it has been established that Rab proteins are located on different membranes within a cell, the nonpreferential coimmunoprecipitation that we have observed suggests that Rabs and t-SNAREs may bind in the lysate after homogenization. A mixing experiment was carried out to determine whether HA-Sec4-N133Ip is able to bind to myc-Ssop after lysis (Figure 4B). HA-Sec4-N133Ip and myc-Ssop were either coexpressed in the same cells or expressed in separate populations of cells that were then mixed before homogenization. Expression of HA-Sec4-N133Ip in a separate population of cells than myc-Ssop did not reduce the amount of HA-Sec4-N133Ip coprecipitated in an anti-myc immunoprecipitate when compared with a strain in which the two proteins are coexpressed. This result suggests not only that HA-Sec4-N133Ip and Ssop can bind after lysis, but also that most of the complexes we observed formed after lysis. If any complexes present before lysis still remained, more HA-Sec4-N133Ip would have bound to myc-Ssop when the two proteins were expressed in the same cells than bound when the proteins were expressed in different cells. Thus, we find no evidence for the specific interaction between Sec4p and Ssop that would be expected if Rabs and t-SNAREs interact to ensure the fidelity of membrane fusion.
To determine whether Rab proteins bind to free t-SNAREs or to
SNARE complexes, we first looked for coimmunoprecipitation of the
overexpressed mutant Rab proteins with the Snc v-SNARE proteins (Figure
5A). Sncp bound in similar amounts to each of the mutant HA-Rabs. The
binding of the mutant Rabs to both Sncp and Ssop suggested that Rabs
bind to SNARE complexes. However, the result is also consistent with
binding of Rabs to free v- and t-SNARE proteins. To distinguish between
these possibilities, we compared the binding of HA-Sec4-N133Ip to Sncp
and Ssop under lysis conditions that promote or inhibit SNARE complex
disassembly (Figure 5B). The Sncp/Ssop SNARE complex is disassembled by
the NSF homologue Sec18p, an ATPase that can be activated in lysates by
addition of ATP and an ATP-regenerating system (Carr et al.,
1999
). To inhibit disassembly, cells are collected in ice-cold buffer
containing azide and fluoride to lower cellular ATP levels and then
lysed in buffer containing EDTA to chelate Mg2+,
which is an essential cofactor for Sec18p. Addition of ATP to the
lysate eliminated detectable binding of Ssop to Sncp but did not affect
the coimmunoprecipitation of HA-Sec4N133Ip with either Sncp or Ssop.
Although we cannot exclude the possibility that HA-Sec4-N133Ip binds
SNARE complexes, we conclude that HA-Sec4-N133Ip is able to bind to
free v- and t-SNAREs and that SNARE complex assembly is not a
prerequisite for binding.
| |
DISCUSSION |
|---|
|
|
|---|
SNAREs and Vesicle Targeting
In the original formulation of the SNARE hypothesis, specific
interactions between SNARE proteins were proposed to mediate vesicle
targeting. Each class of transport vesicle was defined by a unique
v-SNARE, which could bind only to its cognate t-SNARE on the
appropriate fusion target (Rothman and Warren, 1994
). One difficulty
with this model is that, over its lifetime, each v-SNARE protein is
found on several different classes of transport vesicles destined to
fuse with different targets. Newly synthesized v-SNAREs are
translocated into the ER (Kutay et al., 1995
) and
transported to their donor compartments via the secretory pathway.
Under steady-state conditions, v-SNAREs are recycled after fusion from
the acceptor organelle back to the donor to be incorporated into a new
transport vesicle. At the end of their lifetimes, v-SNAREs are likely
to be transported to proteolytic organelles such as the yeast vacuole for degradation. For v-SNAREs to function as targeting molecules, they
must be active only in those transport vesicles destined to fuse with
the acceptor organelle containing their cognate t-SNARE (Pfeffer,
1996
). We find no evidence for such regulation, because the v-SNARE
Snc2p binds to a variety of t-SNAREs including Sso1p, Sso2p, Tlg1p,
Tlg2p, Pep12p, Sed5p, and Vam3p. Because these t-SNAREs are each
localized to a distinct set of acceptor organelles, we propose that
Snc2p is active at all times and participates in diverse fusion events.
The accumulation of post-Golgi secretory vesicles, but not ER to Golgi
vesicles, in a snc mutant strain (Protopopov et
al., 1993
) can be explained by postulating that other v-SNAREs
that function in the early secretory pathway are excluded from
post-Golgi secretory vesicles. We conclude that Snc2p does not have a
fundamental role in vesicle targeting.
This conclusion is only valid if the v-SNARE-t-SNARE interactions we
have observed by coimmunoprecipitation actually occur within the cell.
This is a serious concern, because monomeric Sncp is predicted to have
an amphipathic helix with an exposed hydrophobic surface that might
interact with t-SNAREs after the constraints of subcellular
localization have been removed by lysing the cells with detergent. We
tested for SNARE complex assembly during or after lysis by mixing
populations of cells expressing either HA-tagged Snc2p or various
t-SNAREs before preparing lysates for immunoprecipitation. The results
established that HA-Snc2p does not bind to myc-Sso2p, Pep12p, or Tlg2p
after lysis. The failure of SNARE complexes to assemble in vitro is an
unusual property. We have observed that myc-Dss4p and GFP-Sec2p bind to HA-Sec4-N133Ip in lysates. In addition, the binding of myc-Sec1p to
Sncp/Ssop/s9p SNARE complexes can also occur in lysates (Carr et
al., 1999
). Therefore, in contrast to other protein-protein interactions, the SNARE complexes we have observed between Sncp and
Ssop and Pep12 and Tlg2p only assemble within living cells.
Regulation of SNARE Complex Assembly
The purified core
-helical domains of Snc1p, Sso1p, and Sec9p
have been shown to spontaneously assemble into a stable, high-affinity complex (Rice et al., 1997
). Although dilution of cellular
proteins with lysis buffer might slow the rate of SNARE complex
assembly, the failure of Snc2p to bind to Ssop in lysates during an
overnight incubation suggests that SNARE complex assembly is subject to negative regulation. Synaptophysin and n-Sec1 (munc18 or rb-sec1) have
been proposed to act as negative regulators of neuronal exocytic SNARE
complex assembly because they bind to monomeric SNARE proteins but not
to the exocytic SNARE complex (Pevsner et al., 1994
;
Edelmann et al., 1995
). This type of negative regulation is
unlikely to inhibit Sncp assembly into SNARE complexes because there
are no known synaptophysin homologues in yeast, and Sec1p cannot act as
a negative regulator of SNARE complex assembly because it
preferentially binds to assembled SNARE complexes (Carr et
al., 1999
). SNARE complex assembly is also negatively regulated by
an intramolecular interaction between the N- and C-terminal helical
domains of syntaxin-like t-SNAREs (Calakos et al., 1994
;
Hanson et al., 1995
; Nicholson et al., 1998
).
Promoting a conformational change in the t-SNARE necessary for the
assembly of SNARE complexes may be one component of the priming
activity provided by NSF/Sec18p in staged cell-free fusion assays
(Mayer et al., 1996
; Ungermann et al., 1998a
).
However, we find that the SNARE complex disassembly activity of Sec18p predominates over any potential assembly-promoting activity in lysates,
so it was not possible for us to examine the role of Sec18p in SNARE
complex assembly.
Rab-SNARE Interactions
Rab proteins have been proposed to activate SNARE complex assembly
based on strong genetic interactions between Rabs and SNARE genes
(Dascher et al., 1991
; Brennwald et al., 1994
)
and the observation that the ER to Golgi SNARE complex fails to
assemble in ypt1 mutants (Sogaard et al., 1994
).
However, we have now demonstrated that inhibition of SNARE complex
assembly is not a unique phenotype of Rab mutations, because the
Sncp/Ssop SNARE complex fails to assemble in a variety of mutants that
inhibit secretion upstream of the docking of secretory vesicles to the
plasma membrane. Thus, no conclusions about the mechanism of
SNARE complex assembly can be drawn from the observation that SNARE
complexes fail to assemble in sec4-8 mutant cells, because
sec4-8 fits within the large category of mutations that
block secretion upstream of secretory vesicle docking.
A more recent observation suggested a direct physical interaction
between Rab and SNARE proteins that might activate SNARE complex
assembly. Lupashin and Waters (1997)
reported that the Rab protein
Ypt1p binds to Sed5p, the syntaxin-like t-SNARE, on the
cis-Golgi. These authors proposed that transient binding of Ypt1p to Sed5p might activate Sed5p by promoting the release of the
negative regulator Sly1p (a Sec1p homologue), thereby allowing Sed5p to
bind to the v-SNARE Sec22p (Lupashin and Waters, 1997
). Because Rabs
and syntaxin-like t-SNAREs each function in discrete membrane
trafficking steps, this model suggested to us that interactions between
Rabs and syntaxin-like t-SNAREs might regulate vesicle targeting. We
therefore examined in detail the binding of Rabs to SNAREs.
We observed that six different Rabs, in their nucleotide-free conformation, bind with similar efficiency to three different SNAREs including two t-SNAREs, Ssop and Pep12p, and the v-SNARE Sncp. These results do not support the model that specific interactions between Rabs and t-SNAREs regulate vesicle targeting. In fact, because the interactions we have observed are promiscuous, inefficient and involve the unstable, nucleotide-free Rab conformation, it is possible that they simply reflect the ability of amphipathic helicies to bind to partially unfolded Rab proteins. However, because specific Rab and SNARE proteins are likely to be brought in close proximity to each other during membrane fusion, it remains plausible that the Rab/SNARE binding we and others have observed is physiologically significant. Further experiments will be required to determine whether physical interactions between Rabs and SNAREs at the high concentrations available during membrane fusion regulate either Rab function or SNARE complex assembly.
In vitro, Rab proteins promote tethering of vesicles to larger
organelles (Cao et al., 1998
; Ungermann et al.,
1998b
). Close apposition of vesicles and their target membranes is
likely to accelerate SNARE assembly by increasing the local
concentration of v- and t-SNARE proteins. In addition to their
vesicle-tethering function, Rab proteins have also been implicated in
regulation of vesicle budding (Woodman, 1998
), transport of vesicles on
the cytoskeleton (Walch-Solimena et al., 1997
), and other
cytoskelletal rearrangements (Echard et al., 1998
). As
multifunctional proteins, Rabs are likely to interact with numerous
regulatory and effector proteins.
Functional and Nonfunctional SNARE Complexes
Assembly of a SNARE complex in trans between a v-SNARE
on a transport vesicle and a t-SNARE on its fusion target is essential for fusion (Nichols et al., 1997
). Nevertheless, SNARE
complexes can also form in cis between v- and t-SNARE
proteins located in the same membrane (Otto et al., 1997
).
One indication that the Sncp/Ssop SNARE complexes we have
identified by coimmunoprecipitation are functional (trans)
complexes is that the amount of Ssop bound to Sncp is reduced by
~75% within 10 min after a block in transport is imposed early in
the secretory pathway. The remaining complexes may be remnants of
earlier fusion events that have not yet been disassembled by Sec18p or
cis complexes assembled by a mechanism independent of
membrane transport.
The amount of Ssop bound to Sncp is also reduced when growth is inhibited by overexpression of Sec4-N133Ip. This reduction in SNARE complex assembly may be an indirect consequence of reduced flux through the secretory pathway analogous to the reduction in SNARE complex assembly seen in early sec mutants rather than a direct consequence of overproducing Sec4-N133Ip. Overexpression of Sso2p leads to an increase in the amount of Ssop coprecipitating with Sncp without restoring growth. These SNARE complexes are likely to be nonproductive cis complexes. In contrast, overproducing Dss4p restores normal growth without increasing the amount of Ssop bound to Sncp. This result suggests that under normal conditions, more trans-SNARE complexes are assembled than are necessary for growth. However, it is also possible that partial restoration of secretory function by Dss4p overproduction is sufficient to allow a wild-type growth rate.
Conclusion
We have tested the hypothesis that specific interactions between
Rabs and syntaxin-like t-SNAREs are responsible for ensuring that
transport vesicles fuse only with appropriate target organelles. The
attraction of this hypothesis is primarily based on its adherence to
the theoretical expectation that fusion specificity is mediated by
evolutionarily related proteins. In a test for specificity of the
interaction between the exocytic Rab and t-SNARE proteins Sec4p and
Ssop, we have found that Sec4p is but one of many proteins in the
secretory pathway whose function is required upstream of the assembly
of Sncp and Ssop into SNARE complexes. We have also found that the
direct binding of Sec4p to Ssop involves the nucleotide-free form of
Sec4p and is inefficient and nonspecific. Based on these results, we
propose that the fidelity of vesicle fusion originates from factors
unique to each type of transport event rather than from conserved
components evolved from a common primordial fusion machine. One such
stage-specific factor is the exocyst (TerBush et al., 1996
).
The exocyst is a heteroligomeric protein complex essential for growth
that has been proposed to ensure that post-Golgi secretory vesicles
fuse only with the plasma membrane. The subunits of the exocyst include
Sec15p, which binds to the GTP-bound form of Sec4p on secretory
vesicles (Guo et al., 1999
), and Sec3p, which is localized
to sites on the plasma membrane where secretion normally occurs
independently of flux through the secretory pathway (Finger et
al., 1998
). Candidate targeting complexes have also been
identified for ER to Golgi transport and for homotypic endosome fusion
(Cao et al., 1998
; Sacher et al., 1998
;
Christoforidis et al., 1999
). In addition to factors that
regulate fusion itself, interactions between vesicles and the
cytoskeleton are also likely to have a fundamental role in vesicle targeting.
| |
ACKNOWLEDGMENTS |
|---|
Thanks to Nava Segev, Robert Piper, Axel Brunger, Sirkka Keranen, Susan Ferro-Novick, Jeffrey Shannon, Li Lin Du, N. Barry Elkind, and Ruth Collins for strains and reagents. Thanks to Ruth Collins, Chavela Carr, Hagai Abeliovich, Jeffrey Shannon, N. Barry Elkind, and Li Lin Du for fruitful discussions and/or comments on the manuscript. This work was supported by a National Research Service Award to E.G. and by a grant from the National Institutes of Health to P.N.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: peter.novick{at}yale.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. J. Herrero-Turrion, J. Calafat, H. Janssen, M. Fukuda, and F. Mollinedo Rab27a Regulates Exocytosis of Tertiary and Specific Granules in Human Neutrophils J. Immunol., September 15, 2008; 181(6): 3793 - 3803. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jin, J. M. McCaffery, and E. Grote Ergosterol promotes pheromone signaling and plasma membrane fusion in mating yeast J. Cell Biol., February 25, 2008; 180(4): 813 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Mollinedo, J. Calafat, H. Janssen, B. Martin-Martin, J. Canchado, S. M. Nabokina, and C. Gajate Combinatorial SNARE Complexes Modulate the Secretion of Cytoplasmic Granules in Human Neutrophils. J. Immunol., September 1, 2006; 177(5): 2831 - 2841. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Grosshans, A. Andreeva, A. Gangar, S. Niessen, J. R. Yates III, P. Brennwald, and P. Novick The yeast lgl family member Sro7p is an effector of the secretory Rab GTPase Sec4p J. Cell Biol., January 3, 2006; 172(1): 55 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Puri, M. J. Kruhlak, S. W. Whiteheart, and P. A. Roche Mast Cell Degranulation Requires N-Ethylmaleimide-Sensitive Factor-Mediated SNARE Disassembly J. Immunol., November 15, 2003; 171(10): 5345 - 5352. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Bryant and D. E. James The Sec1p/Munc18 (SM) protein, Vps45p, cycles on and off membranes during vesicle transport J. Cell Biol., May 26, 2003; 161(4): 691 - 696. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ortiz, M. Medkova, C. Walch-Solimena, and P. Novick Ypt32 recruits the Sec4p guanine nucleotide exchange factor, Sec2p, to secretory vesicles; evidence for a Rab cascade in yeast J. Cell Biol., June 10, 2002; 157(6): 1005 - 1016. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Peng and D. Gallwitz Sly1 protein bound to Golgi syntaxin Sed5p allows assembly and contributes to specificity of SNARE fusion complexes J. Cell Biol., May 13, 2002; 157(4): 645 - 655. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gurunathan, M. Marash, A. Weinberger, and J. E. Gerst t-SNARE Phosphorylation Regulates Endocytosis in Yeast Mol. Biol. Cell, May 1, 2002; 13(5): 1594 - 1607. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Seeley, M. Kato, N. Margolis, W. Wickner, and G. Eitzen Genomic Analysis of Homotypic Vacuole Fusion Mol. Biol. Cell, March 1, 2002; 13(3): 782 - 794. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Segev Ypt/Rab GTPases: Regulators of Protein Trafficking Sci. Signal., September 18, 2001; 2001(100): re11 - re11. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-L. Du and P. Novick Yeast Rab GTPase-activating Protein Gyp1p Localizes to the Golgi Apparatus and Is a Negative Regulator of Ypt1p Mol. Biol. Cell, May 1, 2001; 12(5): 1215 - 1226. [Abstract] [Full Text] |
||||
![]() |
M. M.K. Tsui, W. C.S. Tai, and D. K. Banfield Selective Formation of Sed5p-containing SNARE Complexes Is Mediated by Combinatorial Binding Interactions Mol. Biol. Cell, March 1, 2001; 12(3): 521 - 538. [Abstract] [Full Text] |
||||
![]() |
R. Kucharczyk, A. M. Kierzek, P. P. Slonimski, and J. Rytka The Ccz1 protein interacts with Ypt7 GTPase during fusion of multiple transport intermediates with the vacuole in S. cerevisiae J. Cell Sci., January 9, 2001; 114(17): 3137 - 3145. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Grote, G. Vlacich, M. Pypaert, and P. J. Novick A snc1 Endocytosis Mutant: Phenotypic Analysis and Suppression by Overproduction of Dihydrosphingosine Phosphate Lyase Mol. Biol. Cell, December 1, 2000; 11(12): 4051 - 4065. [Abstract] [Full Text] |
||||
![]() |
F. P. Finger and P. Novick Synthetic Interactions of the Post-Golgi sec Mutations of Saccharomyces cerevisiae Genetics, November 1, 2000; 156(3): 943 - 951. [Abstract] [Full Text] |
||||
![]() |
E. Grote, C. M. Carr, and P. J. Novick Ordering the Final Events in Yeast Exocytosis J. Cell Biol., October 18, 2000; 151(2): 439 - 452. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Grote, M. Baba, Y. Ohsumi, and P. J. Novick Geranylgeranylated SNAREs Are Dominant Inhibitors of Membrane Fusion J. Cell Biol., October 18, 2000; 151(2): 453 - 466. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Allan, B. D. Moyer, and W. E. Balch Rab1 Recruitment of p115 into a cis-SNARE Complex: Programming Budding COPII Vesicles for Fusion Science, July 21, 2000; 289(5478): 444 - 448. [Abstract] [Full Text] |
||||
![]() |
M. J. Conboy and M. S. Cyert Luv1p/Rki1p/Tcs3p/Vps54p, a Yeast Protein That Localizes to the Late Golgi and Early Endosome, Is Required for Normal Vacuolar Morphology. Mol. Biol. Cell, July 1, 2000; 11(7): 2429 - 2443. [Abstract] [Full Text] |
||||
![]() |
T. Coppola, S. Magnin-Luthi, V. Perret-Menoud, S. Gattesco, G. Schiavo, and R. Regazzi Direct Interaction of the Rab3 Effector RIM with Ca2+ Channels, SNAP-25, and Synaptotagmin J. Biol. Chem., August 24, 2001; 276(35): 32756 - 32762. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-L. Du and P. Novick Pag1p, a Novel Protein Associated with Protein Kinase Cbk1p, Is Required for Cell Morphogenesis and Proliferation in Saccharomyces cerevisiae Mol. Biol. Cell, February 1, 2002; 13(2): 503 - 514. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||