![]() |
|
|
Vol. 10, Issue 12, 4341-4353, December 1999


*Department of Biology, Washington University, St. Louis, Missouri
63130; and
University of Edinburgh, Institute of Cell and
Molecular Biology, Edinburgh EH9 3JR, United Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
We have identified partial loss of function mutations in class VI unconventional myosin, 95F myosin, which results in male sterility. During spermatogenesis the germ line precursor cells undergo mitosis and meiosis to form a bundle of 64 spermatids. The spermatids remain interconnected by cytoplasmic bridges until individualization. The process of individualization involves the formation of a complex of cytoskeletal proteins and membrane, the individualization complex (IC), around the spermatid nuclei. This complex traverses the length of each spermatid resolving the shared membrane into a single membrane enclosing each spermatid. We have determined that 95F myosin is a component of the IC whose function is essential for individualization. In wild-type testes, 95F myosin localizes to the leading edge of the IC. Two independent mutations in 95F myosin reduce the amount of 95F myosin in only a subset of tissues, including the testes. This reduction of 95F myosin causes male sterility as a result of defects in spermatid individualization. Germ line transformation with the 95F myosin heavy chain cDNA rescues the male sterility phenotype. IC movement is aberrant in these 95F myosin mutants, indicating a critical role for 95F myosin in IC movement. This report is the first identification of a component of the IC other than actin. We propose that 95F myosin is a motor that participates in membrane reorganization during individualization.
| |
INTRODUCTION |
|---|
|
|
|---|
In Drosophila mature sperm arise from stem cells that
reside at the tip of each testis. These stem cells undergo four
synchronous rounds of mitosis without cellular division to yield 16 spermatocytes encased by two cyst cells of somatic origin. The 16 spermatocytes undergo meiosis in the midregion of the testis, resulting
in 64 spermatids connected by a network of cytoplasmic bridges. Still in a syncytium, the spermatids elongate the length of the testis, reaching ~2 mm in size (see Figure 5A for schematic; for reviews, see
Lindsley and Tokuyasu, 1980
; Fuller, 1993
).
To be competent for fertilization each spermatid must be enclosed in
its own membrane by a process called individualization (see Figure
1 for a schematic of individualization).
Individualization proceeds from the head region of each spermatid to
the tail (Tokuyasu et al., 1972
). The cystic bulge, a
spindle-shaped enlargement of the cyst, is the region in which
individualization is occurring. Within the bulge the individualized
portion is devoid of cytoplasmic organelles (except the major and minor
mitochondrial derivatives and the axoneme) and contains structures
termed investment cones. A single investment cone, filled with fine
fibrils ~60 Å in diameter, surrounds each spermatid. Golgi reside at
the individualization boundary, and beyond that are dense
concentrations of ribosomes and organelles (see Tokuyasu et
al., 1972
, their Figure 11). As the cystic bulge progresses toward
the caudal end of the spermatids, it increases in size because of the
accumulation of organelles. Eventually the excluded membrane and
organelles are pinched off at the caudal end in the waste bag
structure. After individualization, each sperm is contained in its own
membrane, and only a remnant of the axonemal sheath remains next to the
condensed mitochondria (for fine structural analysis of
spermatogenesis, see Stanley et al., 1972
).
|
Fabrizio et al. (1998)
have recently shown that the
individualization complex (IC) within the developing spermatids
contains actin as its major cytoskeletal component. They proposed that the IC is a complex of membrane and cytoskeletal proteins. In an effort
to identify important components in the individualization process,
Fabrizio et al. (1998)
examined a number of late male sterile mutations and classified them by distinguishing features of the
actin-containing IC. Although this phenotypic analysis has provided a
wealth of information about the complexity of the individualization
process, the only known molecular component of the IC is actin. The
work reported here identifies another component of the IC as class VI
unconventional myosin.
95F myosin is a member of a large family of unconventional myosins.
Currently there are at least 15 classes of unconventional myosins,
classified according to similarities within their myosin head domains
(for review, see Cope et al., 1996
). Several unconventional myosins, including 95F myosin, have been implicated in membrane and
organelle trafficking in vitro and in vivo (for reviews, see Titus,
1997
; Mermall et al., 1998
). 95F myosin is expressed in many
tissues throughout the life cycle of the fly. It functions in vivo as
an ATP- and actin-dependent transporter in the pregastrulation embryo
(Mermall et al., 1994
). During this stage of embryogenesis the cells are undergoing rapid rounds of mitosis within a common cytoplasm. 95F myosin is involved in particle movements to and from the
invaginating membranes that divide neighboring mitotic apparati in the
syncytium. Upon inhibition of 95F myosin with anti-95F myosin antibody,
these actin-based invaginations fail to form (Mermall and Miller,
1995
). Using antisense RNA technology, 95F myosin has been shown to be
essential for epithelial morphogenesis throughout development.
Gal4-upstream activation sequence-driven antisense constructs
expressed in different tissues and at different times lead to a variety
of phenotypes, including lethality at various developmental stages and
abnormalities in the evagination of leg and wing imaginal discs and in
the migration of follicle cells in oogenesis (Deng et al.,
1999
).
We have isolated a partial loss of function mutation in 95F myosin,
mmw14, which results in male sterility but otherwise does not affect viability or female fertility. We can rescue this mutation with one copy of the 95F myosin heavy chain (MHC) cDNA. In addition, we
have determined that this mutation fails to complement another postmeiotic differentiation mutation, jaguar, which was
previously isolated in a screen for male sterile mutations (Castrillon
et al., 1993
). Both of the mutations in 95F myosin result in
a defect in spermatid individualization. Because of the similarity of
effects of 95F myosin loss in the metaphase furrows of the early embryo and during spermatogenesis, we propose that 95F myosin is the motor
that is essential for transport and reorganization of membranes at the
advancing individualization front.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Fly Culture
All fly stocks were maintained on standard Drosophila
cornmeal, agar, and sucrose medium at 25°C. The jaguar
(jar1) mutant allele, previously described by
Castrillon et al. (1993)
, was obtained from the Bloomington
Stock Center (Bloomington, IN). The deletion chromosome,
Df(3R)S87-5, was made by Elizabeth Knust and Jose
Campos-Ortega and others (University of Koln) and was obtained from
Eric Weischaus (Princeton University). The starting P insert
line, C865, came from a Gal4 screen for genes expressed in a
subset of follicle cells in oogenesis (Deng et al., 1997
, 1999
).
Generation of 95F Myosin Deletion Mutant
The 95F myosin mutation, mmw14, was generated by
excision of a P element insertion, which is located at the 5' end of
the 95F myosin gene on the third chromosome (Figure 2). The starting P
insert line, C865, had the genotype
w
/w
;
P[w+, Gal4]/P[w+,
Gal4]. P element excision was performed by crossing
C865 to an endogenous source of transposase,
w
/Y; P[
2-3],
Dr/TM3, Sb. The dominant marker, Dr, allows selection for and against the source of transposase. In the F1 generation, P[
2-3] containing progeny were selected and
were crossed to a third chromosome balancer line,
w
/w
;
TM3, Sb/TM6, Tb. The resulting progeny were scored for lines that had lost the P element and therefore had white eyes and no longer
contained the P[
2-3]. Heterozygous stocks
were established by crossing the P excision lines to
w
; TM3, Sb/TM6, Tb. The
potential P excisions were screened for lethality by crossing
heterozygous siblings to one another and scoring for the presence of
homozygotes by the lack of the marked balancer chromosome.
Generation of the 95F MHC Transgene
A full-length cDNA encoding the EM3 isoform of 95F MHC was
cloned into CaspeR-HS83 downstream of the hs83 promoter. To clone the
cDNA into the CaspeR-HS83 vector, first a 950-bp PCR product was
generated by using a 5' primer that added an XhoI site
upstream of the initiator methionine and a 3' primer centered around a unique BamHI site in the middle of the 95F myosin gene. This
PCR product was then digested with XhoI and BamHI
and ligated into the XhoI-BamHI-digested CaspeR
vector. Next, a BamHI-NotI fragment of 95F MHC
was isolated from the cDNA. This fragment contains the rest of the 95F
MHC downstream of the BamHI site and includes the 3' UTR.
The BamHI-NotI fragment was then ligated into the BamHI/NotI digested CaspeR vector containing the
Xho-BamHI fragment of 95F MHC. The CaspeR-HS83 95F MHC cDNA
(P[95F MHC]) was injected into homozygous
w
embryos containing constitutively
active transposase, and stable transformants were obtained by standard
procedures (Rubin and Spradling, 1982
). Adults containing the P[95F
MHC] were selected for by the presence of an eye color marker
(w+) present on CaspeR-HS83.
Rescue of the mmw14 Male Sterile Phenotype
To test for rescue of the male sterile phenotype of mmw14/Df(3R)S87-5 by P[95F MHC], w; P[95F MHC]/CyO; mmw14/TM3, e, Sb males or females were crossed with w; +/+; Df(3R)S87-5, e/TM3, e, Sb males or females. The resulting male progeny with the genotypes w; P[95F MHC]/+; mmw14/Df(3R)S87-5, e, and w; +/+; mmw14/Df(3R)S87-5 were selected and tested for fertility by mating to wild-type virgin females.
Mapping of the Genomic Organization of the 95F Myosin Mutant Alleles
The P element insertion (C865), which was used to generate
mmw14, was mapped to the 5' end of the 95F myosin gene (Deng
and Bownes, unpublished results). The P element insertion,
P[lacZ, ry+] (Castrillon
et al., 1993
), was mapped relative to the 95F myosin genomic
structure using PCR. Two primers, one hybridizing to the end of the P
element (CGACGGGACCACCTTATGTTATTTCATC) and one specific for the 95F
myosin ATG (ACACACCAGTTGGGTGTCCTCCAACAT), were used to amplify genomic
DNA of jar1/jar1 adults. The
resulting product was 4.5 kb, placing the P element insertion within an
intron, 4.5 kb upstream from the start of translation (see Figure 2).
The mmw14 deletion was mapped using Southern blotting with
probes from the 95F myosin cDNA and flanking the
P[w+; Gal4] C865 insertion site.
Reverse Transcription (RT)-PCR
Two to 3 µg of total RNA were reverse transcribed by adding 1 µl avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI), and the final concentration of the RT buffer was adjusted to 1×. Usually the reaction volume was 50 µl. The reaction was carried out at 48°C for 45 min and stopped at 94°C for 2 min.
Three microliters of the RT reaction product were used as the template for PCR. PCR was carried out using a Hybaid (Middlesex, United Kingdom) thermal cycler. The standard reaction volume was 100 µl in sterile 0.5-ml tubes. Pharmacia (Piscataway, NJ) dNTPs were used for all reactions. Standard final concentrations of dNTPs and primers were 0.1 mM and 2.5 pmol/µl respectively. The standard PCR buffer used was 50 mM KCl, 20 mM Tris-HCl, pH 8.3, 2 mM MgCl2 and 1 mg/ml gelatin.
Primers used for these experiments are p1 (GAGTTCGACTCGACTCATCCAAC), p517 (ATCACGATGACAACTGCGAAC), and p1027 (TAGTGCGATATGTAACCACCGACC).
Antibodies
The 95F myosin monoclonal antibody 3C7 (Kellerman and Miller,
1992
) was diluted 1:20 for Western blots and 1:10 for whole tissue. The
anti-tubulin monoclonal antibody DM1A was used at a concentration of
1:10 for Western blots.
Western Analysis
Either testes or whole animals were homogenized in 2× Laemmli sample buffer supplemented with 1 mM PMSF and 1 mM EDTA, proteins were separated on a 7.5% SDS polyacrylamide gel and transferred to a Nitrobind transfer membrane (Micron Separations, Westboro, MA) in glycine buffer (150 mM glycine, 0.02% SDS, 20% methanol) at 90 V for 4 h. The blot was blocked for 1 h in 5% nonfat dry milk in TBST (Tris-buffered saline [TBS; 25 mM Tris, 135 mM NaCl, 2.6 mM KCl], pH 8, and 0.05% Tween 20 [Sigma, St. Louis, MO]) and incubated with primary antibody diluted in 5% nonfat dry milk for 2 h at room temperature. The blot was washed four times for 15 min each with TBST, incubated with Immunopure goat anti-mouse HRP (Pierce, Rockford, IL) at 1:10,000 for 1 h, and washed four times for 15 min each with TBST. Detection was performed using enhanced chemiluminescence (Super Signal Substrate; Pierce). The protein standards were broad-range standards from Bio-Rad (Hercules, CA; 200, 116.2, 97.4, 66.2, 45, 31, 21.5, 14.4, and 6.5 kDa).
Immunofluorescent Staining
Testes were prepared for immunofluorescent staining by the
method of Hime et al. (1996)
. Testes were dissected in
testes buffer 1 (15 mM potassium phosphate, pH 6.7, 80 mM KCl, 16 mM
NaCl, 5 mM MgCl, and 1% polyethylene glycol 8000), transferred to a
poly-L-lysine-coated slide, and squashed
with a siliconized coverslip. The slide and coverslip were frozen in
liquid nitrogen, the coverslip was removed with a razor blade, and the
slide was placed in 95% ethanol on dry ice for 10 min. The slide was
drained, fixed in 4% formaldehyde (EM Science, Gibbstown, NJ) in PBS
for 7 min, washed twice for 15 min in PBS + 0.3% Triton X-100 and
0.3% sodium deoxycholate, and rinsed in PBT (PBS + 0.1% Triton
X-100). The fixed testes were then blocked with PBTB (PBS + 0.1%
Triton X-100 + 3% BSA) for 30 min, incubated with primary antibody
(anti-95F myosin monoclonal antibody, 3C7, at 1:10) for 2 h at
room temperature, and rinsed four times for 15 min with PBTB. Testes
were incubated with secondary antibody (goat anti-mouse Oregon Green;
Molecular Probes, Eugene, OR) and/or rhodamine-phalloidin
(Sigma) in PBTB for 1 h at room temperature and then rinsed one
time for 15 min in PBTB. For staining DNA, the testes were incubated
with 1 µg/ml DAPI in PBTB for 10 min and then rinsed two times with
PBTB. Testes were mounted in mounting medium (10% glycerol + 1 mg/ml
p-phenylenediamine).
Cytological Analysis
To assay for spermatid motility, testes were dissected from
newly eclosed Oregon-R, mmw14/Df(3R)S87-5 or
jar1/jar1 males in
Drosophila Ringer's solution with
1,4-piperazinediethanesulfonic acid according to the method of
Castrillon et al. (1993)
. Dissected testes were squashed
under coverslips and examined immediately by phase-contrast microscopy.
Scoring ICs
Testes were dissected from 1- to 2-d-old males of the indicated
genotype and prepared as above for immunofluorescent microscopy. The
fixed testes were stained with both rhodamine-conjugated phalloidin (Sigma) and DAPI. In general the scoring of the ICs was based on the
method of Fabrizio et al. (1998)
, but a detailed description follows. For each genotype (wild-type,
jar1/jar1 or
jarm/Df(3R)S87-5), several (either 8 or
10) testes were examined. First the total number of ICs per testis was
counted on the basis of staining with rhodamine-conjugated
phalloidin. Then for each IC it was determined whether the IC
colocalized with nuclei by examining the IC for colocalizing DAPI
staining. Each IC was carefully observed to determine whether the actin
cones were in register with one another. If they were in register they
were counted as "intact." If they were out of register in any way
they were counted as "disrupted." If rhodamine-phalloidin
staining did not coincide with DAPI staining, it was assumed that the
IC had progressed away from the nuclei; therefore the IC was counted as
"progressed." The progressed ICs were also carefully observed to
determine whether the actin cones were in or out of register and were
counted as either intact or disrupted accordingly.
| |
RESULTS |
|---|
|
|
|---|
P Element Insertion in the 95F Myosin Gene Causes Male Sterility
The 95F myosin mutation, mmw14, was isolated by
imprecise excision of a P element, which mapped to the 5' end of the
95F myosin gene (Figure 2; Deng and
Bownes, unpublished results). The initial P element insertion line,
C865, did not exhibit a phenotype in homozygous mutant
lines. We excised the P element to create a mutation in 95F myosin.
Several lines that show deletion of either 5' or 3' DNA at the
P[Gal4] insertion site were obtained. One of these lines,
mmw14, has a portion of the first exon removed (Figures 2
and 3, A and B). mmw14
heterozygous with the deficiency, Df(3R)S87-5, which removes
the 95F myosin gene (Kellerman and Miller, 1992
), results in viable
adults. Fertility of females is not affected in
mmw14/Df(3R)S87-5 animals. However, male
mmw14/Df(3R)S87-5 animals are sterile. The male sterility
phenotype is also observed in another deletion mutant,
mfw98, in which 2 kb of 5' genomic sequence flanking the
P[Gal4] insertion site in C865 were deleted. mmw14/mfw98 males also exhibit a male sterile phenotype,
indicating that both excision mutants are in the same complementation
group. The male sterile phenotype is due to a partial loss of 95F
myosin function in these flies (see below).
|
|
Before this work Castrillon et al. (1993)
had performed a P
element insertion screen for genes that affected male fertility. They
recovered a line with a P element insertion in the 95F region, which
they called jaguar. When either homozygous or in
trans with Df(3R)S87-5, jaguar results
in male sterility. At the time they were unable to determine the
identity of the gene or genes affected by this insert. Analysis of DNA
that flanks the insertion did not yield any known genes, and the P
element was believed to reside within an intron (Wasserman, personal
communication). Subsequently, we determined by complementation analysis
that mmw14 and jaguar are allelic to one another:
the mmw14/jar1 transheterozygote is male sterile.
This complementation analysis demonstrates that mmw14 and
jar1 are mutations in the same gene. Because
jar mutations were the first mutations isolated, we will
refer to all subsequent mutations in this gene as alleles of
jar. Therefore, mmw14 has been renamed jarmmw14 in keeping with the conventions of
Drosophila nomenclature.
We mapped the P element insertion in jar1 to the
first intron of 95F myosin (Figure 2) using PCR with primers at the P
element end and within the 95F myosin cDNA (see MATERIALS AND METHODS). We and others (Wasserman, unpublished observations) have determined by
excision of the P element that it is responsible for the male sterile
mutation. We introduced an endogenous source of transposase,
2-3,
into the jar1/jar1 background and
scored the resulting offspring for the loss of the P element. Of the 42 independent excisions we recovered, none was lethal, 14 were male
sterile, and 28 were fertile. Because we are able to revert the male
sterile phenotype to fertility by loss of the P element, we conclude
that the P element insertion is responsible for the male sterility.
95F Myosin cDNA Rescues the Sterile Phenotype of mmw14
To determine whether the jarmmw14 male sterile phenotype resulted from a reduction in 95F myosin function, we tested the ability of ectopically expressed 95F MHC to rescue the jarmmw14 fertility defect. Transgenic animals that contain a 95F MHC cDNA driven by hs83, a promoter known to be active in the Drosophila germ line, were generated by P element-mediated transformation, and the transgene was crossed into the mutant background (see MATERIALS AND METHODS). Twenty-four hemizygous jarmmw14/Df(3R)S87-5 males that contained one copy of the 95F MHC transgene were mated with virgin females. Of these 24 males, 83% were fertile and produced viable offspring. In contrast, 100% (20 of 20) of the hemizygous males that lacked the 95F MHC transgene were infertile and produced no offspring. Therefore, the 95F MHC cDNA is sufficient to rescue the jarmmw14 male sterile phenotype, supporting our molecular evidence that jarmmw14 is a mutation in the 95F MHC.
jar1 and jarmmw14 Are Partial Loss-of-Function Mutations
The jarmmw14 deletion does not prevent expression of 95F myosin in all tissues. To demonstrate this we performed RT-PCR (Figure 3) with the primer pairs p1 and p1027. p1 is at the transcription start site in the first exon, whereas p1027 is in the second exon. In wild-type third instar larvae, the p1 and p1027 primer pair yielded a band of ~1 kb (Figure 3A, lane 2). However, in the jarmmw14 homozygous larvae this band was missing (Figure 3A, lane 3). RT-PCR with p517, a primer which is 3' of the first exon, and p1027 yields a band of 500 bp in both the wild-type and jarmmw14 larvae (Figure 3A, lanes 4 and 5). This suggests that a second transcription start site exists, and the deletion in jarmmw14, which only deletes untranslated sequences, does not prevent expression of this gene in whole animals.
Animals homozygous for jarmmw14 die as late as third instar larvae. We attribute this lethality to a mutation at another chromosomal region, because jarmmw14/Df(3R)S87-5 animals are viable and exhibit an identical male sterile phenotype as the jar1/jar1 mutant (see above). Because jar1/jar1, jar1/jarmmw14, and jarmmw14/Df(3R)S87-5 have the same phenotype, i.e. male sterility, and jarmmw14/Df(3R)S87-5 can be rescued by the 95F MHC transgene, the unlinked homozygous lethality of the mmw14 allele is irrelevant to our analysis. To date none of the deletion lines we generated is a null mutation in 95F myosin.
Because jarmmw14 animals still produce 95F
myosin transcripts, we suspected that this allele might affect
regulation of the gene. To determine whether expression of 95F myosin
protein was affected in testes, we analyzed the carcass and testes from
mutant animals by immunoblotting for 95F myosin (Figure
4). In wild-type adults 95F myosin is
present as a 140-kDa protein (Kellerman and Miller, 1992
). When one
copy of the deficiency, Df(3R)S87-5, is introduced into the
wild-type background, the amount of 95F myosin is reduced (lane 2). In
jarmmw14/Df(3R)S87-5 (lane 4) or
jar1/jar1 (lane 6) adult carcass,
95F myosin is present in amounts similar to that seen in
Df(3R)S87-5/+ animals. Thus, in these mutant animals 95F
myosin that is of normal size is expressed in most tissues.
|
In contrast, 95F myosin expression in testes is affected by these mutations. 95F myosin is present in substantial amounts in the testes of wild-type (Figure 4, lane 7) and Df(3R)S87-5/+ (lane 8). However, 95F myosin protein is either completely absent (jarmmw14/Df(3R)S87-5; lane 10) or significantly reduced in amount (jar1/jar1, lane 12) in testes from the mutants. 95F myosin is also present in homozygous jarmmw14 mutant larvae (our unpublished results). The presence of the 95F myosin cDNA transgene results in elevated expression of 95F myosin in the testes (P[95F MHC]; jarmmw14/S87-5, lane 13) These data suggest that jarmmw14and jar1 are partial loss-of-function mutations in the 95F myosin heavy chain. Expression of the gene is not affected in most adult tissues but is reduced or absent in testes.
Gross Morphology of Mutant Testes Is Normal
The cause of the male sterile phenotype was investigated by
detailed examination of testes from mutant animals. To determine whether the size, overall gross morphology of the testes, or meiotic and mitotic stages were affected, we examined mutant and wild-type testes from newly eclosed males stained with DAPI to visualize nuclei.
The testes is organized as a spiral structure with the early stages of
spermatogenesis at the apical end (Figure
5A). The heads of the elongated
spermatids are near the terminal end of the spiral, and
individualization proceeds toward the apical end. A single
individualizing cyst of 64 haploid spermatids is highlighted in red.
|
We did not observe any differences in size or overall morphology between wild-type and jarmmw14/Df(3R)S87-5 testes (Figure 5, B and C). The jar1/jar1 testes were similar (our unpublished results). In addition, the early meiotic and mitotic stages appear normal (our unpublished results). However, there were several differences readily apparent in organization of the spermatid nuclear clusters. In wild type, the nuclear clusters are brightly stained and reside in the terminal third of the testes near the seminal vesicle (Figure 5B). In jarmmw14/Df(3R)S87-5, some nuclear clusters are smaller (and therefore not as brightly stained) and are present closer to the apical end of the testes. We postulate that the presence of bundles in the more apical region results from an accumulation of mutant spermatids in the testes because they are never released into the seminal vesicle. We never observed sperm in the seminal vesicle of the jarmmw14/Df(3R)S87-5 testes (our unpublished results).
jarmmw14 and jar1 Sperm Exhibit Defects in Sperm Motility
The lack of sperm in the jarmmw14 seminal
vesicles indicated to us that there could be a defect either in sperm
morphology or sperm motility. To determine the basis for this
phenotype, mutant testes were squashed and prepared as described in
Fabrizio et al. (1998)
. Wild-type sperm that are properly
individualized exhibit a rapid sinusoidal movement in the squash
preparation. jarmmw14/Df(3R)S87-5 sperm
completely lack motility, and
jar1/jar1 sperm exhibit a slower
sinusoidal motion as compared with wild type. When examined by
phase-contrast light microscopy the mutant sperm of either genotype
does not exhibit any gross morphological defects, such as blebbing of
the cytoplasm (Fabrizio et al., 1998
). The motility defect
suggested that 95F myosin mutations might affect individualization.
95F Myosin Is a Component of the IC
To determine whether individualization was affected, we stained testes with rhodamine-phalloidin, anti-95F myosin monoclonal antibody (3C7), and DAPI to examine IC organization in detail. We first examined wild-type testes to determine the normal subcellular localization of 95F myosin. During individualization a cytoskeletal complex called the IC assembles around the clustered nuclei and travels the length of the testes toward the tips of the tails (Figure 1). The IC is made up of 64 actin-rich cones, one of which surrounds each nucleus. The base of the cones leads as the IC travels away from the nuclei. The plasma membrane that was shared by all the spermatids in the cyst becomes resolved into a single membrane for each sperm as the IC progresses. Finally, the IC terminates in the waste bag, which is eventually pinched off from the cyst.
95F myosin is present in a subcortical distribution in the
spermatocytes before meiosis (our unpublished results). After
elongation, as the IC assembles, 95F myosin localizes in the region of
the nuclear clusters in a particulate distribution (Figure
6A). After formation of the IC (Figure
6E), 95F myosin tightly localizes in a band of staining at the base of
each investment cone (Figure 6D). A tracing of the actin cones in
Figure 6E, with the limits of the cyst and an arrow indicating the
direction of IC movement, is shown for orientation in Figure 6F. Based
on our observations, it is not clear whether 95F myosin assembles into
a ring before or after the actin cones initiate movement. Investigation
of the dynamics of this structure would require live imaging of ICs. The band of 95F myosin staining remains at the leading edge of actin
cones as the IC traverses the length of the testis (Figure 6G). In
fact, 95F myosin appears to become more concentrated at this site as
the complex moves. Upon completion of individualization, the complex,
its proteins, and the membranous material that has been excluded from
the spermatid terminate in the waste bag structure. This structure is
eventually pinched off at the base of each spermatid. 95F myosin
continues to localize in a ring-like structure (Figure 6G), even as the
actin filaments appear to break down in the waste bag (Figure 6H). The
ring-like nature of the staining is seen at high magnification in a
more oblique optical section (Figure 6G, inset).
|
To determine whether 95F myosin-containing rings overlap with
actin-containing investment cones, we overlaid the distributions of 95F
myosin and actin (Figure 7). It is clear
that 95F myosin overlaps the actin distribution in a thin band at the
leading edge of the investment cone. This particular IC is flattened so that the individual cones are more clearly visualized. The outline of
the cystic bulge is apparent in front of the IC.
|
IC Organization Is Aberrant in 95F Myosin Mutants
In the jarmmw14/Df(3R)S87-5
testes, 95F myosin staining is absent from the spermatocytes and
spermatids but is present in somatic cells, such as the cells that
constitute the seminal vesicle (our unpublished results). The actin
filaments of the IC assemble around each nuclear bundle (Figure
8A) but often the nuclei (Figure 8B) are
not aligned in register as in wild type (Figure 6, B,C, and E). The
majority of the ICs that colocalize with the nuclear bundles have their
component actin cones out of register and thus are of abnormal
morphology. These are called disrupted ICs. In
jar1/jar1 testes, occasionally
95F myosin is present in a particulate manner near the nuclei, but more
often 95F myosin staining is absent in the germ cells, as in the
jarmmw14/Df(3R)S87-5 testes. Although the
actin assembles around the nuclei, the individual cones of the ICs in
jar1/jar1 spermatids also are not
aligned properly (Figure 8, C and D). Progressed ICs that have their
component cones out of register and do not contain 95F myosin are
frequently observed (Figure 8E).
|
To determine whether the rescue of the mutant male sterile phenotype by the 95F MHC cDNA restored proper localization of 95F myosin in the spermatids, we stained the P[95F MHC ]; jarmmw14/Df(3R)S87-5 testes with anti-95F myosin and rhodamine-phalloidin. 95F myosin localized in a band at the advancing front of the investment cone similar to wild type (our unpublished results).
Individualization Is Disrupted in the Mutants
To quantitate IC behavior and morphology in mutant animals
compared with wild type, we fixed and stained wild-type,
jarmmw14/Df(3R)S87-5 and
jar1/jar1 testes from newly
eclosed flies. We examined 8 wild-type testes and 10 testes each for
jarmmw14/Df(3R)S87-5 and
jar1/jar1. We selected several
parameters by which to score the ICs, following the convention of
Fabrizio et al. (1998)
(for further details, see Materials
and Methods). We counted the number of
rhodamine-phalloidin-stained ICs in each testis and of those
determined the number associated with DAPI stained nuclear bundles. We
also counted the number of ICs that associated with nuclear bundles but
had their component investment cones out of register (disrupted; see
Figure 8A for example of a disrupted IC). Finally, we counted the
number of ICs that did not colocalize with DAPI (progressed). We noted
for the ICs that had progressed whether all the investment cones were closely apposed in register or disrupted. An example of an intact, progressed IC is shown in Figure 6E, whereas a disrupted, progressed IC
is shown in Figure 8E. The results of the quantitation are summarized
in Figure 9.
|
Both classes of mutant testes have fewer ICs per testis than wild type. The average number of ICs in wild-type testes is 22, whereas in jarmmw14 and jar1, an average of 10 and 14 ICs, respectively, is observed. In wild-type testes most ICs were intact and either associated with nuclei (62%) or progressed away from nuclei (34%). ICs either at the nuclei or the terminal structure, the waste bag, are most common, suggesting that the ICs progress relatively quickly from the head to the end of the tail. There were very few ICs in wild type that were disrupted and colocalized with nuclei (3%) or were disrupted and progressed (0.3%). Both jarmmw14/Df(3R)S87-5 and jar1/jar1 testes displayed significantly fewer intact ICs either colocalizing with the nuclear bundles or progressed compared with wild-type controls. The majority of ICs in the mutants were either disrupted and associated with nuclei (55%, jarmmw14 and 43%, jar1) or disrupted and progressed (24%, jarmmw14 and 42%, jar1).
| |
DISCUSSION |
|---|
|
|
|---|
We have identified three independent partial loss-of-function
mutations in a class VI unconventional myosin, 95F myosin, that result
in male sterility because of a defect in spermatid individualization. Although several groups have suggested possible mechanisms for spermatid individualization (Tokuyasu et al., 1972
; Fuller,
1993
; Fabrizio et al., 1998
), the specific molecules
involved in this process, with the exception of actin and clathrin,
have not been identified. Our phenotypic analysis of the 95F myosin
mutants leads us to suggest that 95F myosin is a motor component of the IC, which may play a role in the reorganization of membrane required for individualization (see below).
95F myosin is not required for the initial assembly of actin into the
IC, because in mutant animals actin initially assembles normally. After
actin is recruited to the complex but before any movement, 95F myosin
localizes in particulate structures along the length of the nucleus.
These particulate structures are reminiscent of 95F myosin localization
in other tissues (Kellerman and Miller, 1992
; Mermall and Miller, 1995
;
Lantz and Miller, 1998
) and may represent vesicular or organellar
cargo. In the absence of 95F myosin, actin still forms investment
cones, but the alignment of cones within each cyst is disrupted
compared with wild type. It is not clear from our results whether this
misalignment is a result of an initial defect in positioning of the
nuclei or whether the complex begins to move in the absence of 95F
myosin, becoming disorganized as it progresses and dragging nuclei out of alignment. However, because spermatid elongation and nuclear condensation appear unaffected in mutant testes, it is unlikely that
95F myosin plays a direct role in nuclear positioning.
After assembly of the complex, the IC progresses down the cyst, maintaining the alignment between investment cones of neighboring spermatids. 95F myosin becomes tightly associated with the base of the advancing investment cone, and this distribution is maintained as the IC progresses down the cyst to the waste bag. In the absence of 95F myosin, either the IC never advances away from the nuclei, or its component cones advance out of register, resulting in a disrupted IC. This suggests that 95F myosin is involved in IC movement. Based on the known functions for other myosins there are three possible models for the role of 95F myosin during individualization: 1) a force-producing motor, which moves the IC; 2) an actin cross-linking structural protein; and 3) a motor involved in short-range movements, which are important for membrane reorganization.
The simplest model for the role of 95F myosin is that it provides the force that moves the IC along the length of the axoneme. If this is the case, when 95F myosin is absent the investment cones should not move away from their assembly site adjacent to the nuclei. In fact, we observe investment cones that have translocated away from the nucleus in the mutant, which make this model unlikely. In addition, in this model, 95F myosin would require some type of "track" on which to translocate down the spermatid. There is no obvious actin track preceding the IC. The microtubules that constitute the spermatid tail axoneme might form a track for movement, but it seems likely that a myosin would only be able to use these microtubules to move actin filaments and membrane in collaboration with microtubule-binding proteins and microtubule motors.
In other tissues, such as nervous system and posterior of the early
embryo, 95F myosin colocalizes with D-CLIP-190, the
Drosophila homologue of the vertebrate vesicle linker
protein CLIP 170 (Lantz and Miller, 1998
). Both CLIP-170 and D-CLIP-190
bind microtubules in vitro. To determine whether 95F myosin might
interact with microtubules by way of D-CLIP-190, we examined the
localization of D-CLIP-190 in testes. D-CLIP-190 is not colocalized
with 95F myosin in testes (our unpublished results). We hypothesize
that if 95F myosin produces force for movement during IC progression it
does not do so by binding indirectly to microtubules by way of
D-CLIP-190. This does not exclude the possibility that there is another
as yet undiscovered CLIP family member or other microtubule-associated protein in Drosophila that could interact with 95F myosin in
this process.
A second model for the role of 95F myosin is in stabilizing the actin structure as it moves. In this case, actin would assemble, and ICs would begin to move. However, because 95F myosin was absent, they would rapidly disassemble, leading to few progressed ICs. Our data show that in fact there is no substantial change in the proportion of ICs that have progressed. This model also does not easily explain why ICs and their associated nuclei are initially out of register in the mutant.
We favor the third hypothesis, that 95F myosin might function to
transport components important for individualization to the site of
membrane growth. Progression of the investment cone down the spermatid
bundle reorganizes the previously shared membrane so that each sperm is
enclosed by a distinct membrane. This membrane remodeling is likely to
involve an organized mechanism for delivery and incorporation of
recycled and/or newly synthesized membrane and cytoskeletal components.
We hypothesize that 95F myosin functions to recruit vesicles from the
apical side of the IC (ahead of individualization machinery) to the
site of membrane remodeling, the leading edge of the investment cone
(Figure 10). 95F myosin would travel
along cortical actin filaments toward the plasma membrane and release vesicles at the site of membrane remodeling. This model would explain
the accumulation of 95F myosin in the band at the base of the leading
edge of the investment cones. In this model, 95F myosin would not serve
as the motor that generates force for IC movement down the
spermatogenic cyst. Instead we postulate that the force that moves the
IC is actin polymerization. This model is reminiscent of the mechanism
of actin-based movement of Listeria monocytogenes (Theriot
et al., 1992
; Tilney et al., 1992
).
|
If the membrane delivery and assembly machinery were defective, as we postulate is the case in the 95F myosin mutants, then the actin polymerization would eventually stall because of physical constraints on the membrane. As the ICs began to move, the nuclei and actin rings would be pulled out of alignment because of inefficient delivery of membrane or other membrane skeleton components to the site of force generation. This hypothesis would explain the observation that mutant testes contain a high number of disrupted, progressed ICs.
95F myosin might also (or instead) play a role in membrane endocytosis, which is likely to be required for this remodeling event. However, whether a role in endocytosis would cause 95F myosin to accumulate at the base of the actin cones is unclear.
The data presented here do not allow us to eliminate 95F myosin as the
force producer for IC movement or as a cross-linker of actin filaments.
However, the idea that it plays a role in membrane transport is
consistent with its function at other times in development and with the
proposed association of myosin VI with Golgi vesicles and other
membrane compartments (Buss et al., 1998
; Bunn et
al. 1999
).
In the blastoderm embryo 95F myosin is a particle transporter (Mermall
et al., 1994
; Mermall and Miller, 1995
). This movement represents an actin-dependent translocation of vesicles or other cellular components into the newly forming membrane furrows. This type
of rapid, directed incorporation of required components is quite
similar to the reorganization that must occur upon individualization. In addition, 95F myosin is expressed at the leading edge of follicle cells undergoing rapid shape changes as they migrate, which is also
compatible with this interpretation (Deng et al., 1999
).
Recently, Buss et al. (1998)
have demonstrated that
myosin VI localizes to the Golgi and the trans-Golgi network
in mammalian cell lines. Myosin VI also is enriched at the leading edge
of migrating human fibroblasts and is recruited to dynamic cell surface structures upon stimulation with epidermal growth factor. The authors
suggest that myosin VI may be involved in exocytic membrane transport
from the Golgi complex to the leading edge. In addition, the glucose
transporter C-terminal binding protein (GLUT1CBP) has recently been
shown to bind in vitro to myosin VI (Bunn et al., 1999
).
This interaction suggests a role for myosin VI as part of the glucose
transporter complex important for specific membrane domain localization.
To date 15 classes of unconventional myosins have been recognized.
However, little is known about their discrete functions in vivo (Cope
et al., 1996
). Mutations in myosins from several classes
have revealed a wide range of phenotypes. In vertebrates, mutations in
some unconventional myosins cause hearing defects, indicating that they
play important roles in the hair cells of the neuroepithelium (for
reviews, see Hasson, 1997
; Steel and Brown, 1998
). In fact, myosin VI
is the gene affected in the Snell's waltzer mutant mouse.
In these animals the cochlear and vestibular neurosensory epithelium
degenerates soon after birth (Avraham et al., 1995
). Within
the hair cells of the inner ear, myosin VI localizes to the actin-rich
cuticular plate, which anchors the stereocilia into the cytoplasm.
Within this region, myosin VI associates with the pericuticular
necklace, a structure rich in vesicles between the cuticular plate and
the circumferential actin band (Hasson et al., 1997
). It has
been postulated that myosin VI may function to locally transport
vesicles and organelles in this region. Although such a role would be
consistent with our models of how 95F myosin functions in
Drosophila syncytial blastoderm and spermatids, it has not
yet been possible to correlate defects in hair cell vesicle trafficking
with concomitant degeneration.
The partial loss-of-function mutations that we have characterized here provide important new information about class VI unconventional myosin function. Based on the excellent correlation between the subcellular localization of 95F myosin and the phenotype of the 95F myosin mutants, we have been able to develop a concrete model for membrane remodeling and cytoskeletal function that requires 95F myosin. Because the role of 95F myosin appears similar in both spermatids and in syncytial blastoderm, further studies of this process promise to provide insight into unconventional myosins roles throughout development.
| |
ACKNOWLEDGMENTS |
|---|
We thank Dr. Steve Wasserman for discussions on the jaguar phenotype and sharing unpublished data, Dr. Chris Bazinet for suggestions on scoring of IC phenotypes and discussions on the 95F myosin mutant defects, Dr. Cynthia Wagner for careful reading of the manuscript, and Dr. Julie Brill and Dr. Elizabeth Raff for helpful comments and testes fixation protocols. We also thank the Bloomington and Umea Drosophila stock centers for providing stocks. This work was supported by the Wellcome Trust (to M.B.), a National Research Service Award (to J.L.H.), and National Institutes of Health grant GM-43607 (to K.G.M.). W.-M.D. was supported by the Darwin Trust. A.D.R. was supported by a National Institutes of Health Cellular and Molecular Biology training grant.
| |
FOOTNOTES |
|---|
Present address: J579, HSB, Department of
Biochemistry, Box 357350, University of Washington, Seattle, WA 98195.
§ Corresponding author. E-mail address: miller{at}biology.wustl.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Noguchi, D. J. Frank, M. Isaji, and K. G. Miller Coiled-Coil-Mediated Dimerization Is Not Required for Myosin VI to Stabilize Actin during Spermatid Individualization in Drosophila melanogaster Mol. Biol. Cell, January 1, 2009; 20(1): 358 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Noguchi, M. Lenartowska, A. D. Rogat, D. J. Frank, and K. G. Miller Proper Cellular Reorganization during Drosophila Spermatid Individualization Depends on Actin Structures Composed of Two Domains, Bundles and Meshwork, That Are Differentially Regulated and Have Different Functions Mol. Biol. Cell, June 1, 2008; 19(6): 2363 - 2372. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Morrison and K. G. Miller Genetic Characterization of the Drosophila jaguar322 Mutant Reveals That Complete Myosin VI Loss of Function Is Not Lethal Genetics, May 1, 2008; 179(1): 711 - 716. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sakata, Y. Watanabe, J. Usukura, and I. Mabuchi Characterization of Native Myosin VI Isolated from Sea Urchin Eggs J. Biochem., October 1, 2007; 142(4): 481 - 490. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhong and J. M. Belote The testis-specific proteasome subunit Pros{alpha}6T of D. melanogaster is required for individualization and nuclear maturation during spermatogenesis Development, October 1, 2007; 134(19): 3517 - 3525. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Dunn, S. Chen, D. A. Faith, J. L. Hicks, E. A. Platz, Y. Chen, C. M. Ewing, J. Sauvageot, W. B. Isaacs, A. M. De Marzo, et al. A Novel Role of Myosin VI in Human Prostate Cancer Am. J. Pathol., November 1, 2006; 169(5): 1843 - 1854. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Frank, S. R. Martin, B. N. T. Gruender, Y.-S. R. Lee, R. A. Simonette, P. M. Bayley, K. G. Miller, and K. M. Beckingham Androcam Is a Tissue-specific Light Chain for Myosin VI in the Drosophila Testis J. Biol. Chem., August 25, 2006; 281(34): 24728 - 24736. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Noguchi, M. Lenartowska, and K. G. Miller Myosin VI Stabilizes an Actin Network during Drosophila Spermatid Individualization Mol. Biol. Cell, June 1, 2006; 17(6): 2559 - 2571. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Jung, G. Liu, W. Zhou, and X. Chen Myosin VI Is a Mediator of the p53-Dependent Cell Survival Pathway. Mol. Cell. Biol., March 1, 2006; 26(6): 2175 - 2186. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ghosh-Roy, B. S. Desai, and K. Ray Dynein Light Chain 1 Regulates Dynamin-mediated F-Actin Assembly during Sperm Individualization in Drosophila Mol. Biol. Cell, July 1, 2005; 16(7): 3107 - 3116. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ghosh-Roy, M. Kulkarni, V. Kumar, S. Shirolikar, and K. Ray Cytoplasmic Dynein-Dynactin Complex Is Required for Spermatid Growth but Not Axoneme Assembly in Drosophila Mol. Biol. Cell, May 1, 2004; 15(5): 2470 - 2483. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hasson Myosin VI: two distinct roles in endocytosis J. Cell Sci., September 1, 2003; 116(17): 3453 - 3461. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Noguchi and K. G. Miller A role for actin dynamics in individualization during spermatogenesis in Drosophila melanogaster Development, May 1, 2003; 130(9): 1805 - 1816. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Rogat and K. G. Miller A role for myosin VI in actin dynamics at sites of membrane remodeling during Drosophila spermatogenesis J. Cell Sci., March 14, 2003; 115(24): 4855 - 4865. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Tzolovsky, H. Millo, S. Pathirana, T. Wood, and M. Bownes Identification and Phylogenetic Analysis of Drosophila melanogaster Myosins Mol. Biol. Evol., July 1, 2002; 19(7): 1041 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Delbac, A. Sanger, E. M. Neuhaus, R. Stratmann, J. W. Ajioka, C. Toursel, A. Herm-Gotz, S. Tomavo, T. Soldati, and D. Soldati Toxoplasma gondii myosins B/C: one gene, two tails, two localizations, and a role in parasite division J. Cell Biol., November 12, 2001; 155(4): 613 - 624. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. P. Cramer Myosin VI: Roles for a Minus End-directed Actin Motor in Cells J. Cell Biol., September 18, 2000; 150(6): F121 - F126. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Biemesderfer, S. A. Mentone, M. Mooseker, and T. Hasson Expression of myosin VI within the early endocytic pathway in adult and developing proximal tubules Am J Physiol Renal Physiol, May 1, 2002; 282(5): F785 - F794. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||