![]() |
|
|
Vol. 10, Issue 4, 1147-1161, April 1999
Vienna Biocenter, Institute of Biochemistry and Molecular Cell Biology, University of Vienna and Ludwig Boltzmann-Forschungstelle für Biochemie, A-1030 Vienna, Austria
Submitted September 10, 1998; Accepted February 1, 1999| |
ABSTRACT |
|---|
|
|
|---|
Budding yeast adjusts to increases in external osmolarity via a specific mitogen-activated protein kinase signal pathway, the high-osmolarity glycerol response (HOG) pathway. Studies with a functional Hog1-green fluorescent protein (GFP) fusion reveal that even under nonstress conditions the mitogen-activated protein kinase Hog1 cycles between cytoplasmic and nuclear compartments. The basal distribution of the protein seems independent of its activator, Pbs2, and independent of its phosphorylation status. Upon osmotic challenge, the Hog1-GFP fusion becomes rapidly concentrated in the nucleus from which it is reexported after return to an iso-osmotic environment or after adaptation to high osmolarity. The preconditions and kinetics of increased nuclear localization correlate with those found for the dual phosphorylation of Hog1-GFP. The duration of Hog1 nuclear residence is modulated by the presence of the general stress activators Msn2 and Msn4. Reexport of Hog1 to the cytoplasm does not require de novo protein synthesis but depends on Hog1 kinase activity. Thus, at least three different mechanisms contribute to the intracellular distribution pattern of Hog1: phosphorylation-dependent nuclear accumulation, retention by nuclear targets, and a kinase-induced export.
| |
INTRODUCTION |
|---|
|
|
|---|
One of the key questions in signal transduction processes is
how signals are distributed to localized physiological targets. For
example, in the control of transcription by extracellular signals, it
is evident that one of the activated signal components or one of its
substrates has to travel from the cytoplasmic to the nuclear
compartment. This question has become a focus in studies on
mitogen-activated protein kinase (MAPK)1-dependent
signal pathways. These, among eukaryotes, highly conserved signaling
systems are organized in a core module composed of three sequentially
acting kinases, a MAPK kinase kinase, MAPK kinase (MAPKK or MEK), and
MAPK (Waskiewicz and Cooper, 1995
). The MAPK is activated by
phosphorylation of strictly conserved T and Y residues in the catalytic
domain of the kinase (T-E/G/P-Y motif), which enables the kinase to
phosphorylate a set of response-specific substrates (for review, see Su
and Karin, 1996
; Treisman, 1996
). Because some of the MAPK substrates
can be considered resident nuclear proteins, and because the MAPK
cascade is activated in the cytoplasm or at the plasma membrane, it has
been clear that at least one component of the signal pathway has to
move to the nucleus. Indeed, analysis of cellular localization of
higher eukaryote p42 and p44 MAPKs revealed that mitogenic stimulation
by serum or
-thrombin seemed to considerably enhance nuclear
transfer of both classical MAPK isoforms (Gonzalez et al.,
1993
; Lenormand et al., 1993
). Because this event could be
correlated with dual tyrosine and threonine phosphorylation (Chen
et al., 1992
), the existence of an import mechanism has been
proposed that depends on the activation of the pathway.
MAPKs do not contain classical import signals, so other nonconventional
and perhaps indirect mechanisms would have to be invoked to explain the
movements of the protein. Attempts to find out whether the dual
phosphorylation of the kinase was part of such an import signal yielded
partly conflicting results. For example, the behavior of
phosphorylation site mutants did not always support the notion that it
was an essential feature for the cytoplasmic-nuclear transfer
(Lenormand et al., 1993
). More recent evidence, however, seemed to resolve this question, suggesting that the modification of
the MAPK is indeed an important feature for determining the localization of the kinase (Khokhlatchev et al., 1998
).
These studies also opened the possibility that phosphorylation-induced dimerization constituted part of the nuclear import signal. Another line of investigations found that the activator of the MAPK, MEK, is
actively excluded from the nucleus by an inherent nuclear export signal
(NES) (Fukuda et al., 1996
). This led to the proposal that cytoplasmic anchorage of the uninduced MAPK by MEK could contribute to
the basal pattern of MAPK localization (Fukuda et al.,
1997
). Analogous to this situation, it has subsequently been proposed that nuclear accumulation might be based on a retention mechanism by
nuclear factors (Gaits et al., 1998
; Wilkinson and Millar, 1998
). This concept originated from studies with the stress-induced Schizosaccharomyces pombe MAPK StyI/Spc1, a homologue of the
mammalian stress kinase p38, but it has also gained some recent
support for the classical MAPKs (Lenormand et al., 1998
).
The work on the S. pombe kinase showed that nuclear
localization of the kinase can be observed after exposure to generic
stress conditions. However, the nuclear localization of StyI/Spc1
depends not only on the phosphorylation status of the kinase but also
on the presence of its target transcription factor, Atf1 (Gaits
et al., 1998
). These data gave the first hint that it may
not be just nuclear import that is regulated but the ability to find
and interact with appropriate substrates that serve as nuclear anchors.
Although budding yeast has been one of the classical model systems for
studying MAPK signaling (Herskowitz, 1995
), no major insights have yet
been gained with respect to MAPK localization. Although one study has
dealt with the localization of the filamentous growth and
mating-specific MAPK Kss1 (Ma et al., 1995
), no important regulatory features with regard to nuclear import were deduced at this
time. Another environmentally controlled MAPK pathway is the so-called
high-osmolarity glycerol response (HOG) system that allows yeast to
maintain osmotic homeostasis (Boguslawski, 1992
; Brewster et
al., 1993
). The MAPK Hog1 has been the prototype for the class of
kinases related to p38. In contrast to its fission yeast (Degols
et al., 1996
) or mammalian counterparts (Kyriakis and
Avruch, 1996
), the HOG pathway in budding yeast appears to be activated
exclusively by hyperosmotic stress (Schüller et al.,
1994
). Changes in external osmolarity are sensed by two transmembrane proteins that act independently but converge at the level of the MAPKK,
Pbs2 (Maeda et al., 1994
, 1995
). One of the branches uses a
phospho-relay mechanism to activate a redundant pair of MAPKKs, Ssk2
and Ssk22, that control dual phosphorylation of Hog1 via the Pbs2
kinase (Posas et al., 1996
; Posas and Saito 1998
). On the
other hand, a low basal activity level of Hog1 and the transience of
Hog1 activation seems to be assured by a set of MAPK-specific protein
phosphatases (Maeda et al., 1993
; Wurgler-Murphy et
al., 1997
).
Hog1 appears to coordinate the induction of a major part of the
Saccharomyces cerevisiae osmostress protection mechanisms, but its immediate substrates are still unknown. Cells that are suddenly
challenged by a hyperosmotic environment respond by the transient
induction of several genes, such as CTT1 or GPD1,
emphasizing that transcriptional control should play an important role
in a cell's short-term adjustment to osmostress (Albertyn et
al., 1994
; Schüller et al., 1994
). Two
redundantly acting transcription factors, Msn2 and Msn4, have been
identified that play a crucial role in this response (Martinez-Pastor
et al., 1996
). Although these factors are activated by
diverse stress situations, they also respond to osmotic instabilities
by being concentrated in nucleus (Görner et al.,
1998
). Hog1 has no control over the nuclear accumulation of these
factors in response to hyperosmotic conditions but appears to modulate
their efficiency as activators. In addition, factors other than Msn2
are able to mediate transcriptional responses to osmostress. Although
their nature still needs to be defined, it seems that they are not
members of the ATF family (Hohmann, 1997
).
In the present investigation we have concentrated on the question of whether Hog1 might be the factor that establishes the connection between the cyto-plasmic part of the signal pathway and its nuclear response system. To this effect we followed the intracellular localization of a functional Hog1-green fluorescent protein (GFP) fusion from nonstressed conditions through the acute stress phase until cells have become adapted. Our data emphasize that several transport and retention phenomena can be dissociated that depend on different cellular mechanisms: 1) continuous cycling between the cytoplasm and the nucleus, 2) phosphorylation-dependent nuclear accumulation, 3) nuclear retention, and 4) MAPK activity-dependent export during adaptation. Importantly, we show that all the associated changes in the nuclear-cytoplasmic equilibrium occur independently of de novo protein synthesis.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Strains and General Methods
The yeast strains used in this study are summarized in Table
1. They all have W303-1A genetic
background. The complete coding region of the PBS2 gene was
deleted with HIS3 by the microhomology PCR method
(Manivasakam et al., 1995
). Deletion was verified by PCR
analysis of chromosomal DNA using specific primers. General cloning
methods are described by Sambrook et al. (1989)
. Yeast media, growth conditions, and procedures were used as presented by Rose
et al. (1990)
.
|
Plasmids
Plasmids used in this study are summarized in Table 1. The
HOG1 coding region including the endogenous promoter was PCR
amplified from plasmid pVR50 (wild-type [WT] HOG1 gene in
vector YCp111) to introduce a NotI site at the very
C-terminus of the HOG1 ORF using universal primer and
oligonucleotide VR25(WH) (5'AAATGGATCCATTAGCGGCCGCTCTGTTGGAACTCAT TAGC) (BamHI and NotI sites underlined)
and cloned as a 1.8-kb HindIII-BamHI fragment
into YCp111 to produce plasmid pVR50-NotI. Hog1-GFP
(pVR65-WT) was generated by ligating an enhanced GFP NotI cassette (Görner et al., 1998
) into
the NotI site of plasmid pVR50-NotI.
Hog1T174A-GFP (pVR65-T/A), Hog1Y176F-GFP (pVR65-Y/F), and
Hog1K52R-GFP (pVR65-K/R) were constructed by replacing a 1.1-kb SalI-SalI fragment of pVR65-WT with the
corresponding fragments of the mutant genes described by Schüller
et al. (1994)
. Protein kinase A inhibitor NES (Wen et
al., 1995
) was inserted as an oligonucleotide adaptor
(CATGAATGAATTAGCCTTGAAATTAGCAGGTCTTGATATCAACAAGATGCATGC) into the
NcoI site within the N-terminal sequence of GFP of pVR65 generating Hog1-NES-GFP (pVR65-NES). The same NcoI site
was used to construct Hog1 fused to more than one GFP. An
NcoI fragment derived from the plasmid containing in-frame
fusion of two GFPs was introduced into the NcoI site of
Hog1-GFP resulting in plasmids containing Hog1 fusions with two or
three tandem repeats of GFP. Pbs2p-GFP was generated by cloning a
1.3-kb NheI-SphI fragment of pVR15 (a 2.9-kb
SpeI-SacI fragment containing the complete PBS2 coding region with endogenous promoter and terminator
sequence cloned into an XbaI-SacI digest of
YCp22) into phage vector M13mp18, isolation of single-stranded DNA, and
introduction of an XbaI site immediately in front of the
stop codon by in vitro mutagenesis using oligonucleotide
5'-TGGATATTAACGCTATCTAGATAAACCACCCATATG (XbaI
site underlined). The 0.9-kb Eco47III-SphI
fragment was cloned back into pVR15 to produce pVR15-XbaI.
The GFP coding region was amplified by PCR to introduce XbaI
sites at both ends and was cloned into the XbaI site of
pVR15-XbaI, generating a Pbs2p-GFP fusion (pVR15-GFP). A
multicopy version of this construct was produced by cloning of a 2.9-kb
SalI-SacI fragment of pVR15-GFP into
corresponding sites of plasmid YEp112 (pVR28). Pbs2pS514A and
Pbs2pT518A were constructed by overlapping PCR technique (Higuchi, 1990
) using oligonucleotide VR12
(5'-GGTGTTTCTGGTAATTTGGTGGCAGCACTGGCCAAGGCAAATATTGGTTGTCG) and its
complement VR13. Pbs2pK389 M (pVR15K/M) was prepared by replacing a
2.2-kb ClaI-SacI fragment of pVR15 with the
corresponding fragment of pPBM23 (a kind gift from H. Saito, Harvard
Medical School, Boston, MA).
Fluorescence Microscopy
Cells were grown to logarithmic phase (OD600 ~ 0.8-1.0) in synthetic complete medium omitting components used as selective markers. DAPI (final concentration, 2 µg/ml) was added as DNA dye 15 min before microscopy. The proportion of cells with nuclear signal accumulation was determined by counting cells with distinctly enhanced nuclear fluorescence. The number of cells with accumulated nuclear signal was expressed relative to the sum of cells counted showing fluorescence (total number of cells examined, >300) after growth under iso-osmotic conditions or after exposure to 0.4 M NaCl (if not indicated otherwise) for 5 min. For time course experiments cells were scored in a similar manner using the camera pictures of samples taken at the time points indicated. To examine the effects of inhibitors of protein synthesis on Hog1-GFP localization, cycloheximide (final concentration, 0.1 mg/ml) was added to the cultures 2 h before exposure to hyperosmotic stress. Living cells were viewed with a Zeiss (Thornwood, NY) Axioplan 2 fluorescence microscope, and images were scanned with a Quantix charge-coupled device camera (Photometrics, Tucson, AZ) using IPLab software (Signal Analytics, Vienna, VA). Pictures were assembled with Adobe (Mountain View, CA) Photoshop 4.0 software.
Protein Extract Preparation and Western Blot Analysis
Cells were grown in appropriate synthetic medium to OD600 ~ 0.8-1.0. When they were hyperosmotically stressed, NaCl (final concentration, 0.4 M) was added at room temperature for the period indicated. To prepare protein extracts, cultures were rapidly cooled down in ice water and harvested by centrifugation. Cells were suspended in ice-cold lysis buffer (0.1 M 2-[N-morpholino]ethanesulfonic acid, 10 mM EGTA, 1% DMSO, 1 mM DTT, pH 6.5) containing Complete protease inhibitor mix (Boehringer Mannheim, Mannheim, Germany) and phosphatase inhibitors (0.1 mM Na vanadate, 10 mM NaF). The cell pellet was then resuspended in ice-cold lysis buffer and vortexed with glass beads three times for 5 min each. Samples were centrifuged at 14,000 rpm two times for 10 min each. All operations were performed at 4°C. Protein concentration was determined in the supernatants by using a Bio-Rad (Hercules, CA) protein assay kit before they were frozen in liquid nitrogen. Extracts (100 µl) were boiled with 50 µl of 4× sample buffer (0.12 M Tris, 20% [vol/vol] glycerol, 0.286 M 2-mercaptoethanol, 0.086 mM bromphenol blue, 5% SDS, pH 6.8) for 3 min. Samples were resolved by 10% SDS-PAGE (Bio-Rad Mini Protean) and transferred onto nitrocellulose membranes (Schleicher & Schüll, Keene, NH) in a SemiDry blotting apparatus (Bio-Rad). Phosphorylated Hog1-GFP was immunodetected by phospho-specific p38 MAPK (T180/Y182) antibody (New England Biolabs, Beverly, MA), and GFP protein was immunodetected with GFP polyclonal antibody (Clontech, Palo Alto, CA). Immunoblots were developed by using an HRP-conjugated protein ECL detection kit (Amersham, Arlington Heights, IL). Probes for immunodetection were removed by incubation in stripping buffer according to recommendations of the suppliers before applying another primary antibody to the same membrane.
| |
RESULTS |
|---|
|
|
|---|
Hog1-GFP and Pbs2-GFP Fusions Are Functional
In an attempt to investigate the intracellular location of the
Hog1 MAPK during different environmental conditions, we fused its gene
to sequences encoding a version of GFP. To verify that the fusion
protein has preserved the biological function of Hog1, we transformed a
hog1
strain with the gene and checked for viability under
hyperosmotic stress conditions (Figure
1A). Our results show that the
HOG1-GFP fusion gene just like a WT HOG1 gene
can complement the lethality of a hog1 null mutation under
persistant high-osmolarity conditions. We found that an antibody
specifically recognizing the phosphorylated form of mammalian p38/RK
MAPK also detects the activated form of Hog1 and Hog1-GFP (Figure 1C)
but not products containing a single amino acid substitution at the modification sites. Hog1-GFP is noticably modified only during the appropriate hyperosmotic stimulus when it is also mainly located in
the nucleus (see below). Thus, the GFP part of the fusion protein does
not seem to interfere with the activation and function of the kinase.
In fact, we were able to obtain Hog1 fusions with two or more tandem
repeats of GFP that on a physiological level behaved exactly like the
single GFP fusion (our unpublished results; also see Figure 5). In a
similar experiment we attached the GFP sequence to the C-terminal
coding region of PBS2, the gene encoding the direct
activator of Hog1. The PBS2-GFP fusion gene complemented as
well as the WT gene a pbs2 defect for growth on high salt
(Figure 1B). We conclude that in both cases GFP fluorescence provides a
valid marker for the intracellular localization of the kinases.
|
The Nuclear Concentration of a Hog1-GFP Fusion Increases Specifically upon Hyperosmotic Stress
The subcellular distribution of Hog1-GFP was first analyzed in a
hog1
strain (Figure 2).
Under standard growth conditions, Hog1-GFP appears uniformly
distributed throughout the cell (with the exception of the vacuole).
When stressed with hyperosmotic agents (0.4 M NaCl or 1 M sorbitol),
the signal rapidly changed, with GFP fluorescence now being
concentrated in nuclei (Figure 2A; our unpublished results). This
change in the localization pattern was observed in the vast majority
(>90%) of cells (Figure 2B). Unlike StyI/Spc1 in fission yeast and
p38/RK in higher eukaryotes, in the budding yeast the HOG pathway
appears to become activated exclusively by hyperosmotic stress; it is
not directly involved in transmission of any other stress signals
(Schüller et al., 1994
). To examine whether the
nuclear translocation of Hog1-GFP is controlled with the same
specificity, we examined its cellular distribution under heat stress
(37°C) after exposure to a weak organic acid (10 mM sorbic acid),
oxidative stress (0.4 mM H202), and adjustment
to 7% ethanol. None of these stress conditions induces the nuclear
accumulation of Hog1-GFP, even though the same conditions cause
nuclear translocation of the general stress activator Msn2
(Görner et al., 1998
). This observation is consistent with the interpretation that rapid nuclear import of Hog1-GFP is
limited to those occasions that normally activate the kinase, suggesting that Hog1-GFP nuclear accumulation is a HOG
pathway-mediated event.
|
Correlation between Phosphorylation and Nuclear Accumulation of Hog1-GFP
It has been noted before that the dual phosphorylation of Hog1
happens extremely fast after yeast cells are osmotically challenged. In
<1 min, the protein kinase seems to become quantitatively modified. The increase in phosphorylation, however, is transient and readjusts during adaptation to the low steady-state level observed before stress
(Brewster et al., 1993
; Maeda et al., 1995
). To
examine whether there is a correlation between Hog1 phosphorylation and nuclear accumulation, we quantified the kinetics of translocation by
counting cells with predominantly nuclear fluorescence. As shown in
Figure 2, the phosphorylation and activation profile of Hog1-GFP and
the enhanced nuclear signal clearly follow the same time-dependent
patterns: they both peak at 1 min, remain close to the maximum up to 15 min, and then slowly decline to reach a steady-state level within ~1
h after stress. This observation suggests that only the phosphorylated
form of Hog1 is able to accumulate in the nucleus and that Hog1's
activation might be a prerequisite for the apparently enhanced nuclear translocation.
To test this assumption we generated versions of Hog1-GFP that had an
amino acid substitution at one of the two the modification sites (T174A
or Y176F). It is well documented that the same or corresponding amino
acid residues are essential for the activity of Hog1 MAPK
(Schüller et al., 1994
) as well as for that of other MAPK family members (Gartner et al., 1992
; Robbins et
al., 1993
). This result also holds true for the Hog1-GFP fusions,
because the mutant constructs are unable to complement the high salt
sensitivity of the hog1 mutant (Figure 1A). The fluorescence
signals elicited by the T174A and the Y176F mutant show a mostly
cytoplasmic distribution even after osmotic challenge (Figure
3A; our unpublished results). The loss of
nuclear signal, however, is not just the consequence of a failure in
signal transmission and activation of a component of the transport
machinery, because the same result is obtained in a HOG-proficient
background (our unpublished results). Because Hog1 is activated via the
Pbs2 MAPKK, we assayed the nuclear signal of Hog1-GFP in different
pbs2 mutants. Deletion of the PBS2 gene severely
impaired nuclear accumulation (our unpublished results). Similar
results were obtained with a Pbs2-K389M substitution, which results in
a catalytically inactive kinase (Posas and Saito, 1997
), and with a
mutant that eliminates the activating phosphorylation sites S514 and
T518 (Wurgler-Murphy et al., 1997
) (Figure 3C).
|
We further asked whether the Hog1 kinase requires its own enzymatic
activity to experience the stress-related increase in nuclear
localization. The K52R substitution disables the protein in its
phospho-transfer function and thus produces a catalytically inactive
kinase. However, the mutation does not prevent phosphorylation by the
upstream kinase (Schüller et al., 1994
). Hog1-GFP
K52R is translocated to the nucleus as efficiently as WT protein after exposure of cells to hyperosmotic stress (Figure 3B; also see Figure
8A). This demonstrates that the intrinsic kinase activity of Hog1 is
dispensable for nuclear accumulation.
After showing that a functional signal pathway is necessary for Hog1
nuclear accumulation, we wanted to address the question of whether
activation of the kinase module is sufficient for this response or
whether other osmotically induced events are also required. For this
purpose we made use of a dominant activating allele of SSK2
that lacks the N-terminal regulatory domain. Expression of this
constitutive kinase is incompatible with the survival of WT cells, but
the lethality is suppressed in pbs2 or hog1
strains (Posas and Saito, 1997
). In our case we generated the
constitutive kinase from a galactose-regulated expression system.
Galactose itself did not increase the number of stained nuclei.
However, when the expression of Ssk2-
N was induced by addition of
galactose in the absence of hyperosmotic stress, ~80% of the cells
exhibited a noticeably stronger Hog1-GFP signal in the nucleus (Figure
3D). Although the number of cells with distinct nuclear fluorescence can be further increased upon hyperosmotic stress, this result implies
that induction of the kinase module is indeed sufficient for Hog1
nuclear accumulation.
Pbs2, a Protein Excluded from the Nucleus, Does Not Affect Basal Nuclear-Cytoplasmic Shuttling of Hog1 during Noninducing Conditions
To investigate whether Hog1 was the only component of the MAPK
cascade to appear in the nucleus, we examined the subcellular distribution of a Pbs2-GFP fusion. Microscopic examination showed that
the GFP fluorescence was distributed evenly over the cytoplasmic compartment. This distribution did not change after application of
high-osmolarity stress (Figure 4A).
Furthermore, the nuclear compartment appeared free of GFP signal; as in
the majority of cells the nuclear position could easily be
distinguished as a dark area against a light background, an observation
suggesting that Pbs2 may be actively excluded from nuclei. It has been
proposed before that MEKs might serve as a cytoplasmic anchor for MAPK, preventing the nuclear appearance of the MAPK under noninducing conditions. We have tried to evaluate such a model for Pbs2 and Hog1
using our observations obtained in the absence of stress. If one
approaches the Hog1-GFP localization data under this aspect, one finds
that under iso-osmotic conditions the signal appears unchanged between
a WT and pbs2
background (Figure 4B). It is also clear
that neither Hog1-GFP nor its phosphorylation site-defective variant
generates a nuclear exclusion signal comparable to that found with the
Pbs2 fusion (compare Figures 3A and 4). This basal distribution of
Hog1-GFP does not appear to be influenced by the size of the kinase.
Fusions that contain two or even three tandem repeats of the GFP moiety
(generating proteins of 105 and 135 kDa) show essentially the
same distribution pattern as Hog1-GFP (Figure
5A).
|
|
To test whether the observed differences between Hog1 and Pbs2 fusions are due to a technicality or whether they might reflect a substantial concentration of unphosphorylated Hog1-GFP in the nucleus, we inserted a generic NES between the Hog1 and the GFP sequence. Such a construct now elicited a pattern for Hog1 that was indistinguishable from the Pbs2-GFP pattern (Figure 4C). The Hog1-NES-GFP product is still physiologically intact, because it is able to rescue the osmotic sensitivity of a hog1 mutant. The fusion protein is also present at normal levels and appropriately phosphorylated after stress exposure, suggesting that the localization result is not due to secondary effects (our unpublished results). Together these experiments allow us to make three important conclusions. First, Hog1 probably cycles between the nucleus and the cytoplasm at all times. Second, the necessary transport steps in and out of the nucleus are independent of any phosphorylation events. Third, Pbs2's putative function as a cytoplasmic anchor is not important for the basal distribution of Hog1. It is more likely that this distribution is achieved because nuclear export of Hog1 provides a rate-limiting step within the nuclear-cytoplasmic cycle.
Stress-specific Transcription Factors Are Not Essential for Hog1 Nuclear Accumulation but Determine Duration of Hog1 Nuclear Residence
If cytoplasmic anchorage is not important for the intracellular
distribution of Hog1, do nuclear retention signals play a role? Studies
in S. pombe have suggested that a functional Atf transcription factor is essential for observing the nuclear
accumulation of the p38 homologue StyI/Spc1 (Gaits et al.,
1998
). These data have been interpreted to the effect that the
transcription factor serves as a nuclear anchor for the MAPK. Although
the situation is more complicated in S. cerevisiae, we
tested whether the general stress factors Msn2 and Msn4 influence the
localization of the Hog1 kinase. A defect in these two ATF-unrelated
factors greatly reduces the transcriptional induction of
CTT1 in response to osmotic stress (Martinez-Pastor et
al., 1996
). Also, Msn2 and Msn4 change their intracellular
distribution under such stress conditions, albeit independently of Hog1
(Görner et al., 1998
). The msn2 msn4 double
mutation did not cause a change in the basal distribution of Hog1-GFP
(Figure 4D) and did not influence the level of Hog1-GFP (Figure
6). Also, shortly after stress induction
most of the mutant cells did properly react by developing a distinct
nuclear Hog1-GFP signal (Figure 6; our unpublished results). These
results suggested either that Msn2 and Msn4 do not provide or establish
a retention signal or that nuclear retention is not as important as has
been implied by others. In such a case nuclear accumulation would be more a matter of changes in export-import efficiency after Hog1 becomes phosphorylated. However, when we investigated the phenomenon in
more detail, we discovered that Msn2 and Msn4 are not completely uninvolved. After the localization of the GFP signal over time one
could observe much faster fading of the nuclear signal in the mutants
than in the WT cells. Approximately 50% of the WT cells retained a
strong nuclear GFP signal up to 30 min after stress, whereas most
msn2 msn4 cells already had lost their signal during that
time span (Figure 6A). The more rapid loss of nuclear signal is
paralleled by an earlier loss in dual phosphorylation (Figure 6B). We
conclude that the nuclear fate of Hog1 is dependent on the integrity of
the transcriptional stress response system, possibly because it
provides or establishes nuclear anchorage for this kinase. The
phosphorylation data suggest that in this case nuclear anchorage might
protect Hog1 against the action of specific protein phosphatases.
|
Adaptation to Hyperosmotic Stress Correlates with Hog1-GFP Nuclear Export
As described above, Hog1-GFP quickly accumulates in the nuclear
compartment after hyperosmotic stress, a phenomenon that correlates well with the induction of kinase activation. In addition, when HOG
pathway activity declines, the number of cells with nuclear GFP also
decreases. Because the overall Hog1-GFP level remains constant under
these conditions (see Figure 2C), the bulk of nuclear Hog1-GFP may not
be degraded but reexported from the nucleus. It might even be ready to
reenter the nucleus when cells are challenged again by hyperosmotic
stress. To support this contention we asked whether protein synthesis
is required to observe environment-related Hog1-GFP translocation
events into and out of the nucleus. Cells expressing Hog1-GFP were
preincubated with cycloheximide (0.1 mg/ml) for 2 h (Figure
7A). No induction of catalase activity can be observed under these conditions, implying efficient inhibition of protein synthesis (Schüller et al., 1994
; our
unpublished results). After preincubation, cells were exposed to a
hyperosmotic environment (0.4 M NaCl). Cells accumulated Hog1-GFP in
their nuclei, although protein synthesis was inhibited (Figure 7B). After 60 min of incubation at increased osmolarity, Hog1-GFP had disappeared from the nuclei with normal kinetics (Figure 7C; our unpublished results). After a second raise in osmolarity (0.8 M NaCl),
Hog1-GFP quickly reaccumulated in nuclei (Figure 7D). Thus, de novo
protein synthesis is dispensable not only for the initial nuclear entry
of Hog1p-GFP but also for subsequent nuclear retention, nuclear
export, and nuclear reentry.
|
In a second experiment we used temporally limited exposure to
hyperosmotic conditions. Five minutes after challenge with 0.4 M NaCl
the cells were returned into the original medium. Although, as
expected, most cells exhibited a nuclear GFP signal after stress exposure, they redistributed the protein to the cytoplasm after return
to normalcy (Figure 8A). This export of
GFP was remarkably fast, because the nuclear compartment seemed to be
emptied of GFP well within 1 min, and it was not affected by the
relative molecular mass of the protein, because multiply
GFP-tagged Hog1 fusions (105 and 135 kDa, respectively) behaved in a
similar manner (Figure 5; our unpublished results). A Western analysis
with p38 antibodies revealed that at this time most of the protein was returned to its unphosphorylated state (Figure 8B). The temporal correlation of both phenomena suggests a tight causal relationship between the two events. Because the import of Hog1 does not require catalytically active protein (neither in cis nor in
trans), we followed the fate of the catalytically inactive
form under conditions that would normally support increased export of
Hog1. The Hog1-K52R-GFP was expressed both in a hog1 and a
WT background, and the protein was concentrated in the nucleus using
exposure to 0.4 M NaCl. The cells were then centrifuged and resuspended
in normal iso-osmotic medium. Under Hog1 kinase-deficient conditions
the GFP signal remained in the nucleus long after return to
iso-osmolarity (Figure 8A, center panels). In contrast, in a
HOG1 strain, the mutant protein was exported with similar
kinetics as the WT product (Figure 8A, right panels). A measurement of
the phosphorylation status showed that, in the first case,
Hog1-K52R-GFP remains phosphorylated over a considerable time frame,
whereas in the second case it becomes almost instantly dephosphorylated
(Figure 8B). We conclude that an active kinase has to be present to
promote rapid nuclear export and that a causal relationship might exist
between cytoplasmic redistribution and the dephosphorylation of the
kinase.
|
| |
DISCUSSION |
|---|
|
|
|---|
In the work described here we have developed a yeast system in
which the mechanisms required for cytoplasmic nuclear shuttling of a
MAPK could be studied. To our knowledge this system actually provides
one of the first instances in which such a kinase has been followed in
vivo under normal physiological conditions. It should be noted that
similar results using the same approach were recently reported from an
independent investigation (Ferrigno et al., 1998
). The key
to these and our studies was the finding that a Hog1-GFP fusion
correctly reflects the behavior of the normal kinase. The activation
and function of the fusion protein were indistinguishable from those of
its WT counterpart and thus provided an excellent cytological marker.
The system enabled us to closely follow the kinetics of
signal-dependent nuclear accumulation and redistribution. This seemed
particularly relevant because the system works with a surprisingly fast
reaction time, both during induction under hyperosmolarity as well as
during adaptive conditions. Our additional finding that phospho-peptide
antibodies developed against p38/RK recognize Hog1 enabled us to
correlate the double phosphorylation status with the intracellular
distribution of the protein. The finding that nuclear accumulation of a
MAPK requires the activating phosphorylation events is perhaps not so
surprising anymore. What this study offers, however, is undisputable evidence that phosphorylation of the protein is the key to its signal-induced nuclear accumulation.
In our opinion several additional insights could be gained from our
data, and their interpretation is summarized in the model presented in
Figure 9. First of all, it appears that
Hog1 undergoes continuous nuclear import and export even as
catalytically inactive kinase. We believe in such a cycle because the
fluorescence of the fusion protein is normally found throughout the
cell, including the nucleus. Its distribution is quite in contrast to
the signal generated by the activator of Hog1, Pbs2-GFP. Here the
nucleus can be clearly visually identified as a dark, unstained region. If a generic NES is added to the Hog1-GFP fusion, a similar pattern of
nuclear exclusion can be seen, suggesting that a more efficient export
will change the equilibrium distribution of the kinase. Comparing the
distribution pattern of WT Hog1 and several mutant versions of kinase
did not reveal a significant difference, suggesting that the basal
nuclear cytoplasmic equilibrium attained by import and export must
happen independently of either substrate binding or kinase activity. In
principle, the nuclear pore could perhaps accommodate proteins the size
of a MAPK and allow free passage in either direction (Ohno et
al., 1998
). However, the different Hog1-GFP fusions tested should
already fall well within the generally assumed size restrictions
imposed by the nuclear pore, which means that either Hog1-GFP assumes
a special conformation that allows diffusion-based exchange between the
two compartments or that Hog1 localization relies on a
carrier-dependent transport mechanism. MAPKs seem to lack generic
import and export sequences, which has raised the question of adaptive
factors that mediate between the kinase and the transport machineries.
So what might the adaptor for inactive Hog1 be? For classical mammalian
MAPKs it looks as if MEKs could provide a shuttling device at least for
part of the journey (Fukuda et al., 1997
; Jaaro et
al., 1997
). However, a pbs2
strain also exhibits the
normal pattern of Hog1-GFP distribution under noninducing conditions.
Hence, one can conclude that this protein acts neither as a cytoplasmic
anchor nor as a shuttling device. If Pbs2 had a cytoplasmic retention
or nuclear export role, then we might expect that even inactive
Hog1-GFP accumulates in the nucleus in pbs2
strains. If
Pbs2 were to enable the import of Hog1 not only by normal basal level
phosphorylation but also by functioning as a carrier, then we could
expect a nuclear exclusion signal of Hog1 in pbs2
strains. Neither result has been observed by us. In addition, our data
rule out that one of the known stress-mediating transcription factors,
Msn2, serves as an essential transport device. This was an intriguing
possibility, because Msn2 itself shuttles between the nucleus and the
cytoplasm. Although it has been speculated that MAPKs continuously
cycle between the two compartments in the absence of an external
stimulus, we believe that our experiments provide considerable evidence
that such a view has some basis in reality (Figure 9A). Whether the
kinase requires special factors for the transport remains to be
answered. It should be noted that Ferrigno et al. (1998)
recently reported that nmd5 mutants are defective in nuclear
accumulation of activated Hog1. However, it remains to be seen whether
the transport factor encoded by NMD5 interacts directly with
the kinase and whether an nmd5-related defect can be
extended to the distribution of the unmodified kinase.
|
If we take continuous shuttling of the MAPK for granted, what causes
the difference between the basal and phosphorylation-induced signals?
The large change in intracellular distribution can be explained by an
increase in import efficiency and a decrease in export efficiency or by
the induction of a nuclear retention mechanism (Figure 9B). Two
observations have been made that mainly support either one or the other
explanation. For the classical MAPK ERK2 it has been proposed that the
modified protein undergoes a conformational change that allows it to
dimerize. These dimers were characterized as constituting more
efficiently transported entities than the unmodified monomers
(Khokhlatchev et al., 1998
). Thus, the authors of this work
clearly favored an import control model. The p38 and Hog1 homologue of
S. pombe, StyI/Spc1, accumulates in the nucleus after a
rather generic stress exposure. It was found that the kinase was unable
to give a nuclear signal when a supposedly resident nuclear substrate
of the kinase was missing from the cells. Here, Gaits et al.
(1998)
championed the idea that the nuclear factor would provide an
anchor to retain the activated kinase in the nucleus. In the absence of
this anchor the kinase could not be concentrated and would be
reexported from the nucleus.
Our data shed light and expand on both ideas. First, one should remember that the appearance of a strong nuclear Hog1 signal is very fast, being completed on the order of <1 min. Second, the absence of a major stress-related transcription complex has no effect on how quickly the nuclear signal appears. We therefore feel that the kinase really must attain a state that makes it either a more efficient import cargo or a less efficient export cargo. For example, the modified kinase could more easily associate with its import carrier. It could also more easily dissociate from such a complex in the nuclear compartment and resist being incorporated into an export-competent complex. Whether this situation is due to a dimerization event, as proposed for ERKs, we cannot answer conclusively. One might, however, note that we were unable to find any evidence for such dimers. For example, coprecipitation experiments with differently sized Hog1 kinases were negative (Reiser, unpublished results). Also, similar to results obtained with StyI/Spc1 in S. pombe, the active Hog1 kinase clearly did not support the nuclear accumulation of unphosphorylatable kinase forms, suggesting that at least with this type of MAPK, dimers might not so easily form in vivo as in vitro to be a major source of regulation.
Even though nuclear retention may not have a role in the initial phase
of the response, it seems to be one important factor for the persistent
nuclear residence of the kinase, because mutants deficient in Msn2 and
Msn4 exhibit a lower half-life for the stress-induced nuclear signal.
Superficially, this observation seems to be more in line with the
S. pombe work, with the exception that in this case the
authors (Gaits et al., 1998
) reported a complete
loss of nuclear MAPK signal in the absence of the anchoring
transcription factor. This difference in results could be due to
different technical approaches, because the S. pombe work
was done with immunolocalization methods after fixation and by
measuring only a few time points separated by at least 10 min. So it
could be that an early and transient nuclear signal was missed under
such conditions. On the other hand, it is also possible that we have
missed the predominant nuclear retention factor, because the
physiological direct target of Hog1 remains still at large. In
principle, it could be just the concentration of nuclear substrates
that determines how long the kinase remains in the nucleus. The
concentration of these targets might decrease over time if they happen
to become modified and exported as a consequence of modification. For
example, the mammalian p38/RK target MAPK-activated protein
kinase II is reexported to the cytoplasm after a p38-dependent
phosphorylation event that uncovers a normally hidden NES (Engel
et al., 1998
). It is not unlikely that similar Hog1
substrates will be found in yeast (Figure 9C).
This finally brings up the question of how MAPKs get redistributed
during adaptation. Our data make quite clear that this is not a passive
event in reaction to the throttling of the initiating signal. Reexport
is clearly happening as a regulated event, and it can happen fast. The
export is independent of protein synthesis and allows Hog1 to reenter
another activation cycle, meaning the kinase could be dephosphorylated
and recruited into a Pbs2-dependent activation complex. Surprisingly,
the export-initiating event requires Hog1 activity, because the
catalytically inactive protein seems to linger in the nucleus much
longer than the active kinase. However, it is not intrinsic kinase
activity that is required for this action, because the export defect of
the mutant protein can be complemented in trans. Thus Hog1
must actively induce a process that makes it competent for export.
Because the export can happen so fast after return to iso-osmotic
conditions, this should rule out that the loss of the nuclear signal is
just the consequence of modification of putative retention factors. Our data rather suggest a close link between export and dephosphorylation of Hog1 (Figure 9C). Even if we are not yet in a position to
distinguish between cause and effect, it is possible that Hog1
activates nuclear phosphatases to allow recognition by the export
machinery. For example, the Hog1-specific phosphatase Ptp2 can indeed
be found predominantly in the nucleus (our unpublished results; Ota,
personal communication) and tightly associated with Hog1
(Wurgler-Murphy et al., 1997
). It might be noteworthy that
the localization of the phosphatase does not change upon stress
stimulation (our unpublished results). Regulated export, on the other
hand, may allow an efficient cytoplasmic system to rapidly cleanse the
kinase from phosphorylation. We can imagine future experiments to
settle this question.
| |
ACKNOWLEDGMENTS |
|---|
We thank H. Saito for providing plasmid constructs and I. Ota
for permission to cite unpublished work. We are grateful to C. Schüller for help with microscopy and for comments on the manuscript, G. Griffioen, Martin Piskacek, Leo
Valá
ek, M. Teige, and other members of the Ruis laboratory
for helpful discussions, and H. Nierlich for excellent technical
assistance. This work was supported by grants P12478 (to H.R.) and W001
(predoctoral fellowship to V.R.) of the Austrian Fonds zur
Förderung wissenschaftlicker Forschung.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: ga{at}abc.univie.ac.at.
| |
ABBREVIATIONS |
|---|
Abbreviations used: GFP, green fluorescent protein; HOG, high-osmolarity glycerol response; MAPK, mitogen-activated protein kinase; MAPKK or MEK, MAPK kinase; NES, nuclear export signal; WT, wild-type.
| |
REFERENCES |
|---|
|
|
|---|
homologs NMD5 and XPO1.
EMBO J.
17, 5606-5614[Medline].This article has been cited by other articles:
![]() |
T. R. Shock, J. Thompson, J. R. Yates III, and H. D. Madhani Hog1 Mitogen-Activated Protein Kinase (MAPK) Interrupts Signal Transduction between the Kss1 MAPK and the Tec1 Transcription Factor To Maintain Pathway Specificity Eukaryot. Cell, April 1, 2009; 8(4): 606 - 616. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Bahn Master and Commander in Fungal Pathogens: the Two-Component System and the HOG Signaling Pathway Eukaryot. Cell, December 1, 2008; 7(12): 2017 - 2036. [Full Text] [PDF] |
||||
![]() |
P. J. Westfall, J. C. Patterson, R. E. Chen, and J. Thorner Stress resistance and signal fidelity independent of nuclear MAPK function PNAS, August 26, 2008; 105(34): 12212 - 12217. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hersen, M. N. McClean, L. Mahadevan, and S. Ramanathan Signal processing by the HOG MAP kinase pathway PNAS, May 20, 2008; 105(20): 7165 - 7170. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Murakami, K. Tatebayashi, and H. Saito Two Adjacent Docking Sites in the Yeast Hog1 Mitogen-Activated Protein (MAP) Kinase Differentially Interact with the Pbs2 MAP Kinase Kinase and the Ptp2 Protein Tyrosine Phosphatase Mol. Cell. Biol., April 1, 2008; 28(7): 2481 - 2494. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Mettetal, D. Muzzey, C. Gomez-Uribe, and A. van Oudenaarden The Frequency Dependence of Osmo-Adaptation in Saccharomyces cerevisiae Science, January 25, 2008; 319(5862): 482 - 484. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Guha, P. Desai, and A. Vancura Plc1p Is Required for SAGA Recruitment and Derepression of Sko1p-regulated Genes Mol. Biol. Cell, July 1, 2007; 18(7): 2419 - 2428. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Wadskog, A. Forsmark, G. Rossi, C. Konopka, M. Oyen, M. Goksor, H. Ronne, P. Brennwald, and L. Adler The Yeast Tumor Suppressor Homologue Sro7p Is Required for Targeting of the Sodium Pumping ATPase to the Cell Surface Mol. Biol. Cell, December 1, 2006; 17(12): 4988 - 5003. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Thorsen, Y. Di, C. Tangemo, M. Morillas, D. Ahmadpour, C. Van der Does, A. Wagner, E. Johansson, J. Boman, F. Posas, et al. The MAPK Hog1p Modulates Fps1p-dependent Arsenite Uptake and Tolerance in Yeast Mol. Biol. Cell, October 1, 2006; 17(10): 4400 - 4410. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Marques, R. J. Rodrigues, A. C. de Magalhaes-Sant'Ana, and T. Goncalves Saccharomyces cerevisiae Hog1 Protein Phosphorylation upon Exposure to Bacterial Endotoxin J. Biol. Chem., August 25, 2006; 281(34): 24687 - 24694. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Westfall and J. Thorner Analysis of Mitogen-Activated Protein Kinase Signaling Specificity in Response to Hyperosmotic Stress: Use of an Analog-Sensitive HOG1 Allele. Eukaryot. Cell, August 1, 2006; 5(8): 1215 - 1228. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Hernandez-Lopez, F. Randez-Gil, and J. A. Prieto Hog1 Mitogen-Activated Protein Kinase Plays Conserved and Distinct Roles in the Osmotolerant Yeast Torulaspora delbrueckii. Eukaryot. Cell, August 1, 2006; 5(8): 1410 - 1419. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Reiser, K. E. D'Aquino, L.-S. Ee, and A. Amon The Stress-activated Mitogen-activated Protein Kinase Signaling Cascade Promotes Exit from Mitosis Mol. Biol. Cell, July 1, 2006; 17(7): 3136 - 3146. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Delgado-Jarana, S. Sousa, F. Gonzalez, M. Rey, and A. Llobell ThHog1 controls the hyperosmotic stress response in Trichoderma harzianum Microbiology, June 1, 2006; 152(6): 1687 - 1700. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Panadero, C. Pallotti, S. Rodriguez-Vargas, F. Randez-Gil, and J. A. Prieto A Downshift in Temperature Activates the High Osmolarity Glycerol (HOG) Pathway, Which Determines Freeze Tolerance in Saccharomyces cerevisiae J. Biol. Chem., February 24, 2006; 281(8): 4638 - 4645. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Proft, F. D. Gibbons, M. Copeland, F. P. Roth, and K. Struhl Genomewide Identification of Sko1 Target Promoters Reveals a Regulatory Network That Operates in Response to Osmotic Stress in Saccharomyces cerevisiae Eukaryot. Cell, August 1, 2005; 4(8): 1343 - 1352. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Bahn, K. Kojima, G. M. Cox, and J. Heitman Specialization of the HOG Pathway and Its Impact on Differentiation and Virulence of Cryptococcus neoformans Mol. Biol. Cell, May 1, 2005; 16(5): 2285 - 2300. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Maeta, S. Izawa, and Y. Inoue Methylglyoxal, a Metabolite Derived from Glycolysis, Functions as a Signal Initiator of the High Osmolarity Glycerol-Mitogen-activated Protein Kinase Cascade and Calcineurin/Crz1-mediated Pathway in Saccharomyces cerevisiae J. Biol. Chem., January 7, 2005; 280(1): 253 - 260. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Bruno, F. Tenjo, L. Li, J. E. Hamer, and J.-R. Xu Cellular Localization and Role of Kinase Activity of PMK1 in Magnaporthe grisea Eukaryot. Cell, December 1, 2004; 3(6): 1525 - 1532. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M.-Y. Lu, R. J. Deschenes, and J. S. Fassler Role for the Ran Binding Protein, Mog1p, in Saccharomyces cerevisiae SLN1-SKN7 Signal Transduction Eukaryot. Cell, December 1, 2004; 3(6): 1544 - 1556. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sheikh-Hamad and M. C. Gustin MAP kinases and the adaptive response to hypertonicity: functional preservation from yeast to mammals Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1102 - F1110. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Edmunds and L. C. Mahadevan MAP kinases as structural adaptors and enzymatic activators in transcription complexes J. Cell Sci., September 1, 2004; 117(17): 3715 - 3723. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Saito and K. Tatebayashi Regulation of the Osmoregulatory HOG MAPK Cascade in Yeast J. Biochem., September 1, 2004; 136(3): 267 - 272. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Smith, S. Nicholls, B. A. Morgan, A. J.P. Brown, and J. Quinn A Conserved Stress-activated Protein Kinase Regulates a Core Stress Response in the Human Pathogen Candida albicans Mol. Biol. Cell, September 1, 2004; 15(9): 4179 - 4190. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Betz, G. Schlenstedt, and S. M. Bailer Asr1p, a Novel Yeast Ring/PHD Finger Protein, Signals Alcohol Stress to the Nucleus J. Biol. Chem., July 2, 2004; 279(27): 28174 - 28181. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wolfger, Y. M. Mamnun, and K. Kuchler The Yeast Pdr15p ATP-binding Cassette (ABC) Protein Is a General Stress Response Factor Implicated in Cellular Detoxification J. Biol. Chem., March 19, 2004; 279(12): 11593 - 11599. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. O'Rourke and I. Herskowitz Unique and Redundant Roles for HOG MAPK Pathway Components as Revealed by Whole-Genome Expression Analysis Mol. Biol. Cell, February 1, 2004; 15(2): 532 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M.-Y. Lu, R. J. Deschenes, and J. S. Fassler Saccharomyces cerevisiae Histidine Phosphotransferase Ypd1p Shuttles between the Nucleus and Cytoplasm for SLN1-Dependent Phosphorylation of Ssk1p and Skn7p Eukaryot. Cell, December 1, 2003; 2(6): 1304 - 1314. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Rodriguez-Hernandez, I. Sanchez-Perez, R. Gil-Mascarell, A. Rodriguez-Afonso, A. Torres, R. Perona, and J. R. Murguia The Immunosuppressant FK506 Uncovers a Positive Regulatory Cross-talk between the Hog1p and Gcn2p Pathways J. Biol. Chem., September 5, 2003; 278(36): 33887 - 33895. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Reiser, D. C. Raitt, and H. Saito Yeast osmosensor Sln1 and plant cytokinin receptor Cre1 respond to changes in turgor pressure J. Cell Biol., June 23, 2003; 161(6): 1035 - 1040. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Blackwell, I. M. Halatek, H.-J. N. Kim, A. T. Ellicott, A. A. Obukhov, and D. E. Stone Effect of the Pheromone-Responsive G{alpha} and Phosphatase Proteins of Saccharomyces cerevisiae on the Subcellular Localization of the Fus3 Mitogen-Activated Protein Kinase Mol. Cell. Biol., February 15, 2003; 23(4): 1135 - 1150. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Young, J. Mapes, J. Hanneman, S. Al-Zarban, and I. Ota Role of Ptc2 Type 2C Ser/Thr Phosphatase in Yeast High-Osmolarity Glycerol Pathway Inactivation Eukaryot. Cell, December 1, 2002; 1(6): 1032 - 1040. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. O'Rourke and I. Herskowitz A Third Osmosensing Branch in Saccharomyces cerevisiae Requires the Msb2 Protein and Functions in Parallel with the Sho1 Branch Mol. Cell. Biol., July 1, 2002; 22(13): 4739 - 4749. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hohmann Osmotic Stress Signaling and Osmoadaptation in Yeasts Microbiol. Mol. Biol. Rev., June 1, 2002; 66(2): 300 - 372. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nanduri and A. M. Tartakoff Perturbation of the Nucleus: A Novel Hog1p-independent, Pkc1p-dependent Consequence of Hypertonic Shock in Yeast Mol. Biol. Cell, June 1, 2001; 12(6): 1835 - 1841. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Teige, E. Scheikl, V. Reiser, H. Ruis, and G. Ammerer Rck2, a member of the calmodulin-protein kinase family, links protein synthesis to high osmolarity MAP kinase signaling in budding yeast PNAS, May 8, 2001; 98(10): 5625 - 5630. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pascual-Ahuir, R. Serrano, and M. Proft The Sko1p Repressor and Gcn4p Activator Antagonistically Modulate Stress-Regulated Transcription in Saccharomyces cerevisiae Mol. Cell. Biol., January 1, 2001; 21(1): 16 - 25. [Abstract] [Full Text] |
||||
![]() |
M. R. Alexander, M. Tyers, M. Perret, B. M. Craig, K. S. Fang, and M. C. Gustin Regulation of Cell Cycle Progression by Swe1p and Hog1p Following Hypertonic Stress Mol. Biol. Cell, January 1, 2001; 12(1): 53 - 62. [Abstract] [Full Text] |
||||
![]() |
C. P. Mattison and I. M. Ota Two protein tyrosine phosphatases, Ptp2 and Ptp3, modulate the subcellular localization of the Hog1 MAP kinase in yeast Genes & Dev., May 15, 2000; 14(10): 1229 - 1235. [Abstract] [Full Text] |
||||
![]() |
M. Rep, M. Krantz, J. M. Thevelein, and S. Hohmann The Transcriptional Response of Saccharomyces cerevisiae to Osmotic Shock. Hot1p AND Msn2p/Msn4p ARE REQUIRED FOR THE INDUCTION OF SUBSETS OF HIGH OSMOLARITY GLYCEROL PATHWAY-DEPENDENT GENES J. Biol. Chem., March 17, 2000; 275(12): 8290 - 8300. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Martin, J. M. Rodriguez-Pachon, C. Ruiz, C. Nombela, and M. Molina Regulatory Mechanisms for Modulation of Signaling through the Cell Integrity Slt2-mediated Pathway in Saccharomyces cerevisiae J. Biol. Chem., January 14, 2000; 275(2): 1511 - 1519. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nanduri, S. Mitra, C. Andrei, Y. Liu, Y. Yu, M. Hitomi, and A. M. Tartakoff An Unexpected Link between the Secretory Path and the Organization of the Nucleus J. Biol. Chem., November 19, 1999; 274(47): 33785 - 33789. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rep, V. Reiser, U. Gartner, J. M. Thevelein, S. Hohmann, G. Ammerer, and H. Ruis Osmotic Stress-Induced Gene Expression in Saccharomyces cerevisiae Requires Msn1p and the Novel Nuclear Factor Hot1p Mol. Cell. Biol., August 1, 1999; 19(8): 5474 - 5485. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. H. Cox, R. Rai, M. Distler, J. R. Daugherty, J. A. Coffman, and T. G. Cooper Saccharomyces cerevisiae GATA Sequences Function as TATA Elements during Nitrogen Catabolite Repression and When Gln3p Is Excluded from the Nucleus by Overproduction of Ure2p J. Biol. Chem., June 2, 2000; 275(23): 17611 - 17618. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bell, R. Capone, I. Pashtan, A. Levitzki, and D. Engelberg Isolation of Hyperactive Mutants of the MAPK p38/Hog1 That Are Independent of MAPK Kinase Activation J. Biol. Chem., June 29, 2001; 276(27): 25351 - 25358. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Cyert Regulation of Nuclear Localization during Signaling J. Biol. Chem., June 8, 2001; 276(24): 20805 - 20808. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||