![]() |
|
|
Vol. 10, Issue 5, 1381-1394, May 1999

and
*Instituto de Investigaciones Bioquímicas Fundación
Campomar, 1405 Buenos Aires, Argentina; and
Instituto de
Investigaciones Biotecnológicas, Universidad Nacional de General
San Martín, 1650 Provincia de Buenos Aires, Argentina
| |
ABSTRACT |
|---|
|
|
|---|
Trypanosoma cruzi is a protozoan parasite that
belongs to an early branch in evolution. Although it lacks several
features of the pathway of protein N-glycosylation and
oligosaccharide processing present in the endoplasmic reticulum of
higher eukaryotes, it displays UDP-Glc:glycoprotein glucosyltransferase
and glucosidase II activities. It is herewith reported that this
protozoan also expresses a calreticulin-like molecule, the third
component of the quality control of glycoprotein folding. No
calnexin-encoding gene was detected. Recombinant T.
cruzi calreticulin specifically recognized free
monoglucosylated high-mannose-type oligosaccharides. Addition of
anti-calreticulin serum to extracts obtained from cells pulse-chased
with [35S]Met plus [35S]Cys
immunoprecipitated two proteins that were identified as calreticulin
and the lysosomal proteinase cruzipain (a major soluble glycoprotein).
The latter but not the former protein disappeared from
immunoprecipitates upon chasing cells. Contrary to what happens in
mammalian cells, addition of the glucosidase II inhibitor
1-deoxynojirimycin promoted calreticulin-cruzipain interaction. This
result is consistent with the known pathway of protein
N-glycosylation and oligosaccharide processing occurring
in T. cruzi. A treatment of the calreticulin-cruzipain complexes with endo-
-N-acetylglucosaminidase H either
before or after addition of anti-calreticulin serum completely
disrupted calreticulin-cruzipain interaction. In addition, mature
monoglucosylated but not unglucosylated cruzipain isolated from
lysosomes was found to interact with recombinant calreticulin. It was
concluded that the quality control of glycoprotein folding appeared
early in evolution, and that T. cruzi calreticulin binds
monoglucosylated oligosaccharides but not the protein moiety of
cruzipain. Furthermore, evidence is presented indicating that
glucosyltransferase glucosylated cruzipain at its last folding stages.
| |
INTRODUCTION |
|---|
|
|
|---|
N-Glycoproteins are first glycosylated upon transfer of
an oligosaccharide (Glc3Man9GlcNAc2
in most cells, see below) from a dolichol-P-P derivative to Asn
residues in the lumen of the endoplasmic reticulum (ER). Protein-linked
oligosaccharides are then processed in the same subcellular location by
glucosidase I (GI), which removes the more external glucose unit, and
glucosidase II (GII), which excises the two remaining glucoses.
Specific mannosidases may remove up to two mannose units in the
mammalian cell ER (Kornfeld and Kornfeld, 1985
). An additional ER
processing reaction is that catalyzed by the UDP-Glc:glycoprotein
glucosyltransferase (GT). This enzyme adds a single glucose unit to
glucose-free, high-mannose-type oligosaccharides in glycoproteins not
displaying their properly folded tertiary structures. GT behaves,
therefore, as a sensor of glycoprotein conformations (Parodi et
al., 1983b
; Sousa et al., 1992
). GII deglucosylates not
only the monoglucosylated oligosaccharides generated by partial
deglucosylation of the transferred oligosaccharides but also those
formed by GT, because they have identical structures (Trombetta
et al., 1989
).
Glycoproteins acquire their proper tertiary structure in the ER. This
process requires participation of chaperones and other folding-assisting proteins. Glycoproteins that fail to properly fold are retained in the ER and further transported to the cytosol where they are degraded in the proteasomes. On the other hand, properly
folded species may continue their transit through the secretory pathway
to their final destinations. Two unconventional chaperones (calnexin
and calreticulin), which recognize monoglucosylated high-mannose-type
oligosaccharides, have been described in the ER lumen of mammalian
cells (for review, see Helenius et al., 1997
).
Membrane-bound calnexin and soluble calreticulin display a 35%
similarity in their amino acid sequence. It has been shown that
interaction of calnexin and calreticulin with monoglucosylated glycoproteins generated either by partial deglucosylation of the transferred oligosaccharide or by reglucosylation of glucose-free compounds by GT facilitates glycoprotein folding in mammalian cells by
preventing aggregation and suppressing formation of nonnative disulfide
bonds (Hebert et al., 1996
). Moreover, the above-mentioned interaction provides one of the mechanisms by which cells retain misfolded glycoproteins in the ER (Zhang et al., 1997
). The
calnexin and calreticulin interaction with monoglucosylated
glycoproteins has been considered, therefore, a quality control of
glycoprotein folding. Although the bulk of evidence supporting the
model of quality control as proposed comes from experiments performed
with mammalian cell systems, indirect evidence indicates that the same features of the model occur in the yeast Schizosaccharomyces
pombe and in plants (Parodi et al., 1984
; Trombetta
et al., 1989
; Fernández et al., 1994
, 1996
;
Jannatipour and Rokeach, 1995
; Parlati et al., 1995
;
Lupattelli et al., 1997
).
There is a controversy on whether calnexin and calreticulin behave as
lectins that exclusively recognize the above-mentioned oligosaccharides
or whether, alternatively, such recognition is the first and necessary
step for an interaction between misfolded glycoprotein protein moieties
and calnexin and calreticulin. According to this last interpretation,
once the protein-protein interaction is established, recognition of
monoglucosylated oligosaccharides would be irrelevant for the stability
of the complex. Liberation of glycoproteins from the complex would
result from a conformational change in the substrate polypeptides. On
the other hand, according to the first interpretation release of
glycoproteins from the complex would exclusively occur through the
action of GII. In both cases, properly folded species would not be able
to be reglucosylated by GT, and thus no further interaction with
calnexin and calreticulin would occur (Helenius et al.,
1997
). Evidence supporting both models has certain drawbacks that will
be discussed further below.
Trypanosomatid protozoa are microorganisms that according to most
commonly used criteria (rRNA and several protein sequences) belong to a
an early branch of evolution (Baldauf and Palmer, 1993
; Solgin, 1997
).
From an evolutionary point of view they are much more distant from
mammals than fungi. Several features of the pathway leading to the
formation of N-glycoproteins in trypanosomatids reveal
significant differences with those present in mammalian cells: 1) the
dolichol moiety has, in trypanosomatid protozoa, 11 or 12 isoprene
residues, the same as polyprenols involved in bacterial cell wall
synthesis (Parodi and Quesada-Allué, 1982
; Quesada-Allué
and Parodi, 1983
; Low et al., 1991
); trypanosomatid dolichols are, therefore, significantly shorter than those found in
fungal and mammalian cells (16-18 and 19-21 isoprenes, respectively); 2) trypanosomatid protozoa are the only wild-type eukaryotic cells known so far to be unable to synthesize dolichol-P-Glc (de la Canal and
Parodi, 1987
); 3) Man6GlcNAc2,
Man7GlcNAc2, or
Man9GlcNAc2 (depending on the species), instead
of Glc3Man9GlcNAc2, is transferred in vivo in trypanosomatid cells (Parodi et al., 1981
; Parodi
and Quesada-Allué, 1982
; Mendelzon et al., 1986
); and
4) the oligosaccharyltransferase from trypanosomatids
transfers, in cell-free assays, Man6-9GlcNAc2 and Glc1-3Man9GlcNAc2 at the same
rate (Bosch et al., 1988
). Its specificity significantly
varies from the fungal and mammalian enzymes that transfer the
triglucosylated compound 10- to 25-fold faster than the other
oligosaccharides. GT and GII activities have been detected both in
intact trypanosomatid cells and in cell-free assays (Parodi et
al., 1983a
; Bosch et al., 1988
; Trombetta et
al., 1989
). As expected, no GI activity was found. This result is
consistent with the fact that no triglucosylated compounds occur in
these parasites. Glycosylation and oligosaccharide-processing reactions
occurring in the ER of mammalian and Trypanosoma cruzi (the
causative agent of Chagas' disease) cells are depicted in Figure
1. It is worth stressing the fact that in
this parasite, the same as in all other trypanosomatids,
monoglucosylated compounds are exclusively formed through GT-dependent
glucosylation.
|
Results presented here show that the quality control of glycoprotein folding appeared early in evolution, before completion of the pathway of protein N-glycosylation and oligosaccharide processing occurring in the ER of higher eukaryotes. Moreover, evidence is presented showing that calreticulin exclusively behaves as a lectin in trypanosomatid protozoa.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cells and Culture Media
T. cruzi Tulahuen 2 epimastigotes were grown as
described before (Cazzulo et al., 1985
). Escherichia
coli NovaBlue (Novagen, Madison, WI) was used for cloning
experiments. E. coli strain Y1090 (Stratagene, La Jolla, CA)
was used for screening the T. cruzi genomic library
constructed in
gt11 phages. For expression of the recombinant
protein the strain was E. coli BL26 (DE3; Novagen). Bacteria
were grown in Luria-Bertani medium, 0.5% NaCl, 1% tryptone (Difco, Detroit, MI), 0.5% yeast extract (Difco), and 100 µg/ml ampicillin if necessary or in the same medium supplemented with 0.2%
maltose and 10 mM MgSO4.
Other Procedures
Extraction of RNA and Northern blots were performed as described
before (Ausubel et al., 1994
). mRNA was purified through an
oligo-dT-cellulose column. Western blots were carried out as described
previously (Sambrook et al., 1989
). T. cruzi
genomic DNA was prepared as already described (Borst et al.,
1980
). The T. cruzi genomic DNA library in phage
gt11 was
that described before (Ibáñez et al.,
1987
). Subcellular fractionation was performed as described previously
(Bontempi et al., 1989
).
PCR Reactions
Standard procedures were used for PCR. Primers used for synthesis of the 250-, 320-, and 375-bp fragments were ATHATGTTYGGNCCNGAYAARTG (sense) and TCCCARTCYTCNGGYTT (antisense). For synthesis of the entire calreticulin-encoding gene the primers were CATGCCCATGGGCATGCGTGCAGCAATTTTTTTCTGTGCAC (sense) and TAGTCCTCGAGCAAATCCTCCTTATCAC (antisense).
Cloning and Sequencing of the T. cruzi Calreticulin-encoding Gene
Degenerate oligonucleotides (see above) were designed according
to conserved sequences of calnexins and calreticulins from different
species (Jannatipour and Rokeach, 1995
; Parlati et al., 1995
). PCR reactions that used those primers and T. cruzi
genomic DNA as template yielded fragments having ~250, 320, and 375 bp. Both larger fragments were cloned and sequenced. Two 320-bp
fragments from independent clones gave identical sequences. A single
375-bp cloned fragment was sequenced and found to contain the 320-bp fragment. The 250-bp fragment was not sequenced. The 375-bp fragment was used as probe for screening a genomic DNA library in
gt11. A
phage containing a 3200-bp insert was thus isolated. The insert was
cloned in the EcoRI of pBluescript vector
(Stratagene) and sequenced. It contained the 320- and 375-bp
fragments and the entire gene as well. The T. cruzi
calreticulin-encoding gene GenBank accession number is AF107115.
Expression of Calreticulin
The entire calreticulin-encoding gene was synthesized by PCR amplification using primers indicated above that are complementary to the 5' and 3' termini and introduce NcoI and XhoI restriction sites, Pfu DNA polymerase (Stratagene), and the pBluescript vector that contained the entire gene as template. The fragment synthesized, previously treated with NcoI and XhoI, was ligated to pET22B+ (Novagen), also treated with the same enzymes. The resulting plasmid was amplified in E. coli NovaBlue and used for expressing calreticulin in BL26 (DE3) E. coli cells. Synthesis of calreticulin (a 46.7-kDa protein) after isopropylthiogalactoside induction of ampicillin-resistant cells was monitored by breaking cells by lysozyme treatment (100 µg/ml), followed by centrifugation at 12,000 × g for 5 min. Supernatant and precipitate fractions were submitted to 10% SDS-PAGE. Calreticulin was found in inclusion bodies.
Purification and Renaturation of Calreticulin
Cells from a 20-ml culture were resuspended in 20 mM Tris-HCl buffer, pH 7.9, 1 mM PMSF (Sigma, St. Louis, MO), 1% Triton X-100, 20 µg/ml DNase, 10 mM MgCl2, and lysozyme (Sigma, 100 µg/ml) and centrifuged. The pellet was resuspended in 4 ml of binding buffer (20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, and 5 mM imidazole). The suspension was centrifuged, and the supernatant was discarded. The pellet was resuspended in binding buffer containing 6 M urea. After 1 h at 0°C, the suspension was centrifuged for 40 min at 19,000 × g. The supernatant was submitted to Ni2+ affinity chromatography using 2.5 ml of an iminodiacetic acid-agarose column (Sigma) equilibrated with 6 M urea in binding buffer. The column was washed three times with 2 vol of washing buffer (20 mM Tris-HCl buffer, pH 7.9, and 6 M urea) containing increasing imidazole concentrations (10, 15, and 20 mM) in each washing. Calreticulin was eluted with 6 vol of 300 mM imidazole, 0.25 M NaCl, 10 mM Tris-HCl buffer, pH 7.9, and 6 M urea and successively dialyzed for 12 h at 4°C each time against 10 mM Tris-HCl buffer, pH 7.9, and 10 mM CaCl2 containing 4 or 2 M or no urea. This preparation was used for biochemical assays and for generating antibodies because it was homogeneous, as revealed by 10% SDS-PAGE stained with Coomassie Brilliant Blue.
Oligosaccharide Binding to Calreticulin
[14C]Glc1-3Man9GlcNAc2
and [14C]Man9GlcNAc2 were
obtained upon mild acid hydrolysis of dolichol-P-P-oligosaccharides
isolated from hen oviduct slices incubated with
[14C]glucose (250 Ci/mol; New England Nuclear, Boston,
MA) for 3 h, as described before (Parodi et al., 1981
).
Oligosaccharide binding to calreticulin was performed as previously
described (Ware et al., 1995
) with slight modifications: 20 µg of hexahistidine-tagged calreticulin was mixed with 40 µl of
Ni2+-iminodiacetic acid-agarose in binding buffer (10 mM
Tris-HCl buffer, pH 7.6, 100 mM NaCl, and 10 mM CaCl2) and
2000 cpm of above-mentioned oligosaccharides in 100 µl of binding
buffer. The mixture was incubated in an orbital shaker at room
temperature for 1 h, after which the sample was centrifuged for 1 min at 2600 × g. The supernatant was collected, and
the beads were washed with 100 µl of binding buffer and centrifuged
as above. The supernatant was discarded. The agarose beads were then
incubated for 1 h with 100 µl of binding buffer containing 10 mM
-methylglucoside plus 10 mM
-methylmannoside and centrifuged. The
supernatant was collected. All samples were desalted with a Dowex 50 W
(H+ form) resin (Dow Chemical, Midland, MI), freeze dried,
and spotted on Whatman (Clifton, NJ) 1 papers. Chromatographies were
developed with 1-propanol:nitromethane:water (5:2:4).
Generation of Anti-Calreticulin Serum
Calreticulin purified as described above (200 µg) was
intradermically injected to a rabbit together with complete Freund's adjuvant. Two successive subcutaneous injections of 200 µg of calreticulin in incomplete adjuvant were performed with 15-d intervals. The animal was bled 15 d after the last booster. The serum was preadsorbed with a crude E. coli BL26 (DE3) extract as
already described (Sambrook et al., 1989
).
Pulse-Chase Labeling of T. cruzi Cells
Cells in the exponential phase (4.0 × 107
cells/ml) were harvested, and 2.5 g of them were washed twice with
Ham's F-12 (Met, Pro, and Gly free; Biochrom KG, Berlin, Germany)
medium (10.65 mg/ml) supplemented with 34.5 mg/l of Pro, 7.5 mg/l of
Gly, and 1.2 g/l of NaHC03. The parasites were resuspended
in 9 ml of the above-mentioned medium. The suspension was divided in
halves. 1-Deoxynojirimycin (DNJ, Sigma) was added to one of them up to a 6 mM final concentration. Both halves were preincubated for 20 min at
28°C. [35S]Met plus [35S]Cys (2 mCi,
>1000 Ci/mmol; EasyTag protein labeling mix, New England Nuclear) were
added, and both halves were then incubated for 2 min at 28°C. The
suspensions were submitted to low-speed centrifugations, and the
pellets were washed with 6 ml of T. cruzi normal growth
medium supplemented with 3 mM Met plus 3 mM Cys. DNJ (6 mM) was added
to the medium used for washing cells previously incubated with the
drug. Pellets were resuspended in 6 ml of the respective washing media,
and 1-ml aliquots were withdrawn after 0, 5, 10, 30, 60, and 120 min at
28°C. The suspensions were centrifuged, and the pellets were lysed in
1 ml of buffer A (50 mM HEPES buffer, pH 7.5, 0.2 M NaCl, and 1%
Nonidet P-40) containing 0.3 M iodoacetamide, 1 mM PMSF, and 100 µM
trans-epoxysuccinyl-1-leucylamido(4-guanidino)butane (E-64,
Sigma; this compound irreversibly inhibits cruzipain proteinase activity). After 1 h at 0°C, cell lysates were precleared by
centrifugation. Where indicated 10 mU of
endo-
-N-acetylglucosaminidase H (Endo H, Sigma) per 200 µl of solution were added. The supernatants were then maintained for
1 h at 28°C and submitted to immunoprecipitation.
Immunoprecipitations
For nondenaturing conditions, supernatants (200 µl) were
incubated with 1:50 diluted anti-calreticulin serum for 2 h at
4°C in a shaker incubator. Protein A-Sepharose (40 µl, Sigma) was added, and the suspensions were further incubated overnight. Beads were
then twice washed with 400 µl of buffer A. Where indicated 10 mU of
Endo H/200 µl of suspension were added. The suspensions were then
maintained for 1 h at 28°C; the beads washed twice with 200 µl
of buffer A, resuspended in cracking buffer, and submitted to 10%
SDS-PAGE. For denaturing conditions, SDS (0.5% final concentration) was added to supernatants (200 µl). Solutions were first heated at
95°C for 5 min and then diluted twofold with buffer A. Immunoprecipitations were further performed as above. Sequential
immunoprecipitations were first performed under nondenaturing
conditions, and washed protein A-Sepharose beads were resuspended in 50 µl of buffer A containing 0.5% SDS and heated for 5 min at 95°C.
Suspensions were threefold diluted with buffer A, and supernatants
obtained upon centrifugation were submitted to immunoprecipitation with anti-cruzipain serum (Campetella et al., 1990
).
Isolation of Labeled Mature Cruzipain
T. cruzi cells were harvested and labeled as above,
but labeling was prolonged for 20 min and performed in the presence and absence of 6 mM DNJ. Cells were then chased for 450 min, also in
the presence and absence of the drug, and mature cruzipain was isolated
from lysosomes as already described (Labriola et al., 1995
).
Cruzipain was purified up to the concanavalin A affinity chromatography step.
| |
RESULTS |
|---|
|
|
|---|
Cloning and Sequencing of T. cruzi Calreticulin
As mentioned above, two of the three components of the quality
control of glycoprotein folding (GT and GII) have been described previously in T. cruzi. To test whether the third component
(calnexin-calreticulin) is also present in this parasite, T. cruzi genomic DNA was used as template in PCR reactions together
with degenerate primers designed according to amino acid sequences
conserved among several fungal and mammalian calnexins and
calreticulins (IMFGPDKC and the KPEDWDE repeat motif for the sense and
antisense primers, respectively). Three bands of ~250, 320, and 375 bp were obtained. Both larger fragments were cloned and sequenced. Two
320-bp fragments from independent clones gave identical sequences. A
single 375-bp cloned fragment was sequenced and found to contain the
320-bp fragment. The 250-bp fragment was not sequenced. The 375-bp
fragment was used as probe for screening a genomic DNA library in
gt11. A phage containing a 3200-bp insert was thus isolated and
sequenced. It contained the 320- and 375-bp fragments and the entire
gene as well. As with all trypanosomatid genes sequenced so far, it contained no introns. A conceptual translation of the ORF is
depicted in Figure 2. The gene codes for
a 46.7-kDa protein that is 40% identical and 64% similar to human
calreticulin. It has the characteristic acidic domain at the C
terminus as well as an ER retrieval sequence (KEDL) that
resembles that present in grp78, a T. cruzi ER protein that
ends in MDDL (Tibbetts et al., 1994
). The parasite
calreticulin has three consensus Ca2+ binding motifs, the
same as its human counterpart (KPEDWDE or its conserved variations),
and also both Cys residues present in conserved positions in other
calreticulins. Synthesis of the 250-, 320-, and 375-bp fragments as PCR
products was probably due to the recognition of the three consensus
Ca2+ binding motifs by the antisense primer.
|
Calreticulin has also been sequenced from another trypanosomatid
protozoan, Leishmania donovani (Figure 2) (Josi et
al., 1996
). Calreticulin from this parasite is 39 and 42%
identical to its human and T. cruzi counterparts,
respectively. L. donovani calreticulin has two consensus
N-glycosylation sites, at least one of which was occupied
when the corresponding gene was transcribed and translated in the
presence of dog pancreas microsomes. No N-glycosylation sites occur in T. cruzi calreticulin. The L. donovani protein had, the same as its human and simian
homologues, the capacity of binding RNA. The possible physiological
role of this property remains obscure (see below).
We have been unable to detect a calnexin-encoding gene in
T. cruzi. As mentioned above, although primers were designed
according to sequences conserved in both calreticulins and calnexins,
the PCR fragments synthesized corresponded to a calreticulin-like protein. When the same primers were used with genomic S. pombe DNA as template in PCR reactions, the fragment formed had
the size expected for all calnexin-encoding genes sequenced so far (450 bp). No fragment having this size was formed with T. cruzi DNA as template. The 450-bp fragment was sequenced, and because it
corresponded to the highly conserved region of calnexins, it was used
as probe for screening T. cruzi genomic DNA at
low-stringency hybridization conditions (50°C, 2× SSC). No positive
signal was obtained. It would appear that T. cruzi is the
opposite of S. pombe, a microorganism whose genome codes for
a calnexin- but not for a calreticulin-like protein (Jannatipour and
Rokeach, 1995
; Parlati et al., 1995
).
Expression and Subcellular Localization of T. cruzi Calreticulin
Northern blotting analysis of total T. cruzi
epimastigote mRNA yielded a single 2300-bp positive signal when the
375-bp fragment was used as probe (Figure
3A). This confirmed that the
calreticulin-encoding gene was expressed in T. cruzi.
|
The entire gene was cloned in pET22B+ (which introduces a His tag at the C terminus of the protein) and expressed in E. coli BL26. Cells were lysed after isopropylthiogalactoside induction and centrifuged. SDS-PAGE analysis of soluble and insoluble material showed that practically all of an induced 48-kDa protein was in the last fraction. Insoluble material was solubilized in 6 M urea and purified by Ni2+ affinity chromatography. Calreticulin was renatured by successive dialysis against solutions containing decreasing urea concentrations. This preparation was used for studying calreticulin binding properties and for generating antibodies because it was homogeneous as judged by SDS-PAGE.
T. cruzi epimastigote cells were submitted to a subcellular fractionation by differential centrifugation. Similar protein amounts from each fraction (soluble, nuclear, small granule, large granule, and microsomal) were submitted to SDS-PAGE and further analyzed by Western blotting analysis using anti-calreticulin serum. A single positive signal corresponding to a 47-kDa protein was detected in the microsomal fraction (Figure 3B). A much weaker signal of the same size was observed in the small granule fraction. These results are compatible with the presence of an ER retrieval sequence in T. cruzi calreticulin. The presence of the protein in the small granule fraction might be due to a cross-contamination of fractions. The absence of calreticulin from the soluble and nuclear fractions strongly argues against the possibility that the capacity of RNA binding shown by L. donovani calreticulin in cell-free assays (see above) could have a physiological role.
T. cruzi Calreticulin Specifically Binds Free Monoglucosylated Oligosaccharides
A mixture of
[14C]Glc1-3Man9GlcNAc2
and [14C]Man9GlcNAc2 was mixed
with recombinant T. cruzi
calreticulin-Ni2+-iminodiacetic acid-agarose. Bound
material was eluted with a mixture of 10 mM
-methylglucoside plus 10 mM
-methylmannoside. Comparison of patterns of applied, unbound, and
retained material showed that T. cruzi calreticulin, the
same as mammalian calnexin and calreticulin, specifically binds
monoglucosylated oligosaccharides (Figure
4, A-C) (Ware et al., 1995
;
Spiro et al., 1996
).
|
DNJ Promotes Binding of Glycoproteins to Calreticulin
It has been firmly established that addition of GI and GII
inhibitors as castanospermine and DNJ to mammalian cells inhibits binding of glycoproteins to calnexin and calreticulin, because those
compounds promote accumulation of di- and triglucosylated oligosaccharides (Figure 1A) (Ou et al., 1993
; Hammond
et al., 1994
; Kearse et al., 1994
; Hebert
et al., 1995
; Nauseef et al., 1995
; Peterson
et al., 1995
). According to the known glycosylation and
oligosaccharide processing pathway occurring in the ER of T. cruzi cells (Figure 1B), addition of GI and GII inhibitors should
have the opposite effect if a quality control of glycoprotein folding
similar to that described for mammalian cells is operative in this
parasite. T. cruzi cells were incubated for 2 min with [35S]Met plus [35S]Cys both in the absence
and in the presence of 6 mM DNJ and chased for different periods. Cells
were lysed upon addition of detergent and iodoacetamide, and
anti-calreticulin serum was added. The immunoprecipitates obtained
under nondenaturing conditions were submitted to reducing SDS-PAGE. As
depicted in Figure 5A, autoradiography of
gels showed two main bands of 47 and 60 kDa. The intensities of the
bands having the lower molecular mass were approximately similar in
samples incubated with or without DNJ. On the contrary, the 60-kDa
bands were much more intense in samples incubated in the presence of
the GII inhibitor. In addition, whereas the 60-kDa band gradually
disappeared upon chasing cells, the intensity of the 47-kDa band did
not show a noticeable decrease.
|
DNJ does not penetrate instantly into the ER lumen. For this reason,
inhibition of calnexin and calreticulin binding of folding glycoproteins may only be observed in mammalian cells when the drug is
added some time before the labeled glycoprotein precursor. A short or
null preincubation of cells with the drug might result in an apparent
enhancement of lectin and glycoprotein binding because of inhibition of
removal not of the outer or middle but of the innermost glucose units.
In the experiment shown in Figure 5A, DNJ was added 20 min before
[35S]Met plus [35S]Cys. On the other hand,
we have previously observed that the percentage of glucosylated Endo
H-sensitive oligosaccharides was the same in T. cruzi cells
incubated with [14C]glucose and 6 mM DNJ for either 30 min or grown continuously for several generations under similar
conditions (Gañán et al., 1991
). This puts an
upper limit of 30 min for penetration of DNJ into the T. cruzi ER lumen. To confirm that indeed DNJ-mediated enhancement of
the interaction between the 47- and 60-kDa proteins was not due to
incomplete glucosidase inhibition after 20 min of preincubation with
the drug, parasite cells were preincubated with or without DNJ for 20 or 40 min, labeled for 2 min, chased for 10 min, and further treated as
in Figure 5A. As depicted in Figure 5B, DNJ promoted calreticulin
binding of the 60-kDa protein under both preincubation conditions. This
result confirmed that DNJ enhancement of the interaction between the
47- and 60-kDa proteins was not due to incomplete inhibition of glucose
removal but to the particular features of the glycoprotein formation
and processing pathway occurring in T. cruzi as shown in
Figure 1.
Identification of Proteins Precipitated by Anti-Calreticulin Serum
The 47-kDa protein was identified as calreticulin because it was
the only band present when immunoprecipitation was performed under
denaturing conditions (Figure 6A). This
identification is consistent with the molecular mass of calreticulin.
On the other hand, the 60-kDa protein was identified as cruzipain, a
lysosomal cysteine proteinase (for a review on cruzipain, see Cazzulo
et al., 1997
). A Western blotting analysis of gel shown in
Figure 5A gave a positive signal when probed with
[125I]protein A-anti-cruzipain serum (Figure 6B).
Moreover, a 60-kDa signal appeared when the immunocomplexes formed upon
addition of anti-calreticulin serum to samples incubated both in the
presence and in the absence of DNJ were dissociated, precipitated with anti-cruzipain serum, run on SDS-PAGE, and submitted to autoradiography (Figure 6C).
|
Cruzipain constitutes 5-8% of total soluble cellular protein (Cazzulo
et al., 1989
). This may explain why it was the only labeled
glycoprotein that was recognized by calreticulin after a 2-min pulse.
Cruzipain has at least six (and probably seven) disulfide bridges and
three N-glycosylation consensus sequences, at least two of
which are occupied by high-mannose-type oligosaccharides (Labriola
et al., 1995
; Metzner et al., 1996
). Moreover, we
have determined previously that 60-65% of
N-oligosaccharides contain a single glucose unit in mature
cruzipain molecules isolated from lysosomes of cells grown in the
presence of 6 mM DNJ (Labriola et al., 1995
).
Results shown in Figures 5 and 6 show, therefore, that calreticulin transiently recognized at least one glycoprotein and that, contrary to what happens in mammalian cells and consistently with the model of quality control of glycoprotein folding proposed for those cells and with the known processing pathway of oligosaccharides in T. cruzi, DNJ promotes binding of calreticulin to the glycoprotein.
Calreticulin Behaves Exclusively as a Lectin
Endo H Treatment of Calreticulin-Cruzipain Complexes.
To test
whether calreticulin recognized the protein moiety of cruzipain in
addition to the monoglucosylated oligosaccharides, lysates from cells
pulse-chased in the absence or presence of DNJ were treated with Endo
H before addition of anti-calreticulin serum. Autoradiography of the
SDS-PAGE of immunoprecipitates obtained upon addition of the antiserum
showed that the enzymatic treatment had completely abolished the
appearance of cruzipain in the immunoprecipitates in samples labeled
both in the presence and in the absence of DNJ (Figure
7A,
DNJ and +DNJ; compare with Figure
5,
DNJ and +DNJ, respectively). SDS-PAGE of immunoprecipitates
obtained upon addition of anti-cruzipain serum to Endo H-treated
samples revealed that in all cases cruzipain had been completely
deglycosylated by the enzyme (Figure 7B,
DNJ and +DNJ).
|
Endo H Treatment of Calreticulin-Cruzipain-Anti-calreticulin
Antibody Immunocomplexes.
Complete disappearance of cruzipain from
the complexes was also observed when treatment with Endo H was
performed not before addition of the anti-calreticulin serum but on the
immunoprecipitates obtained upon addition of anti-calreticulin serum to
lysates of cells labeled in the absence of DNJ (Figure
8A,
DNJ; compare with Figure 5,
DNJ).
On the other hand, residual cruzipain in the complexes was observed
when Endo H treatment was similarly performed on immunoprecipitates
obtained from samples labeled in the presence of DNJ (Figure 8A, +DNJ;
compare with Figure 5, +DNJ). This result was due not to an interaction
of the protein moieties of cruzipain and calreticulin but to the fact
that not all cruzipain molecules had been degraded by Endo H as
cruzipain migrated in Figure 8A, +DNJ, the same as in samples not
treated with the glycosidase. To check that cruzipain in Figure 8 A,
+DNJ, had not been degraded by Endo H, immunoprecipitates obtained from samples incubated with DNJ were incubated with Endo H but in the presence of 0.5% SDS. The whole samples (not only bead-bound proteins) were then submitted to SDS-PAGE and autoradiography. As depicted in
Figure 8B, +DNJ, cruzipain incubated with Endo H under slightly denaturing conditions migrated much closer to calreticulin than in
Figure 8A, +DNJ.
|
DNJ and +DNJ, and 8A,
DNJ and +DNJ, indicated that no
interaction between calreticulin and cruzipain protein moieties had occurred.
Calreticulin Binds Mature Monoglucosylated Cruzipain
To confirm that the presence of monoglucosylated oligosaccharides
was a necessary and sufficient condition for calreticulin-cruzipain interaction, mature cruzipain was isolated from lysosomes of cells pulse-chase labeled with [35S]Met plus
[35S]Cys in the presence or absence of 6 mM DNJ, mixed
with recombinant calreticulin, and immunoprecipitated with
anti-calreticulin serum. As mentioned above, we have previously shown
that ~65% of N-oligosaccharides present in mature
cruzipain synthesized in the presence of the GII inhibitor are
monoglucosylated. No glucosylated oligosaccharides were detected in the
mature proteinase formed in the absence of DNJ (Labriola et
al., 1995
). SDS-PAGE of immunoprecipitates and supernatants showed
that mature glucosylated but not unglucosylated cruzipain interacted
with calreticulin (Figure 9). A control
experiment showed that the appearance of glucosylated cruzipain in the
immunoprecipitate was dependent on the addition of recombinant
calreticulin.
|
Calreticulin Recognizes Cruzipain at Its Last Folding Stages
To study the folding status of cruzipain recognized by
calreticulin, cells were pulse-chase labeled as described above
(absence of DNJ) and lysed in the presence of detergent and
iodoacetamide, and immunoprecipitates obtained with anti-calreticulin
serum were run on SDS-PAGE under reducing and nonreducing conditions.
As depicted in Figure 10
(anti-calreticulin), in all samples calreticulin-bound cruzipain
migrated under nonreducing conditions as the fully oxidized glycoprotein, differently from the completely reduced proteinase. Cruzipain species with intermediate migration corresponding to different oxidation stages (as mentioned above, cruzipain has six or
seven disulfide bridges) were nevertheless present as they were
immunoprecipitated with anti-cruzipain serum (Figure 10,
anti-cruzipain). It was concluded that calreticulin and therefore also
GT recognized cruzipain at its last folding stages.
|
| |
DISCUSSION |
|---|
|
|
|---|
As mentioned above, trypanosomatid protozoa are microorganisms
belonging to an early branch in evolution. Trypanosomatids display
certain distinctive features in the pathway of protein N-glycosylation and ER oligosaccharide processing when
compared with that occurring in mammalian cells, such as a much shorter dolichol moiety, an inability to synthesize dolichol-P-Glc, the in vivo
transfer of unglucosylated oligosaccharides to nascent polypeptide
chains, the absence in certain species of the dolichol-P-Man-dependent mannosyltransferases responsible for the addition of the seventh, eighth, and ninth or the eighth and ninth mannosyl residues, and the
presence of an oligosaccharyltransferase unable to discriminate between
glucosylated and unglucosylated oligosaccharides (for review, see
Parodi, 1993
). Nevertheless, all 12 species tested so far were found to
express an in vivo functional GT (Previato et al., 1986
).
Moreover, in two of them (T. cruzi and Crithidia fasciculata) the enzyme was detected in cell-free assays
(Trombetta et al., 1989
). In fact, it was precisely in
T. cruzi, in which direct glucosylation of high-mannose-type
protein-linked oligosaccharides was first described (Parodi and
Cazzulo, 1982
). Trypanosomatid protozoa also express a GII activity
able to remove glucose units from monoglucosylated oligosaccharides
created by GT (Bosch et al., 1988
). Concentrations of
inhibitors (DNJ and castanospermine) required for attaining 50%
inhibition of trypanosomatid GII were similar (if not identical) to
values reported for the mammalian enzyme, thus suggesting a high
similarity between GII activities from both origins (Gañán
et al., 1991
; Gotz et al., 1991
).
We demonstrate in this report that T. cruzi expresses a protein that is 40% identical and 64% similar to human calreticulin. The same as its mammalian counterpart, the protozoan protein has three Ca2+ binding motifs, and more important, it specifically binds monoglucosylated oligosaccharides. No gene coding for a calnexin homologue was detected in T. cruzi. Nevertheless, only completion of the currently World Health Organization-sponsored T. cruzi genome project would confirm the apparent absence of a calnexin-encoding gene in this parasite.
A single glycoprotein (cruzipain, a lysosomal proteinase) was found to
interact with calreticulin in T. cruzi cells pulse-chased with [35S]Met plus [35S]Cys. Cruzipain is a
major cellular protein (5-8% of total soluble protein) that has at
least two N-linked high-mannose-type oligosaccharides and at
least six disulfide bridges (Labriola et al., 1995
; Metzner et al., 1996
; Cazzulo et al., 1997
). It cannot be
discarded, however, that other minor glycoproteins might also interact
with calreticulin. Nevertheless, the fact that only a single species
was recognized by the lectin after a 2-min pulse, and that this
recognition had a transient character as it disappeared upon chasing
cells, shows that the cruzipain-calreticulin interaction was highly
specific and that it followed the same time course already described
for the interaction of calnexin and calreticulin with mammalian glycoproteins.
A crucial result that validates the mechanism proposed for the quality
control of glycoprotein folding was the fact that, contrary to what has
been described for mammalian cells, DNJ (a GII inhibitor) promoted,
rather than inhibited, the interaction of calreticulin and cruzipain
(Ou et al., 1993
; Hammond et al., 1994
; Kearse
et al., 1994
; Hebert et al., 1995
; Nauseef
et al., 1995
; Peterson et al., 1995
). This result
is consistent with the known differences between mammalian and
trypanosomatid ER oligosaccharide processing pathways (Figure 1). We
have previously reported that addition of DNJ to T. cruzi
cell cultures delayed arrival of cruzipain to lysosomes. Forced
interaction of the proteinase with calreticulin was probably
responsible for the observed delay (Labriola et al., 1995
).
Moreover, ~60-65% of all N-linked oligosaccharides
present in mature cruzipain isolated from lysosomes of cells grown in the presence of 6 mM DNJ were found to be glucosylated. The same proportion was found when the structure of a specific oligosaccharide (that closer to the C terminus of the glycoprotein) was studied (Labriola et al., 1995
). This suggests that GT-mediated
glucosylation is not a deterministic process but that it is restricted
in vivo to glycoprotein molecules that for some reason present folding problems, probably because they have not been recognized by the proper
chaperones at the proper time and at the proper place.
Interaction of cruzipain with calreticulin was solely dependent on the presence of glucosylated N-oligosaccharides in the former protein. Incubation with Endo H of the cruzipain-calreticulin complexes isolated from cells labeled in the presence or absence of DNJ completely abolished the interaction when treatment was performed before addition of the anti-calreticulin serum. Some residual cruzipain was found in the complexes when Endo H degradation was performed on the immunoprecipitates obtained from cells labeled in the presence of DNJ. However, this was not due to an interaction of calreticulin with the protein moiety of cruzipain but to a hindrance in the accessibility of Endo H to cruzipain in the immunocomplexes, because residual cruzipain had the same migration on gels as the fully glycosylated protein. In addition, it was demonstrated that the presence of monoglucosylated oligosaccharides was a necessary and sufficient condition for the interaction of mature cruzipain isolated from lysosomes with recombinant calreticulin.
A rather surprising result was the fact that only cruzipain migrating
as the fully oxidized species under nonreducing conditions was
recognized by calreticulin even after a 2-min pulse and 0-min chase.
This result is at variance with that reported by Hebert et
al. (1996)
. They showed that both calreticulin and calnexin recognized folding intermediates of influenza virus hemagglutinin differing in their oxidation status. Because glycoprotein recognition by both lectins only depends on the presence of glucosylated
oligosaccharides and not on the folding status of the protein moieties
(see below), it may be speculated that in the case described by Hebert
et al. (1996)
, the monoglucosylated oligosaccharides
recognized by the lectins in the folding intermediates were those
created by deglucosylation of the transferred compound
(Glc3Man9GlcNAc2). As shown in
Figure 1B, those monoglucosylated derivatives are not created in
T. cruzi. This indicates that GT glucosylated cruzipain at
its last folding stages (i.e., when all or almost all disulfide bonds
have been already formed). In fact, it has been reported that GT may
quite efficiently glucosylate a glycoprotein enzyme having ~25-35%
of the enzymatic activity of the native enzyme, that is, a tertiary structure closely resembling that of the properly folded species (Sousa
and Parodi, 1995
).
As mentioned above, there is a controversy about whether calnexin and
calreticulin behave as lectins that exclusively recognize the
above-mentioned oligosaccharides or whether, alternatively, such
recognition is the first and necessary step for an interaction between
misfolded glycoprotein protein moieties and calnexin and calreticulin.
Evidence for this last possibility was provided by experiments in which
several transmembrane glycoproteins (murine major histocompatibility
complex [MHC] class I heavy chain Kb and Db,
human MHC class I human leukocyte antigen heavy chain, MHC class II
DR
and DR
and invariant chains, and T cell receptor
chain) were found to immunoprecipitate with anti-calnexin antibodies even
after enzymatic removal of all oligosaccharide chains (Arunachalam and
Cresswell, 1995
; Ware et al., 1995
; Zhang et al.,
1995
; Bennett et al., 1998
). The possibility exists,
however, that because both calnexin and the substrates are
transmembrane species, they may remain trapped in the same detergent
micelles after removal of oligosaccharides. On the other hand, a
soluble glycoprotein such as
1-anti-trypsin was also
found to be apparently immunoprecipitated by anti-calnexin serum after
removal of oligosaccharides. In this case the above-mentioned possible
colocalization of calnexin and the substrate glycoprotein in the same
micelles may be ruled out (Ware et al., 1995
). However, a
poor solubility of the yet not properly folded
1-anti-trypsin (and also of the above-mentioned transmembrane deglycosylated glycoproteins) may explain its appearance in the immunoprecipitate.
Evidence for the role of calnexin and calreticulin as lectins that
exclusively recognize monoglucosylated oligosaccharides comes from
experiments in which the interaction of glycosylated bovine pancreas
RNase with calnexin and calreticulin was studied either in a dog
pancreas microsome-rabbit reticulocyte translation system or with
isolated RNase and calnexin (Rodan et al., 1996
; Zapun
et al., 1997
). It was concluded in both studies that removal of oligosaccharides with endoglycosidases or of the glucose units present in the oligosaccharides with GII completely abolished calnexin
and calreticulin interaction with monoglucosylated RNase. The main
drawback of the above-mentioned conclusion is that the model
glycoprotein chosen (RNase) is practically devoid of hydrophobic domains, as revealed by a Kyte-Doolittle hydrophilicity plot. An
extremely weak interaction of the protein moiety of RNase with calnexin
and calreticulin would be expected if such interaction involved
hydrophobic domains in the substrate glycoprotein, as has been
described for folding proteins and classical chaperones.
Results presented in the present report obviate objections mentioned above for conclusions supporting either one of both models of the calnexin-calreticulin interaction. Both calreticulin and cruzipain are soluble proteins (i.e., they cannot be trapped in micelles), and the substrate glycoprotein has several hydrophobic domains interspersed along the entire molecule. Moreover, the conclusion that calreticulin behaves exclusively as a lectin that binds monoglucosylated oligosaccharides was derived from experiments performed in intact cells, using a naturally expressed glycoprotein. However, the occurrence of extremely weak protein-protein interactions between calreticulin and folding glycoproteins that might be disrupted on immunoprecipitation cannot be ruled out.
Glycoprotein folding facilitation mediated by the exclusive interaction of protein-linked monoglucosylated oligosaccharides and ER lectins is, therefore, a process that appeared early in evolution.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by National Institutes of Health grant GM44500 and by grants from the United Nations Development Program/World Bank/World Health Organization Special Program for Research and Training in Tropical Diseases, Scientific Research Cooperation Department of the Swedish International Development Agency, the University of Buenos Aires, and the Argentine Federal Government (Consejo Nacional de Investigaciones Científicas y Técnicas and Agencia Nacional de Promoción Científica y Tecnológica). C.L. is a doctoral fellow and J.J.C. and A.J.P. are career investigators of the National Research Council (Argentina). A.J.P. is a Howard Hughes Medical Institute international research scholar.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
aparodi{at}iib.uba.ar.
| |
REFERENCES |
|---|
|
|
|---|
proteins from rapid degradation in CD4+CD8+ thymocytes.
J. Biol. Chem.
273, 23674-23680
and TCR
proteins with calnexin and results specifically in accelerated degradation of nascent TCR
proteins within the endoplasmic reticulum.
EMBO J.
13, 3678-3686[Medline].
-saturated polyprenyl phosphate.
Biochem. J.
212, 123-128[Medline].This article has been cited by other articles:
![]() |
D. J. Termine, K. W. Moremen, and R. N. Sifers The mammalian UPR boosts glycoprotein ERAD by suppressing the proteolytic downregulation of ER mannosidase I J. Cell Sci., April 1, 2009; 122(7): 976 - 984. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Pearse, L. Gabriel, N. Wang, and D. N. Hebert A cell-based reglucosylation assay demonstrates the role of GT1 in the quality control of a maturing glycoprotein J. Cell Biol., April 21, 2008; 181(2): 309 - 320. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Jones, A. Mehlert, M. L. S. Guther, and M. A. J. Ferguson Deletion of the Glucosidase II Gene in Trypanosoma brucei Reveals Novel N-Glycosylation Mechanisms in the Biosynthesis of Variant Surface Glycoprotein J. Biol. Chem., October 28, 2005; 280(43): 35929 - 35942. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Leach and D. B. Williams Lectin-deficient Calnexin Is Capable of Binding Class I Histocompatibility Molecules in Vivo and Preventing Their Degradation J. Biol. Chem., March 5, 2004; 279(10): 9072 - 9079. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Ferreira, C. Valck, G. Sanchez, A. Gingras, S. Tzima, M. C. Molina, R. Sim, W. Schwaeble, and A. Ferreira The Classical Activation Pathway of the Human Complement System Is Specifically Inhibited by Calreticulin from Trypanosoma cruzi J. Immunol., March 1, 2004; 172(5): 3042 - 3050. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Conte, C. Labriola, J. J. Cazzulo, R. Docampo, and A. J. Parodi The Interplay between Folding-facilitating Mechanisms in Trypanosoma cruzi Endoplasmic Reticulum Mol. Biol. Cell, September 1, 2003; 14(9): 3529 - 3540. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Guerin and A. J. Parodi The UDP-glucose:Glycoprotein Glucosyltransferase Is Organized in at Least Two Tightly Bound Domains from Yeast to Mammals J. Biol. Chem., May 30, 2003; 278(23): 20540 - 20546. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Caramelo, O. A. Castro, L. G. Alonso, G. de Prat-Gay, and A. J. Parodi Inaugural Article: UDP-Glc:glycoprotein glucosyltransferase recognizes structured and solvent accessible hydrophobic patches in molten globule-like folding intermediates PNAS, January 7, 2003; 100(1): 86 - 91. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goicoechea, M. A. Pallero, P. Eggleton, M. Michalak, and J. E. Murphy-Ullrich The Anti-adhesive Activity of Thrombospondin Is Mediated by the N-terminal Domain of Cell Surface Calreticulin J. Biol. Chem., September 27, 2002; 277(40): 37219 - 37228. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. McConville, K. A. Mullin, S. C. Ilgoutz, and R. D. Teasdale Secretory Pathway of Trypanosomatid Parasites Microbiol. Mol. Biol. Rev., March 1, 2002; 66(1): 122 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. G. Danilczyk and D. B. Williams The Lectin Chaperone Calnexin Utilizes Polypeptide-based Interactions to Associate with Many of Its Substrates in Vivo J. Biol. Chem., June 29, 2001; 276(27): 25532 - 25540. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Furuya, M. Okura, F. A. Ruiz, D. A. Scott, and R. Docampo TcSCA Complements Yeast Mutants Defective in Ca2+ Pumps and Encodes a Ca2+-ATPase That Localizes to the Endoplasmic Reticulum of Trypanosoma cruzi J. Biol. Chem., August 24, 2001; 276(35): 32437 - 32445. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||