![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 10, Issue 6, 1851-1857, June 1999
12/13 Subunits in Neuronal Cells: Induction of Neurite
Retraction
and
*The Netherlands Cancer Institute, Division of Cellular
Biochemistry, 1066 CX Amsterdam, The Netherlands; and
Medical Research Council Laboratory for Molecular Cell
Biology, University College London, London WC1E 6BT, United Kingdom
 |
ABSTRACT |
|---|
 TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERNCES
|
|---|
Neuronal cells undergo rapid growth cone collapse, neurite
retraction, and cell rounding in response to certain G protein-coupled receptor agonists such as lysophosphatidic acid (LPA). These shape changes are driven by Rho-mediated contraction of the actomyosin-based cytoskeleton. To date, however, detection of Rho activation has been
hampered by the lack of a suitable assay. Furthermore, the nature of
the G protein(s) mediating LPA-induced neurite retraction remains
unknown. We have developed a Rho activation assay that is based on the
specific binding of active RhoA to its downstream effector Rho-kinase
(ROK). A fusion protein of GST and the Rho-binding domain of ROK
pulls down activated but not inactive RhoA from cell lysates. Using
GST-ROK, we show that in N1E-115 neuronal cells LPA activates
endogenous RhoA within 30 s, concomitant with growth cone
collapse. Maximal activation occurs after 3 min when neurite retraction
is complete and the actin cytoskeleton is fully contracted. LPA-induced
RhoA activation is completely inhibited by tyrosine kinase inhibitors
(tyrphostin 47 and genistein). Activated G
12 and
G13 subunits mimic LPA both in activating RhoA and in inducing RhoA-mediated cytoskeletal contraction, thereby preventing neurite outgrowth. We conclude that in neuronal cells, LPA activates RhoA to induce growth cone collapse and neurite retraction through a
G12/13-initiated pathway that involves protein-tyrosine
kinase activity.
| |
INTRODUCTION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERNCES
|
|---|
Rho family GTPases control a variety of cellular processes,
ranging from cytoskeletal reorganization and cell motility to gene
transcription in response to external stimuli (for review, see Van
Aelst and D'Souza-Schorey, 1997
; Hall, 1998). Like Ras, Rho GTPases
act as binary switches: they are inactive when bound to GDP and are
active in their GTP-bound form. RhoA, the founder member of the Rho
subfamily, regulates the actin cytoskeleton in response to G
protein-coupled receptor agonists such as the serum-borne phospholipid
lysophosphatidic acid (LPA; Moolenaar et al., 1997). The
cytoskeletal changes mediated by RhoA vary between cell types. In
serum-starved fibroblasts, RhoA induces the assembly of stress fibers
and focal adhesions (Ridley and Hall, 1992). In neuronal N1E-115 cells,
on the other hand, RhoA induces the formation of a cortical shell of
f-actin that mediates cytoskeletal contraction (Kranenburg et
al., 1997), which is thought to underlie growth cone collapse,
retraction of developing neurites, and rounding of the cell body in
response to LPA (Jalink et al., 1993, 1994; Kozma et
al., 1997; Kranenburg et al., 1997; van Leeuwen et al., 1997). In vivo, Rho-mediated neurite retraction
might occur after nervous system injury, when neurons are suddenly
exposed to blood-borne factors such as LPA released by activated
platelets (Moolenaar et al., 1997).
Multiple downstream effectors of RhoA have been identified in
recent years (Hall, 1998). Of particular relevance is the Rho-kinase (ROK/ROCK) family of Ser/Thr kinases that mediate both stress fiber
formation and cytoskeletal contraction by stimulating myosin light-chain phosphorylation (Leung et al., 1996; Matsui
et al., 1996; Amano et al., 1997, 1998; Hirose
et al., 1998; Katoh et al., 1998a). It has
recently become clear that, in neuronal cells, the Rac and Cdc42
members of the Rho GTPase family oppose RhoA action in that they
promote neurite outgrowth and stimulate growth cone motility (Kozma
et al., 1997; van Leeuwen et al., 1997).
Insight into the cellular functions of RhoA has been obtained by overexpressing constitutively active and dominant-negative versions of RhoA. Although this overexpression approach has considerably advanced our understanding of RhoA downstream signaling, relatively little is still known about how cell surface receptors couple to activation of RhoA (i.e., RhoA-GTP accumulation). This is mainly because direct monitoring of RhoA activation has proved to be difficult. At present, agonist-induced activation of Rho GTPases is usually assessed in an indirect manner by monitoring changes in f-actin organization and cell morphology.
In the present study, we set out to monitor LPA-induced RhoA activation
in a more direct manner and thereby gain further insight into how LPA
regulates neuronal morphology, using N1E-115 cells as a model. LPA
receptors couple to at least three distinct classes of G proteins:
Gq, which activates phospholipase C; Gi,
which inhibits adenylyl cyclase, whereas its corresponding 
subunits are thought to couple to Ras signaling; and the
G12/13 subclass, which has been implicated in Rho
activation (Buhl et al., 1995; Fromm et al.,
1997; Gohla et al., 1998; Gutkind, 1998; Hart et al., 1998). Our RhoA activation assay is analogous to recently described protocols for measuring Rap1, Ras, and Rac/Cdc42 activation (Taylor and Shalloway, 1996; de Rooij and Bos, 1997; Franke et al., 1997; Manser et al., 1998) and makes use of the
selective binding of active, GTP-bound RhoA to the Rho-binding domain
of ROK (Leung et al., 1995). A fusion between this domain
and GST allows the specific recovery of activated RhoA on
glutathione-Sepharose. Using this assay, we show that LPA rapidly
activates endogenous RhoA in N1E-115 cells and that this activation
requires tyrosine kinase activity. Moreover, we find that
G12 and G13 subunits activate RhoA
specifically and completely inhibit neurite outgrowth in a
RhoA-dependent manner.
| |
MATERIALS AND METHODS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERNCES
|
|---|
Cell Lines and Transfection
COS7 and N1E-115 cells were grown in Dulbecco's modified
Eagle's medium containing 10% FCS and antibiotics. COS7 cells were transfected using the DEAE-dextran method, whereas N1E-115 cells were
transfected using calcium phosphate precipitates (Gebbink et
al., 1997; Kranenburg et al., 1997).
RhoA and Cdc42 Activation Assay
The GST-ROK fusion protein was made by using primers
gccggatccctactaagtgactctccatc and gcggaattcactgcctatactggaactat in a PCR reaction on the full-length ROK cDNA (a generous gift from Dr.
L. Lim, Institute of Neurology, London, United Kingdom),
followed by digestion with BamHI and EcoRI and
subcloning into pGEX4T3. The Escherichia coli Bl21-DE3pLysE
strain was transformed with this construct, and expression of the
fusion protein was induced by overnight incubation with 0.1 mM
isopropyl-1-thio--D-galactopyranoside at room
temperature. The fusion protein was prepared by lysing the bacteria in
a buffer containing 1% NP-40, 50 mM Tris, pH 7.4, 100 mM NaCl, 5 mM
MgCl2, and 10% glycerol, supplemented with protease inhibitors. The bacterial lysate was then sonicated with 60 1-s pulses,
and the lysates were cleared by centrifugation at 10,000 rpm for 15 min. The fusion protein was then recovered by addition of glutathione
beads to the supernatant. The beads were washed three times in cell
lysis buffer before addition to the cellular lysates. The fusion
protein was prepared fresh for every experiment.
Cells were stimulated, washed with ice-cold PBS, and lysed in a buffer containing 50 mM Tris, pH 7.4, 0.1% Triton X-100, 150 mM NaCl, 5 mM MgCl2, and 10% glycerol, supplemented with protease inhibitors. Lysates were cleared by centrifugation (14,000 rpm, 10 min), and the freshly prepared fusion protein, immobilized on glutathione-Sepharose, was added. After 1 h of tumbling at 4°C, beads were washed three times with lysis buffer and analyzed by Western blotting.
Western Blotting
PAA gels were run and blotted onto nitrocellulose filters. The filters were blocked using 5% milk and were subsequently probed with primary antibodies (9E10, anti-myc; 26C4 [Santa Cruz Biotechnology, Santa Cruz, CA], anti-RhoA) and HRP-conjugated secondary antibodies (Dako, Glostrup, Denmark). The 26C4 anti-RhoA is specific for RhoA; it does not recognize Rac or Cdc42 overexpressed in Cos7 cells (our unpublished results). Signals were visualized using the ECL detection system (Amersham, Arlington Heights, IL).
Morphological Analysis of N1E-115 Cells
The morphology of transfected N1E-115 cells was assessed as
described (Gebbink et al., 1997). In short, cells were
transfected with an expression vector encoding -galactosidase and
expression vectors encoding activated versions of the G protein subunits. Activated G12 and G13 were
kindly provided by Dr. H. Bourne (University of California, San
Francisco, CA); activated Gq was provided by Dr.
S. Gutkind (National Institute of Dental Research, Bethesda,
MD); and activated Gi was provided by Dr. S. Hermouet (Institut Biologie des Hôpitale de Nantes). Cells
were either scored rounded ("round"), flattened ("flat"), or
flattened with neurites the length of at least twice the cell body
diameter ("neurite"). The experiments were performed in triplicate
and morphologies were scored without prior knowledge of the dishes'
identities. The shown percentages are means of at least three
independent experiments.
Immunofluorescence
Cells were grown on glass coverslips and were transfected with
either pcDNA-G12 or pcDNA-G13. After
overnight culturing in serum-free medium, the cells were fixed in 3.7%
formaldehyde and were processed for immunofluorescence as described
using anti-G12 and G13 antibodies (A20
and S20, Santa Cruz) and rhodamine-conjugated phalloidin to stain
f-actin.
| |
RESULTS AND DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERNCES
|
|---|
A New Rho Activation Assay
We developed a novel method to measure the activation of RhoA,
analogous to the recently described methods to detect Rap1, Ras, and
Rac/Cdc42 activation (Taylor and Shalloway, 1996; de Rooij and Bos,
1997; Franke et al., 1997; Manser et al., 1998). The Rho-binding domain of the RhoA effector ROK (Leung et
al., 1995) (residues 420-1137) was fused to GST, and this fusion
protein was then used to precipitate Rho proteins from cell lysates. We first tested whether GST-ROK could discriminate between GTP- and GDP-bound forms of RhoA by using RhoA mutants that are either constitutively GTP bound (V14 and L63) or GDP-bound (N19). Cos7 cells
were transfected with expression vectors encoding myc-tagged wild-type
(wt), activated (L63), or inactive (N19) RhoA as well as effector loop
mutants (L63A37 and L63G39). Cell extracts were then prepared and
incubated with the GST-ROK fusion protein. Binding of the various Rho
proteins to GST-ROK was analyzed by recovery of the fusion protein on
glutathione-Sepharose followed by Western blot analysis using an
anti-myc tag antibody. Figure 1A shows that GST-ROK binds to activated (L63) and wt versions of RhoA but not
to inactive N19RhoA or to the (GTP-bound) effector domain mutants. None
of the RhoA proteins bound to GST alone. Thus, the interaction of
GST-ROK with RhoA depends on GTP loading as well as on an intact
effector domain.
|
We next tested whether GST-ROK could also be used to recover the
GTP-bound forms of Rac and Cdc42. An in vitro interaction between ROK
and Rac has been reported (Lamarche et al., 1996). We found
that both Rac1 and Cdc42 are efficiently pulled down by GST-ROK.
However, although GST-ROK binds Cdc42 in a GTP-dependent manner, its
binding to Rac1 appears to be nucleotide-independent (Figure 1B). Thus,
GST-ROK is a useful tool to measure activation of RhoA and Cdc42, but
not Rac. As shown in Figure 1, A and B, we consistently observed that
in COS cells basal RhoA activity is much higher than basal Cdc42
activity (compare wt with V12 and V14/L63 lanes).
LPA-induced RhoA Activation in Neuronal Cells: Tyrosine Kinase Involvement
We next used GST-ROK to measure activation of endogenous RhoA in
response to external stimuli. To this end, we used neuronal N1E-115
cells, which are highly responsive to LPA (Jalink et al., 1993, 1994; Kranenburg et al., 1997). When exposed to LPA,
these cells undergo rapid RhoA-mediated contraction of the
actomyosin-based cytoskeleton, leading to growth cone collapse, neurite
retraction, and cell rounding (Jalink et al., 1994). As
shown in Figure 2A, LPA activates
endogenous RhoA within 30 s, which coincides with the rapid onset
of growth cone collapse and neurite retraction (Jalink et
al., 1993). Maximal RhoA activation is observed at 3 min after
addition of LPA, when neurites are retracted and the cell body has
adopted a fully rounded morphology. Bradykinin, which stimulates
phosphoinositide hydrolysis and Ca2+ signaling but not
neurite retraction (Jalink and Moolenaar, 1992), fails to activate RhoA
in N1E-115 cells (Figure 2A).
|
In an attempt to measure activation of endogenous Cdc42, we tested several commercially available antibodies. However, although some of them reacted with overexpressed Cdc42 in Cos7 cells, none of them detected endogenous Cdc42 in N1E-115 cells, thus precluding the detection of Cdc42 activation.
Circumstantial evidence suggests that, in 3T3 cells, receptor-mediated
Rho activation involves protein-tyrosine kinase activity. This notion
is based on the finding that tyrphostin inhibits stress fiber formation
induced by LPA but not that induced by activated RhoA (Nobes et
al., 1995). Similarly, tyrosine kinase inhibition by either
genistein or tyrphostin 47 blocks the rapid effects of LPA on growth
cone collapse and neurite retraction in N1E-115 cells (Jalink et
al., 1993), whereas the inactive tyrphostin-1 had no effect (our
unpublished results). To examine whether tyrosine kinase activity acts
upstream or downstream of RhoA, we measured LPA-induced RhoA activation
in the absence and presence of genistein or tyrphostin 47. Figure 2B
shows that pretreatment of N1E-115 cells with either compound prevents
LPA-induced activation of RhoA. Thus, tyrosine kinase activity links
LPA receptors to RhoA activation in neuronal cells.
G12/13 Subunits Activate RhoA and Induce
Cytoskeletal Contraction
LPA signals through multiple heterotrimeric G proteins to evoke
its cellular responses. The G12/13 subclass has been
implicated in Rho activation and signaling (Buhl et al.,
1995; Fromm et al., 1997; Gohla et al., 1998;
Hart et al., 1998). We transfected various expression
vectors encoding activated (GTPase-deficient) versions of
G12, G13, Gi, and
Gq, together with wt RhoA into Cos cells. The activation
state of RhoA was determined using GST-ROK. We found that both
G12 and G13 activate RhoA, whereas
Gi had no effect (Figure
3). Activated Gq caused
massive cell death (our unpublished results; also see Xu et
al., 1993) and hence could not be used in RhoA activation assays.
|
When transfected into N1E-115 cells, activated G12 and
G13, like LPA or active RhoA (Jalink et al.,
1993; Gebbink et al., 1997; Kranenburg et al.,
1997), induced cell rounding, thereby preventing cell flattening and
neurite outgrowth (Figure 4A). The
rounded cells expressing activated G12 and
G13 display a contracted cortical cytoskeleton (Figure
4B), indicating that cell rounding induced by these subunits is not
secondary to loss of cell adhesion attributable to dissolution of the
cytoskeleton. We did not observe the formation of actin stress fibers
in N1E-115 cells expressing either G12 or
G13. We tested the sensitivity of G12-
and G13-induced cell rounding to both genistein and tyrphostin 47. Although we observed a slight inhibition in
G13-expressing cells (consistent with findings by Gohla
et al. [1998] and Katoh et al.
[1998b]), interpretation of these results was obscured by
increased cell death and shape changes in control cells (our unpublished results).
|
Cytoskeletal contraction was not observed with activated
Gi, whereas activated Gq again induced
cell death (our unpublished results). Yet, it seems highly unlikely
that active Gq would promote RhoA activation for several
reasons. First, bradykinin, which couples to Gq-mediated
phosphoinositide hydrolysis in these cells, does not activate RhoA
(Figure 2), nor does it induce neurite retraction (Jalink and
Moolenaar, 1992). Second, in neuronal PC12 cells activated
Gq promotes rather than prevents neurite outgrowth (Heasley et al., 1996), and finally, Gq
promotes the disassembly of stress fibers in fibroblasts (Buhl et
al., 1995), opposite to what is observed with activated RhoA and
G12/13.
To assess whether the contractility in neuronal cells induced by
G12/13 requires RhoA activity, we cotransfected
dominant-negative RhoA (N19) or a control vector with either
G12 or G13. Figure 4C shows that N19RhoA
largely restores the normal morphology of N1E-115 cells, consistent
with G12/13 acting via RhoA to induce cytoskeletal contraction.
Concluding Remarks
In conclusion, we have developed a new Rho activation assay to
show that, in neuronal cells, LPA rapidly activates RhoA through G12/13 and an unidentified protein-tyrosine kinase. The
finding that tyrosine kinase activity is required for RhoA activation is important, because it implies that the recently reported in vitro
interaction between G13 and a Rho-specific exchange
factor (p115-RhoGEF; Hart et al., 1998) is not sufficient
for efficient RhoA activation in intact cells. Recent studies by Gohla
et al. (1998) and Katoh et al. (1998b)
suggest that there is a differential requirement for tyrosine kinase
activation in the induction of RhoA signaling by G12 and
G13. A major challenge for further studies is to
identify the tyrosine kinase involved in RhoA activation by
G12/13 in neuronal cells. Both the EGF receptor and Tec
family tyrosine kinases have been implicated in Rho activation (Gohla et al., 1998; Mao et al., 1998). However, neither
of these tyrosine kinases is highly expressed in neuronal N1E-115
cells. Further studies should reveal how G12/13, Rho
exchange factor(s), and tyrosine kinase(s) interact to promote RhoA
activation in neuronal cells exposed to LPA. The presently described
assay should serve as a useful tool in these studies.
| |
ACKNOWLEDGMENTS |
|---|
We thank Drs. M. Gebbink, H. Bourne, S. Gutkind, and S. Hermouet for expression vectors. This work was supported the Dutch Cancer Society. D.D. and A.H. were supported by The Wellcome Trust.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
wmoolen{at}nki.nl.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERNCES
|
|---|
12, G13, and Gq induce Rho-dependent neurite retraction through different signaling pathways.
J. Biol. Chem.
273, 28700-28707This article has been cited by other articles:
|
|
 |
|
  A. Tomar, S. P. George, S. Mathew, and S. Khurana Differential Effects of Lysophosphatidic Acid and Phosphatidylinositol 4,5-Bisphosphate on Actin Dynamics by Direct Association with the Actin-binding Protein Villin J. Biol. Chem., December 18, 2009; 284(51): 35278 - 35282. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Duffy, A. Schmandke, A. Schmandke, J. Sigworth, S. Narumiya, W. B. J. Cafferty, and S. M. Strittmatter Rho-Associated Kinase II (ROCKII) Limits Axonal Growth after Trauma within the Adult Mouse Spinal Cord J. Neurosci., December 2, 2009; 29(48): 15266 - 15276. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Ponsioen, L. van Zeijl, M. Langeslag, M. Berryman, D. Littler, K. Jalink, and W. H. Moolenaar Spatiotemporal Regulation of Chloride Intracellular Channel Protein CLIC4 by RhoA Mol. Biol. Cell, November 15, 2009; 20(22): 4664 - 4672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. He, Y. Su, P. V. Usatyuk, E. Wm. Spannhake, P. Kogut, J. Solway, V. Natarajan, and Y. Zhao Lysophosphatidic Acid Enhances Pulmonary Epithelial Barrier Integrity and Protects Endotoxin-induced Epithelial Barrier Disruption and Lung Injury J. Biol. Chem., September 4, 2009; 284(36): 24123 - 24132. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Nurnberg, A. U. Brauer, N. Wettschureck, and S. Offermanns Antagonistic Regulation of Neurite Morphology through Gq/G11 and G12/G13 J. Biol. Chem., December 19, 2008; 283(51): 35526 - 35531. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Fontainhas and E. Townes-Anderson RhoA and Its Role in Synaptic Structural Plasticity of Isolated Salamander Photoreceptors Invest. Ophthalmol. Vis. Sci., September 1, 2008; 49(9): 4177 - 4187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. T. Walsh, D. Stupack, and J. H. Brown G Protein-Coupled Receptors Go Extracellular: RhoA Integrates the Integrins Mol. Interv., August 1, 2008; 8(4): 165 - 173. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Iwanicki, T. Vomastek, R. W. Tilghman, K. H. Martin, J. Banerjee, P. B. Wedegaertner, and J. T. Parsons FAK, PDZ-RhoGEF and ROCKII cooperate to regulate adhesion movement and trailing-edge retraction in fibroblasts J. Cell Sci., March 15, 2008; 121(6): 895 - 905. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Moers, A. Nurnberg, S. Goebbels, N. Wettschureck, and S. Offermanns G{alpha}12/G{alpha}13 Deficiency Causes Localized Overmigration of Neurons in the Developing Cerebral and Cerebellar Cortices Mol. Cell. Biol., March 1, 2008; 28(5): 1480 - 1488. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Schmandke, A. Schmandke, and S. M. Strittmatter ROCK and Rho: Biochemistry and Neuronal Functions of Rho-Associated Protein Kinases Neuroscientist, October 1, 2007; 13(5): 454 - 469. [Abstract] [PDF]
|
|
|
|
|
|
M. K. Cho, W. D. Kim, S. H. Ki, J.-I. Hwang, S. Choi, C. H. Lee, and S. G. Kim Role of G{alpha}12 and G{alpha}13 as Novel Switches for the Activity of Nrf2, a Key Antioxidative Transcription Factor Mol. Cell. Biol., September 1, 2007; 27(17): 6195 - 6208. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. van Zeijl, B. Ponsioen, B. N.G. Giepmans, A. Ariaens, F. R. Postma, P. Varnai, T. Balla, N. Divecha, K. Jalink, and W. H. Moolenaar Regulation of connexin43 gap junctional communication by phosphatidylinositol 4,5-bisphosphate J. Cell Biol., June 21, 2007; 177(5): 881 - 891. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-S. Kim, S. M. Lee, W. D. Kim, S. H. Ki, A. Moon, C. H. Lee, and S. G. Kim G{alpha}12/13 Basally Regulates p53 through Mdm4 Expression Mol. Cancer Res., May 1, 2007; 5(5): 473 - 484. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Meyers and J. T. Corwin Shape Change Controls Supporting Cell Proliferation in Lesioned Mammalian Balance Epithelium J. Neurosci., April 18, 2007; 27(16): 4313 - 4325. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Fu, J. Hue, and S. Li Nonsteroidal Anti-Inflammatory Drugs Promote Axon Regeneration via RhoA Inhibition J. Neurosci., April 11, 2007; 27(15): 4154 - 4164. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Ray, H. Guo, M. Patel, S. Jin, S. Bhattacharya, and L. R. Johnson Role of myosin regulatory light chain and Rac1 in the migration of polyamine-depleted intestinal epithelial cells Am J Physiol Gastrointest Liver Physiol, April 1, 2007; 292(4): G983 - G995. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yanagida, S. Ishii, F. Hamano, K. Noguchi, and T. Shimizu LPA4/p2y9/GPR23 Mediates Rho-dependent Morphological Changes in a Rat Neuronal Cell Line J. Biol. Chem., February 23, 2007; 282(8): 5814 - 5824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-P. Xu, J. Yin, and F.-S. X. Yu Lysophosphatidic Acid Promoting Corneal Epithelial Wound Healing by Transactivation of Epidermal Growth Factor Receptor Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 636 - 643. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. van Meeteren, P. Ruurs, C. Stortelers, P. Bouwman, M. A. van Rooijen, J. P. Pradere, T. R. Pettit, M. J. O. Wakelam, J. S. Saulnier-Blache, C. L. Mummery, et al. Autotaxin, a Secreted Lysophospholipase D, Is Essential for Blood Vessel Formation during Development Mol. Cell. Biol., July 1, 2006; 26(13): 5015 - 5022. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Robert, N. Smadja-Lamere, M.-C. Landry, C. Champagne, R. Petrie, N. Lamarche-Vane, H. Hosoya, and J. N. Lavoie Adenovirus E4orf4 Hijacks Rho GTPase-dependent Actin Dynamics to Kill Cells: A Role for Endosome-associated Actin Assembly Mol. Biol. Cell, July 1, 2006; 17(7): 3329 - 3344. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Rajnicek, L. E. Foubister, and C. D. McCaig Temporally and spatially coordinated roles for Rho, Rac, Cdc42 and their effectors in growth cone guidance by a physiological electric field J. Cell Sci., May 1, 2006; 119(9): 1723 - 1735. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kino, E. Souvatzoglou, E. Charmandari, T. Ichijo, P. Driggers, C. Mayers, A. Alatsatianos, I. Manoli, H. Westphal, G. P. Chrousos, et al. Rho Family Guanine Nucleotide Exchange Factor Brx Couples Extracellular Signals to the Glucocorticoid Signaling System J. Biol. Chem., April 7, 2006; 281(14): 9118 - 9126. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Sayas, A. Ariaens, B. Ponsioen, and W. H. Moolenaar GSK-3 Is Activated by the Tyrosine Kinase Pyk2 during LPA1-mediated Neurite Retraction Mol. Biol. Cell, April 1, 2006; 17(4): 1834 - 1844. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Pulinilkunnil and B. Rodrigues Cardiac lipoprotein lipase: Metabolic basis for diabetic heart disease Cardiovasc Res, February 1, 2006; 69(2): 329 - 340. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. C. Orth, S. Lang, M. Taniguchi, and K. Aktories Pasteurella multocida Toxin-induced Activation of RhoA Is Mediated via Two Families of G{alpha} Proteins, G{alpha}q and G{alpha}12/13 J. Biol. Chem., November 4, 2005; 280(44): 36701 - 36707. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Maghazachi Insights into Seven and Single Transmembrane-Spanning Domain Receptors and Their Signaling Pathways in Human Natural Killer Cells Pharmacol. Rev., September 1, 2005; 57(3): 339 - 357. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Kvachnina, G. Liu, A. Dityatev, U. Renner, A. Dumuis, D. W. Richter, G. Dityateva, M. Schachner, T. A. Voyno-Yasenetskaya, and E. G. Ponimaskin 5-HT7 Receptor Is Coupled to G{alpha} Subunits of Heterotrimeric G12-Protein to Regulate Gene Transcription and Neuronal Morphology J. Neurosci., August 24, 2005; 25(34): 7821 - 7830. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Yakubchyk, H. Abramovici, J.-C. Maillet, E. Daher, C. Obagi, R. J. Parks, M. K. Topham, and S. H. Gee Regulation of Neurite Outgrowth in N1E-115 Cells through PDZ-Mediated Recruitment of Diacylglycerol Kinase {zeta} Mol. Cell. Biol., August 15, 2005; 25(16): 7289 - 7302. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Pulinilkunnil, D. An, S. Ghosh, D. Qi, G. Kewalramani, G. Yuen, N. Virk, A. Abrahani, and B. Rodrigues Lysophosphatidic acid-mediated augmentation of cardiomyocyte lipoprotein lipase involves actin cytoskeleton reorganization Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H2802 - H2810. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yamada, Y. Ohoka, M. Kogo, and S. Inagaki Physical and Functional Interactions of the Lysophosphatidic Acid Receptors with PDZ Domain-containing Rho Guanine Nucleotide Exchange Factors (RhoGEFs) J. Biol. Chem., May 13, 2005; 280(19): 19358 - 19363. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. T. K. Singh, A. Gilchrist, T. Voyno-Yasenetskaya, J. M. Radeff-Huang, and P. H. Stern G{alpha}12/G{alpha}13 Subunits of Heterotrimeric G Proteins Mediate Parathyroid Hormone Activation of Phospholipase D in UMR-106 Osteoblastic Cells Endocrinology, May 1, 2005; 146(5): 2171 - 2175. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Vaidya, R. M. Ray, and L. R. Johnson MEK1 restores migration of polyamine-depleted cells by retention and activation of Rac1 in the cytoplasm Am J Physiol Cell Physiol, February 1, 2005; 288(2): C350 - C359. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E.-E. Govek, S. E. Newey, and L. Van Aelst The role of the Rho GTPases in neuronal development Genes & Dev., January 1, 2005; 19(1): 1 - 49. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Holst, N. D. Holliday, A. Bach, C. E. Elling, H. M. Cox, and T. W. Schwartz Common Structural Basis for Constitutive Activity of the Ghrelin Receptor Family J. Biol. Chem., December 17, 2004; 279(51): 53806 - 53817. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Nakamura, B. Kreutz, S. Tanabe, N. Suzuki, and T. Kozasa Critical Role of Lysine 204 in Switch I Region of G{alpha}13 for Regulation of p115RhoGEF and Leukemia-Associated RhoGEF Mol. Pharmacol., October 1, 2004; 66(4): 1029 - 1034. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. B. Jones, H. Y. Lu, and Q. Lu Abl Tyrosine Kinase Promotes Dendrogenesis by Inducing Actin Cytoskeletal Rearrangements in Cooperation with Rho Family Small GTPases in Hippocampal Neurons J. Neurosci., September 29, 2004; 24(39): 8510 - 8521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Zhuang, G. T. Nguyen, Y. Chen, T. Gudi, M. Eigenthaler, T. Jarchau, U. Walter, G. R. Boss, and R. B. Pilz Vasodilator-stimulated Phosphoprotein Activation of Serum-response Element-dependent Transcription Occurs Downstream of RhoA and Is Inhibited by cGMP-dependent Protein Kinase Phosphorylation J. Biol. Chem., March 12, 2004; 279(11): 10397 - 10407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. H. Suh, S. F. Oster, S. S. Soehrman, G. Grenningloh, and D. W. Sretavan L1/Laminin Modulation of Growth Cone Response to EphB Triggers Growth Pauses and Regulates the Microtubule Destabilizing Protein SCG10 J. Neurosci., February 25, 2004; 24(8): 1976 - 1986. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Yau, N. Yokoyama, Y. Goshima, Z. K. Siddiqui, S. S. Siddiqui, and T. Kozasa Identification and molecular characterization of the G{alpha}12-Rho guanine nucleotide exchange factor pathway in Caenorhabditis elegans PNAS, December 9, 2003; 100(25): 14748 - 14753. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Cen, A. Selvaraj, R. C. Burgess, J. K. Hitzler, Z. Ma, S. W. Morris, and R. Prywes Megakaryoblastic Leukemia 1, a Potent Transcriptional Coactivator for Serum Response Factor (SRF), Is Required for Serum Induction of SRF Target Genes Mol. Cell. Biol., September 15, 2003; 23(18): 6597 - 6608. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Vogt, R. Grosse, G. Schultz, and S. Offermanns Receptor-dependent RhoA Activation in G12/G13-deficient Cells: GENETIC EVIDENCE FOR AN INVOLVEMENT OF Gq/G11 J. Biol. Chem., August 1, 2003; 278(31): 28743 - 28749. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Holinstat, D. Mehta, T. Kozasa, R. D. Minshall, and A. B. Malik Protein Kinase C{alpha}-Induced p115RhoGEF Phosphorylation Signals Endothelial Cytoskeletal Rearrangement J. Biol. Chem., August 1, 2003; 278(31): 28793 - 28798. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Mulder, M. Poland, M. F. B. G. Gebbink, J. Calafat, W. H. Moolenaar, and O. Kranenburg p116Rip Is A Novel Filamentous Actin-binding Protein J. Biol. Chem., July 11, 2003; 278(29): 27216 - 27223. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gopalakrishnan, M. A. Hallett, S. J. Atkinson, and James. A. Marrs Differential regulation of junctional complex assembly in renal epithelial cell lines Am J Physiol Cell Physiol, July 1, 2003; 285(1): C102 - C111. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Hallett, P. C. Dagher, and S. J. Atkinson Rho GTPases show differential sensitivity to nucleotide triphosphate depletion in a model of ischemic cell injury Am J Physiol Cell Physiol, July 1, 2003; 285(1): C129 - C138. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Ray, S. A. McCormack, C. Covington, M. J. Viar, Y. Zheng, and L. R. Johnson The Requirement for Polyamines for Intestinal Epithelial Cell Migration Is Mediated through Rac1 J. Biol. Chem., April 4, 2003; 278(15): 13039 - 13046. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. D. Dontchev and P. C. Letourneau Growth Cones Integrate Signaling from Multiple Guidance Cues J. Histochem. Cytochem., April 1, 2003; 51(4): 435 - 444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Arai, Y. Maruyama, M. Nishida, S. Tanabe, S. Takagahara, T. Kozasa, Y. Mori, T. Nagao, and H. Kurose Differential Requirement of Galpha 12, Galpha 13, Galpha q, and Gbeta gamma for Endothelin-1-Induced c-Jun NH2-Terminal Kinase and Extracellular Signal-Regulated Kinase Activation Mol. Pharmacol., March 1, 2003; 63(3): 478 - 488. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Fournier, B. T. Takizawa, and S. M. Strittmatter Rho Kinase Inhibition Enhances Axonal Regeneration in the Injured CNS J. Neurosci., February 15, 2003; 23(4): 1416 - 1423. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Hopkins, S. V. Walsh, P. Verkade, P. Boquet, and A. Nusrat Constitutive activation of Rho proteins by CNF-1 influences tight junction structure and epithelial barrier function J. Cell Sci., February 15, 2003; 116(4): 725 - 742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Suzuki, S. Nakamura, H. Mano, and T. Kozasa Galpha 12 activates Rho GTPase through tyrosine-phosphorylated leukemia-associated RhoGEF PNAS, January 21, 2003; 100(2): 733 - 738. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. N. van Leeuwen, C. Olivo, S. Grivell, B. N. G. Giepmans, J. G. Collard, and W. H. Moolenaar Rac Activation by Lysophosphatidic Acid LPA1 Receptors through the Guanine Nucleotide Exchange Factor Tiam1 J. Biol. Chem., January 3, 2003; 278(1): 400 - 406. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E.-Y. Shin, K.-S. Shin, C.-S. Lee, K.-N. Woo, S.-H. Quan, N.-K. Soung, Y. G. Kim, C. I. Cha, S.-R. Kim, D. Park, et al. Phosphorylation of p85 beta PIX, a Rac/Cdc42-specific Guanine Nucleotide Exchange Factor, via the Ras/ERK/PAK2 Pathway Is Required for Basic Fibroblast Growth Factor-induced Neurite Outgrowth J. Biol. Chem., November 8, 2002; 277(46): 44417 - 44430. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Crowley, C.-H. Lee, S. A. Gin, A. M. Keep, R. C. Cook, and C. van Breemen The mechanism of excitation-contraction coupling in phenylephrine-stimulated human saphenous vein Am J Physiol Heart Circ Physiol, October 1, 2002; 283(4): H1271 - H1281. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Gallo, H. F. Yee Jr., and P. C. Letourneau Actin turnover is required to prevent axon retraction driven by endogenous actomyosin contractility J. Cell Biol., September 29, 2002; 158(7): 1219 - 1228. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Gudi, J. C. Chen, D. E. Casteel, T. M. Seasholtz, G. R. Boss, and R. B. Pilz cGMP-dependent Protein Kinase Inhibits Serum-response Element-dependent Transcription by Inhibiting Rho Activation and Functions J. Biol. Chem., September 27, 2002; 277(40): 37382 - 37393. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-C. Saurin, M. Fallavier, B. Sordat, J.-C. Gevrey, J.-A. Chayvialle, and J. Abello Bombesin Stimulates Invasion and Migration of Isreco1 Colon Carcinoma Cells in a Rho-dependent Manner Cancer Res., August 15, 2002; 62(16): 4829 - 4835. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Sayas, J. Avila, and F. Wandosell Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by Galpha 12 and Galpha 13 by Rho-Independent and Rho-Dependent Mechanisms J. Neurosci., August 15, 2002; 22(16): 6863 - 6875. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. J. Buchan, C.-Y. Lin, J. Choi, and D. L. Barber Somatostatin, Acting at Receptor Subtype 1, Inhibits Rho Activity, the Assembly of Actin Stress Fibers, and Cell Migration J. Biol. Chem., August 2, 2002; 277(32): 28431 - 28438. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. D. Dontchev and P. C. Letourneau Nerve Growth Factor and Semaphorin 3A Signaling Pathways Interact in Regulating Sensory Neuronal Growth Cone Motility J. Neurosci., August 1, 2002; 22(15): 6659 - 6669. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Fukushima, I. Ishii, Y. Habara, C. B. Allen, and J. Chun Dual Regulation of Actin Rearrangement through Lysophosphatidic Acid Receptor in Neuroblast Cell Lines: Actin Depolymerization by Ca2+-alpha -Actinin and Polymerization by Rho Mol. Biol. Cell, August 1, 2002; 13(8): 2692 - 2705. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. G. Ponimaskin, J. Profirovic, R. Vaiskunaite, D. W. Richter, and T. A. Voyno-Yasenetskaya 5-Hydroxytryptamine 4(a) Receptor Is Coupled to the Galpha Subunit of Heterotrimeric G13 Protein J. Biol. Chem., May 31, 2002; 277(23): 20812 - 20819. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Tian, V. Litvak, M. Toledo-Rodriguez, S. Carmon, and S. Lev Nir2, a Novel Regulator of Cell Morphogenesis Mol. Cell. Biol., April 15, 2002; 22(8): 2650 - 2662. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Chikumi, S. Fukuhara, and J. S. Gutkind Regulation of G Protein-linked Guanine Nucleotide Exchange Factors for Rho, PDZ-RhoGEF, and LARG by Tyrosine Phosphorylation. EVIDENCE OF A ROLE FOR FOCAL ADHESION KINASE J. Biol. Chem., March 29, 2002; 277(14): 12463 - 12473. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. HEUSINGER-RIBEIRO, M. EBERLEIN, N. A. WAHAB, and M. GOPPELT-STRUEBE Expression of Connective Tissue Growth Factor in Human Renal Fibroblasts: Regulatory Roles of RhoA and cAMP J. Am. Soc. Nephrol., September 1, 2001; 12(9): 1853 - 1861. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. T. Budnik and A. K. Mukhopadhyay Lysophosphatidic Acid Antagonizes the Morphoregulatory Effects of the Luteinizing Hormone on Luteal Cells: Possible Role of Small Rho-G-Proteins Biol Reprod, July 1, 2001; 65(1): 180 - 187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. U. Schraufstatter, J. Chung, and M. Burger IL-8 activates endothelial cell CXCR1 and CXCR2 through Rho and Rac signaling pathways Am J Physiol Lung Cell Mol Physiol, June 1, 2001; 280(6): L1094 - L1103. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. P. van Nieuw Amerongen and V. W.M. van Hinsbergh Cytoskeletal Effects of Rho-Like Small Guanine Nucleotide-Binding Proteins in the Vascular System Arterioscler Thromb Vasc Biol, March 1, 2001; 21(3): 300 - 311. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Zeng, P. Sachdev, L. Yan, J. L. Chan, T. Trenkle, M. McClelland, J. Welsh, and L.-H. Wang Vav3 Mediates Receptor Protein Tyrosine Kinase Signaling, Regulates GTPase Activity, Modulates Cell Morphology, and Induces Cell Transformation Mol. Cell. Biol., December 15, 2000; 20(24): 9212 - 9224. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. P. v. N. Amerongen, M. A. Vermeer, and V. W. M. van Hinsbergh Role of RhoA and Rho Kinase in Lysophosphatidic Acid-Induced Endothelial Barrier Dysfunction Arterioscler Thromb Vasc Biol, December 1, 2000; 20 (12): e127 - e133. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Gohla, G. Schultz, and S. Offermanns Role for G12/G13 in Agonist-Induced Vascular Smooth Muscle Cell Contraction Circ. Res., August 4, 2000; 87(3): 221 - 227. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Boshans, S. Szanto, L. van Aelst, and C. D'Souza-Schorey ADP-Ribosylation Factor 6 Regulates Actin Cytoskeleton Remodeling in Coordination with Rac1 and RhoA Mol. Cell. Biol., May 15, 2000; 20(10): 3685 - 3694. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wahl, H. Barth, T. Ciossek, K. Aktories, and B. K. Mueller Ephrin-A5 Induces Collapse of Growth Cones by Activating Rho and Rho Kinase J. Cell Biol., April 17, 2000; 149(2): 263 - 270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Anastasiadis and A. Reynolds The p120 catenin family: complex roles in adhesion, signaling and cancer J. Cell Sci., January 4, 2000; 113(8): 1319 - 1334. [Abstract] [PDF]
|
|
|
|
|
|
O. Kranenburg, I. Verlaan, and W. H. Moolenaar Dynamin Is Required for the Activation of Mitogen-activated Protein (MAP) Kinase by MAP Kinase Kinase J. Biol. Chem., December 10, 1999; 274(50): 35301 - 35304. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kimura, T. Tsuji, Y. Takada, T. Miki, and S. Narumiya Accumulation of GTP-bound RhoA during Cytokinesis and a Critical Role of ECT2 in This Accumulation J. Biol. Chem., June 2, 2000; 275(23): 17233 - 17236. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Bhattacharyya and P. B. Wedegaertner Galpha 13 Requires Palmitoylation for Plasma Membrane Localization, Rho-dependent Signaling, and Promotion of p115-RhoGEF Membrane Binding J. Biol. Chem., May 12, 2000; 275(20): 14992 - 14999. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Hahn, J. Heusinger-Ribeiro, T. Lanz, S. Zenkel, and M. Goppelt-Struebe Induction of Connective Tissue Growth Factor by Activation of Heptahelical Receptors. MODULATION BY Rho PROTEINS AND THE ACTIN CYTOSKELETON J. Biol. Chem., November 22, 2000; 275(48): 37429 - 37435. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Togashi, K.-i. Nagata, M. Takagishi, N. Saitoh, and M. Inagaki Functions of a Rho-specific Guanine Nucleotide Exchange Factor in Neurite Retraction. POSSIBLE ROLE OF A PROLINE-RICH MOTIF OF KIAA0380 IN LOCALIZATION J. Biol. Chem., September 15, 2000; 275(38): 29570 - 29578. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. P. G. van Horck, M. R. Ahmadian, L. C. Haeusler, W. H. Moolenaar, and O. Kranenburg Characterization of p190RhoGEF, A RhoA-specific Guanine Nucleotide Exchange Factor That Interacts with Microtubules J. Biol. Chem., February 9, 2001; 276(7): 4948 - 4956. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Linseman, K. A. Heidenreich, and S. K. Fisher Stimulation of M3 Muscarinic Receptors Induces Phosphorylation of the Cdc42 Effector Activated Cdc42Hs-associated Kinase-1 via a Fyn Tyrosine Kinase Signaling Pathway J. Biol. Chem., February 16, 2001; 276(8): 5622 - 5628. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. van der Wal, R. Habets, P. Varnai, T. Balla, and K. Jalink Monitoring Agonist-induced Phospholipase C Activation in Live Cells by Fluorescence Resonance Energy Transfer J. Biol. Chem., April 27, 2001; 276(18): 15337 - 15344. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Sagi, T. M. Seasholtz, M. Kobiashvili, B. A. Wilson, D. Toksoz, and J. H. Brown Physical and Functional Interactions of Galpha q with Rho and Its Exchange Factors J. Biol. Chem., April 27, 2001; 276(18): 15445 - 15452. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Siehler, Y. Wang, X. Fan, R. T. Windh, and D. R. Manning Sphingosine 1-Phosphate Activates Nuclear Factor-kappa B through Edg Receptors. ACTIVATION THROUGH Edg-3 AND Edg-5, BUT NOT Edg-1, IN HUMAN EMBRYONIC KIDNEY 293 CELLS J. Biol. Chem., December 21, 2001; 276(52): 48733 - 48739. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Gilchrist, J. F. Vanhauwe, A. Li, T. O. Thomas, T. Voyno-Yasenetskaya, and H. E. Hamm Galpha Minigenes Expressing C-terminal Peptides Serve as Specific Inhibitors of Thrombin-mediated Endothelial Activation J. Biol. Chem., July 6, 2001; 276(28): 25672 - 25679. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. D. Wells, S. Gutowski, G. Bollag, and P. C. Sternweis Identification of Potential Mechanisms for Regulation of p115 RhoGEF through Analysis of Endogenous and Mutant Forms of the Exchange Factor J. Biol. Chem., July 27, 2001; 276(31): 28897 - 28905. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-S. Shi, S. Sinnarajah, H. Cho, T. Kozasa, and J. H. Kehrl G13alpha -mediated PYK2 Activation. PYK2 IS A MEDIATOR OF G13alpha -INDUCED SERUM RESPONSE ELEMENT-DEPENDENT TRANSCRIPTION J. Biol. Chem., August 4, 2000; 275(32): 24470 - 24476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M. Seasholtz, T. Zhang, M. R. Morissette, A. L. Howes, A. H. Yang, and J. H. Brown Increased Expression and Activity of RhoA Are Associated With Increased DNA Synthesis and Reduced p27Kip1 Expression in the Vasculature of Hypertensive Rats Circ. Res., September 14, 2001; 89(6): 488 - 495. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
