![]() |
|
|
Vol. 10, Issue 6, 1923-1938, June 1999


*Cell Biology Unit, Glaxo-Wellcome Research and Development,
Stevenage, Hertfordshire, SG1 2NY, United Kingdom;
Department of Molecular and Cell Biology, Howard Hughes
Medical Institute, University of California, Berkeley, California
94720;
Biotechnology Research Institute, National
Research Council of Canada, Montreal, Quebec, Canada H4P 2R2; and
§Department of Anatomy and Cell Biology, McGill
University, Montreal, Quebec, Canada H3A 2B2
| |
ABSTRACT |
|---|
|
|
|---|
Six new members of the yeast p24 family have been identified and characterized. These six genes, named ERP1-ERP6 (for Emp24p- and Erv25p-related proteins) are not essential, but deletion of ERP1 or ERP2 causes defects in the transport of Gas1p, in the retention of BiP, and deletion of ERP1 results in the suppression of a temperature-sensitive mutation in SEC13 encoding a COPII vesicle coat protein. These phenotypes are similar to those caused by deletion of EMP24 or ERV25, two previously identified genes that encode related p24 proteins. Genetic and biochemical studies demonstrate that Erp1p and Erp2p function in a heteromeric complex with Emp24p and Erv25p.
| |
INTRODUCTION |
|---|
|
|
|---|
Transport between organelles of the secretory pathway is
mediated by membrane-bound vesicles that bud from the surface of a
donor membrane and specifically fuse with a target membrane (Palade,
1975
). Genetic and biochemical studies have identified key proteins
that mediate this process, many of which are conserved from yeast to
mammalian cells (Rothman and Wieland, 1996
; Schekman and Orci, 1996
).
In the early secretory pathway, between the endoplasmic reticulum (ER)
and the Golgi apparatus, transport in the anterograde direction is
mediated via vesicles coated with a protein complex termed COPII
(Barlowe et al., 1994
; Kuehn and Schekman, 1997
; Kaiser and
Ferro-Novick, 1998
). Anterograde transport is balanced by a retrograde
transport pathway, mediated by COPI-coated vesicles, that facilitates
the recovery of membrane, ER resident proteins and limiting vesicle
targeting and fusion proteins back to the ER from later compartments of
the secretory pathway (Letourneur et al., 1994
; Cosson and
Letourneur, 1997
). COPI-coated vesicle populations have also been
implicated in intra-Golgi anterograde and retrograde transport
(Orci et al., 1997
) and endocytosis (Daro et al.,
1997
) and have been observed to bud directly from the ER (Bednarek
et al., 1995
).
Recent biochemical and genetic approaches in yeast, mammalian systems,
and frog have identified a conserved family of 23- to 27-kDa type I
transmembrane proteins that have been termed the p24 family. The
function of these proteins is currently unknown, but it is clear from
several lines of evidence that p24 proteins play an important role in
the early secretory pathway (Wada et al., 1991
; Holthuis
et al., 1995
; Schimmöller et al., 1995
;
Stamnes et al., 1995
; Belden and Barlowe, 1996
; Blum
et al., 1996
; Fiedler et al., 1996
; Sohn et
al., 1996
; Rojo et al., 1997
; Dominguez et
al., 1998
). Members of this protein family all contain a single membrane-spanning domain with a short cytoplasmic C-terminal
tail that, in a subset of p24 proteins, contains a motif related to the
KKXX or K(X)KXX motif previously implicated in retrieval to the ER
(Nilsson et al., 1989
; Jackson et al., 1990
).
Consistent with these observations, some p24 proteins have been
demonstrated to bind subunits of both COPI and COPII vesicle coats in
vitro (Fiedler et al., 1996
; Sohn et al., 1996
;
Dominguez et al., 1998
). p24 proteins have been found in
both COPI and COPII vesicles in addition to ER and Golgi membranes
(Schimmöller et al., 1995
; Stamnes et al.,
1995
; Belden and Barlowe, 1996
; Sohn et al., 1996
; Rojo
et al., 1997
; Dominguez et al., 1998
).
In the budding yeast Saccharomyces cerevisiae two members of
the p24 family, encoded by the EMP24 and ERV25
genes, have been previously identified (Schimmöller et
al., 1995
; Belden and Barlowe, 1996
). Cell fractionation
experiments have demonstrated that Emp24p is predominantly ER localized
with some Emp24p in the Golgi apparatus (Schimmöller et
al., 1995
). Analysis of the steady-state distribution of Erv25p by
indirect immunofluorescence has revealed a similar localization. Emp24p
and Erv25p interact with one another in stoichiometric amounts in a
complex in ER-derived membranes (Belden and Barlowe, 1996
). In
addition, both Emp24p and Erv25p are major proteins in COPII-coated
vesicles. Furthermore, Emp24p and Erv25p are dependent on each other
for stability and incorporation into COPII-coated vesicles (Belden and
Barlowe, 1996
).
Neither EMP24 nor ERV25 is an essential
gene, but strains containing deletions in either gene exhibit delays in
the ER-to-Golgi transport of a subset of secretory cargo molecules
(Schimmöller et al., 1995
; Belden and Barlowe, 1996
).
These observations, taken together with the type I topology of p24
proteins, and the binding of vesicle coat proteins to their cytoplasmic
tails in vitro, have led to the suggestion that members of the p24
family may function as receptors or adaptors for cargo in the early
secretory pathway (Schimmöller et al., 1995
; Stamnes
et al., 1995
; Belden and Barlowe, 1996
). In this model the
short cytosolic C-terminal tails of p24 proteins would interact with
vesicle coat proteins, whereas the larger lumenal domains, and perhaps
transmembrane regions, might interact with cargo molecules. There is
currently no direct evidence in support of this hypothesis, however. A
further possibility is that p24 proteins play a role in vesicle
biogenesis. However, using an in vitro assay for the formation of ER
transport vesicles, Belden and Barlow (1996)
have demonstrated that
membranes derived from emp24, erv25, and even
emp24/erv25 double mutants exhibit normal vesicle
formation characteristics, although genetic experiments implicate at
least Emp24p in the fidelity of ER-derived vesicle formation (Stamnes
et al., 1995
; Elrod-Erickson and Kaiser, 1996
). A further
possibility is that p24 proteins may play a structural role in the
early secretory pathway.
In this study we have identified and characterized six additional p24 family members in S. cerevisiae. We have called these genes ERP1-ERP6 (for Emp24p- and Erv25p-related proteins). We find that deletion of two of these genes, called ERP1 and ERP2, results in phenotypes similar to those caused by deletion of EMP24 or ERV25. Genetic and biochemical experiments suggest that Emp24p, Erv25p, Erp1p, and Erp2p function together in a heteromeric complex.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains, Plasmids, and Growth Media
Yeast strains used in this study are listed in Table
1. Standard yeast genetic and molecular
techniques were used. Yeast cells were grown in either YPD or
YNB media supplemented as necessary (Kaiser et al.,
1994
). The p24 deletion mutants were generated by replacing each
ORF with the HIS3 gene in a haploid segregant of
YPH274 (DHY9) using standard PCR techniques. Primer sequences were
GAACAGATTGTTGGCGCTTTCTTCCTTATCGCCTCAATCTGA-AAGGATCTAGATTTGCCACGTTTTAAGAGCTTGGT and
AT-TGAAACAACGAAATTCTCATGTATGCCTGCTAAGGATTCAATTTTTTGATATGTACGGTCGAGTTCAAGAGAAAA (ERP6, YGL002w),
GTGTAATACTACTAGTTACTTAAGGGAACACATCAAG-CATTCGGTGTCTCACAGGCTACTCGTTTTAAGAGCTTGGT and
AGCTCATTGCACCGATTGCACCGATTCGTAATGAGCGATATATAAACTCTATATAACAAACATGGTATATCGAGTTCAAGAGAAAA (ERP5, YHR110w),
TACTTGGTGAAACTGCAATCTTAATA-GTATCCCTCCGCACAAAAATACACACGCATAAGGCGTTTTA-AGAGCTTGGT and
CGTGTATGTAATCGTATGTAGGCAA-AAGTAAATAGATATGAACTACATTTTCCTGCTTTACTCGAGT-TCAAGAGAAAA (EMP24),
AGCTGGGGCCTACCTTTATAGT-TAGTTGTATAACTCAGTTGATCTCATAAGTGAAAAGCAAAA-AAAGGCGTTTTAAGAGCTTGGT and
ATAGTCGAGTACATATGCAATTATAGGGTAAGCTGATACACAAATGCATGGTGTGGTC-CTCTTCCTTTGCTCGAGTTCAAGAGAAAA (ERV25),
TGAAG-TAGTTTCACGAGCGCTAGTGAAGTTTTTTCATAAATATATAT-TCCCAATCATCGCTAGGAATTCGTTTTAAGAGCTTGGT and
TCATGATACAAAAAAGTGCCTTCCCCTTAGCACAGCTGATC-AACAATTTTAAGAGCTTGAAAAGCAACTCGAGTTCAAGAGAAAA (ERP4,YOR016C),
AAGGCTCTTGATAGTTACCGTACTTG-AAGGGACACTGTGAACTGACTAAAAAACTCCGTCCGTTTTA-AGAGCTTGGT and
TAAATATGAAGAACATATTCTCAAGTT-GATAGAAAATGCAGGAACAATACACAACTATTCGAGTTCAA-GAGAAAA (ERP3, YDL018C),
TCAGGTGACCCAAACTAGAA-TAAGATAAACAGTGGAGTACACTCATTGTAAAGGAAAACC-CGTTTTAAGAGCTTGGT and
AATATAAACCTAATTGTG-TTCTATATTGCGGACATATATTTTTCGTAGATTGAAAAGTTC-TCGAGTTCAAGAGAAAA (ERP2, YAL007), and
CTCTAT-CTTCCCTCTGTAGTTTGGAAAAGTATTTAAAGGTAACCAAT-CTCTCTACTAATCCGTTTTAAGAGCTTGGT and
CTTTAGCG-GCTCTTATAAACTATAAATTTCTAGAAGATACATAAAAGGTTTTTAGTCTGATCGAGTTCAAGAGAAAA (ERP1, YAR002A). Underlined sequences are derived from the
HIS3 locus. The entire p24 ORF was precisely replaced in
each case. The deletion of each gene was verified by PCR. Double,
triple, and quadruple p24 mutants were created by PCR genotyping
segregants from diploids generated by crossing haploid deletion
strains. The sec13-1 mutation in CKY45 was back-crossed
three times into the YPH274 genetic background to generate strain ARY63
suitable for crossing with the p24 deletion mutants. The
sec13-1 locus in ARY63 was then genetically marked with
URA3 by cloning a region of SEC13 downstream
flanking sequence (+884 to +1277 from ATG) into vector YEP352 (Hill
et al., 1986
) and integrating this construct at the
sec13-1 locus by linearizing with EagI before
transformation. Correct integration was verified by PCR analysis of
genomic DNA. This URA3 marker allowed us to follow the
sec13-1 locus in genetic crosses with the p24 deletion
mutants independently of its temperature-sensitive phenotype.
Overexpression of yeast p24 genes was achieved by cloning each p24 ORF
behind the triose phosphate isomerase (TPI) promotor in a modified
version of plasmid TP
H (Dean and Pelham, 1990
) in which the
EcoRI-SalI cassette was replaced by the p24 ORFs amplified by PCR. Constructs were integrated into ura3 after
cleavage with XhoI.
|
Invertase Assay
Cells were grown to midlogarithmic phase in YPD medium,
harvested, and washed, and 10 OD600 units of cells were
transferred to medium (20 ml) containing 0.1% glucose for 1 h to
induce invertase synthesis. The cells were then collected by
centrifugation, washed twice with ice-cold sodium azide (10 mM), and
resuspended in 0.1 ml of 1.4 M sorbitol, 50 mM Tris-HCl, pH 7.5, and 40 mM
-mercaptoethanol containing 50 U of lyticase. After 30 min
incubation at 30°C, spheroplasts were sedimented at 3000 × g for 10 min and lysed by resuspension in 50 mM Tris-HCl, pH
7.5, and 0.1% Triton X-100. Samples corresponding to 1 OD600 unit of cells were electrophoresed on 8%
nondenaturing polyacrylamide gels at 4°C. Invertase was localized in
gels after incubation in 0.1 M sodium acetate, pH 5.1, containing 0.1 M
sucrose for 30-60 min at 30°C as described (Grossmann and
Zimmermann, 1979
).
Preparation of Protein Samples, Electrophoresis, and Immunoblotting
To assay Gas1p transport, cells were grown to
midlogarithmic phase, and 2 OD600 units were spun down and
resuspended in 100 µl of Laemmli sample buffer containing 5 mM
-mercaptoethanol. Glass beads were added, and the cells were lysed
in a bead beater (Biospec Products, Bartlesville, OK). Lysates
were boiled and loaded onto 8% SDS-polyacrylamide gels. After transfer
to nitrocellulose membranes, blots were incubated with primary and
secondary antibodies, and bands were detected using ECL (Amersham
Pharmacia Biotech, Uppsala, Sweden). Gas1p antiserum (provided by H. Riezman, University of Basel, Basel, Switzerland) was used at a
1:30,000 dilution. Goat anti-rabbit secondary antibody (Jackson
ImmunoResearch, West Grove, PA) was used at a 1:15,000 dilution.
To monitor Kar2p secretion, exponentially growing cells were washed, resuspended in fresh medium, and incubated at 30°C. Samples (0.3 OD600 units of cells) were taken at t = 0, 2, and 4 h (see Figure 4) or at 4.5 h (see Figure 6) and centrifuged for 5 min. Proteins from cell supernatants were precipitated by addition of trichloroacetic acid (TCA) to a final concentration of 10% with the addition of 5 µg of ovalbumin as carrier and to serve as a standard to monitor transfer efficiency. Kar2p was detected by SDS-PAGE (4-20% gels) and Western blotting with an anti-Kar2p antibody (1:10,000 dilution; kindly provided by Mark Rose, Princeton University, Princeton, NJ).
Protein extracts for the analysis of Emp24p, Erv25p, Erp1p, and Erp2p
were prepared from 10 OD600 units of a log phase culture resuspended in 300 µl of 10% TCA. Cells were lysed by vigorous agitation in the presence of glass beads. Crude extracts were spun at
maximum speed in a microcentrifuge, and the resulting pellets were
washed with cold acetone. Pellets were resuspended in 200 µl of
Laemmli sample buffer containing 5 mM
-mercaptoethanol, and proteins
were resolved on 12% polyacrylamide gels. Antisera to Emp24p (provided
by H. Riezman) and Erv25p (provided by C. Barlowe, Dartmouth Medical
School, Hanover, NH) were used at 1:5000 and 1:2000 dilutions,
respectively. Antiporin mAb 16G9-E6 (Molecular Probes, Eugene, OR) was
used at 0.5 µg/ml.
Erp1p antibodies were raised in rabbits to a C-terminal peptide (CQMKHLGKFFVKQKIL). Peptide was coupled via the N-terminal cysteine residue to keyhole limpet hemacyanin using maleimide (SMCC; Pierce, Rockford, IL) as the cross-linker. An initial subcutaneous injection of an emulsion of peptide in complete Freund's adjuvant was followed by four boosts of peptide (100 µg each) in incomplete adjuvant. Erp1p antiserum was used at a 1:1000 dilution. The Erp1 antiserum was affinity purified by conjugating peptide to Sulfolink coupling gel (6% cross-linked agarose column containing immobilized iodacetyl groups; Pierce). Any remaining sites were blocked with 50 mM cysteine in 50 mM Tris and 5 mM EDTA, pH 8.5. Elution was with 0.1 M glycine, pH 2.5. Fractions were collected and neutralized with 1 M Tris, pH 8.0. Antibodies against Erp2p were raised in rabbits to an N-terminal peptide (SKECLYYDMVTEDDC, amino acids 40-53) and were used at a 1:500 dilution.
Radiolabeling and Immunoprecipitation
Cells were grown to midlogarithmic phase in minimal medium with
2% glucose. Cell samples (5 OD600 units) were collected by centrifugation, washed once with medium, and resuspended in 1 ml of
fresh minimal medium. After 10 min at 30°C, 100 µCi of Trans 35S label (ICN Biochemicals, Costa Mesa, CA) were added,
and cells were incubated for 5 min. The chase period was initiated by
adding 120 µl of 10× chase solution (50 mM methionine and 10 mM
cysteine) to a 1× final concentration. At the indicated time points,
labeled samples of 1 OD600 unit of cells were collected and
chilled on ice in the presence of 20 mM NaN3 and 20 mM NaF.
Cell lysis with glass beads and immunoprecipitation of Gas1p were
performed as described (Horvath et al., 1994
). The samples
were resolved on 8% SDS-polyacrylamide gels. The gels were fixed,
dried, and visualized in a Molecular Dynamics (Sunnyvale, CA) PhosphorImager.
For precipitation of Erp1 protein complexes cells were grown to midlogarithmic phase in YEPD medium. Approximately 100 OD units of cells were harvested, washed one time in PBS, and resuspended in 1 ml of ice-cold RIPA assay (150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS, and 50 mM Tris-HCl, pH 8.0) containing protease inhibitors (Complete; Boehringer Mannheim, Mannheim, Germany). The cells were lysed in the presence of glass beads (0.5 mm) by vortexing vigorously seven times for 1 min in 50-ml tubes. The lysates were centrifuged at 500 × g to remove unbroken cells, and the supernatant (~900 µl) was transferred to 1.5-ml Eppendorf tubes. Triton X-100 was added to a 1% final concentration, and the samples were incubated on ice for 45 min. The lysates were then agitated for 20 min at 4°C with 50 µl of protein A-Sepharose beads (Amersham Pharmacia Biotech). After this preclearing step, 5 µl of affinity-purified anti-Erp1p antibody (4 mg/ml) was added, and the samples were incubated overnight at 4°C with end-over-end rotation. Protein A-Sepharose beads (30 µl) were added, and the samples were agitated for an additional 1 h at 4°C. The immune complexes were collected by centrifugation, washed three times with TNET (100 mM Tris-HCl, pH 8.0, 100 mM NaCl, 5 mM EDTA, and 1% Triton X-100), one time in TNE (TNET without Triton X-100), and dissociated with 40 µl of twofold concentrated SDS sample buffer. One-fifth of each sample per lane was separated by SDS-PAGE. To quantify the levels of Erp1p, Erp2p, Emp24p, and Erv25p in the immunoprecipitates, equal amounts of starting material, immunoprecipitation fraction, and depleted fraction were analyzed by Western blotting with antibodies against the individual p24 proteins followed by densitometric analysis.
Gel Filtration Chromatography
Yeast cells were converted to spheroplasts as described (Rexach
et al., 1994
) and lysed in 4% octyl glucoside, 100 mM NaCl, 10% glycerol, 2 mM PMSF, and 20 mM HEPES, pH 7.5, at a protein concentration of 5 mg/ml. The extract was cleared by centrifugation (100,000 × g for 30 min at 4°C), and 200 µl of the
resulting supernatant were applied to a Superose 6 HR 10/30 gel
filtration column (Amersham Pharmacia Biotech). The run was performed
in 1% octyl glucoside, 100 mM NaCl, 10% glycerol, and 20 mM HEPES, pH
7.5, at a flow rate of 0.25 ml/min, and 500-µl fractions were
collected. The fractionation was calibrated by
immunoblotting against protein complexes of known size
and by a parallel run of molecular weight markers (Amersham Pharmacia Biotech).
Accession Numbers
The p24 genes in this study have the following GenBank accession numbers: EMP24, 1322830; ERV25, 854478; ERP1 (YAR002CA), 1339991; ERP2 (YAL007C), 349746; ERP3 (YDL018C), 1430986; ERP4 (YOR016C), 1420117; ERP5 (YHR110W), 529120; and ERP6 (YGL002W), 1322449.
| |
RESULTS |
|---|
|
|
|---|
The Yeast p24 Gene Family Contains Eight Nonessential Genes
Comparison of Emp24p and Erv25p with the complete yeast
genome sequence revealed six ORFs coding for putative proteins which share overall structural and sequence similarity with Emp24p and Erv25p
(Figure 1A). Each predicted protein
contains a hydrophobic region that might serve as an N-terminal signal
sequence and is probably cleaved at the positions indicated. Near the
predicted C terminus of each predicted protein there is a
further stretch of hydrophobic residues capable of spanning the lipid
bilayer. It is highly likely therefore that, like EMP24 and
ERV25, these new genes encode type I transmembrane proteins
with short (10- to 12-amino acid) cytoplasmically exposed C termini and
larger N-terminal lumenal domains. The yeast genome sequence is
complete, and therefore this is the first case in which the complete
complement of p24 proteins in one organism has been identified. We have
named these new p24 genes ERP1 (YAR002CA), ERP2
(YAL007C), ERP3 (YDL018C), ERP4 (YOR016C),
ERP5 (YHR110W), and ERP6 (YGL002W) for Emp24p- and Erv25p-related proteins. The similarity of each of the eight yeast
p24 proteins to those previously identified in other species is shown
in Figure 1B.
|
To characterize the function of the eight yeast p24 proteins, we individually replaced each of the p24 genes with a HIS3 marker by a PCR-mediated disruption protocol. The resulting deletion strains were all viable and displayed growth that was indistinguishable from the isogenic wild-type strain YPH274 at all temperatures tested (14, 20, 30, and 37°C).
Protein Transport Defects in p24 Mutants
Previous studies have determined that mutations in
EMP24 and ERV25 result in selective cargo
transport defects of anterograde cargo proteins, including Gas1p and
invertase (Schimmöller et al., 1995
; Belden and
Barlowe, 1996
). These results suggested a role for the Emp24p and
Erv25p proteins in selective ER-to-Golgi transport. To examine the
potential role of the six additional p24-related proteins in protein
trafficking, we first assessed transport of invertase (Figure
2). Invertase is synthesized and is
modified by the addition of N-linked oligosaccharides in the ER. Upon
transport to the Golgi, invertase is further modified by extensive
elongation of these carbohydrate side chains to generate a
heterogeneous 100- to 150-kDa population of hyperglycosylated molecules. This latter form of invertase is rapidly secreted into the
periplasmic space. To assay invertase secretion, cells were incubated
in low-glucose YEP medium at 30°C to derepress invertase synthesis.
Cells were converted to spheroplasts and then separated by
centrifugation into internal and external fractions. Samples of both
fractions were subjected to nondenaturing gel electrophoresis, and the
gels were stained for invertase activity. In the
EMP24::HIS3 deletion strain (DHY3) we observed a
significant accumulation of core glycosylated invertase in the internal
fraction, in contrast to wild-type cells (DHY9), in which little
invertase was present in the internal fraction (Figure 2). In addition,
the mature invertase in the external fraction was hypoglycosylated
(indicated by increased electrophoretic mobility) relative to invertase
in the external fraction in wild-type cells. This result is consistent
with earlier pulse-chase analysis that indicated both delayed
invertase secretion and underglycosylation of secreted invertase in a
strain deleted for EMP24 (Schimmöller et
al., 1995
). An identical observation was made for cells carrying a
deletion of the ERV25 gene. This new finding is consistent
with previous data demonstrating a physical interaction between these
two gene products in COPII-coated vesicles (Belden and Barlowe, 1996
).
Using this assay we observed no internal accumulation or
hypoglycosylation of secreted invertase in any of the six additional
p24 deletion strains. It is therefore unlikely that these additional
six members, individually at least, are required for efficient
invertase transport.
|
To assess the transport of the GPI-anchored protein Gas1p we first
monitored the accumulation of Gas1p precursor by Western blot analysis.
Gas1p is synthesized as a 105-kDa GPI-anchored precursor containing
N- and O- linked core oligosaccharides that is
modified in the Golgi to generate a 125-kDa mature protein. Figure
3A demonstrates that, as expected from
earlier analysis, EMP24::HIS3 (DHY3) and
ERV25::HIS3 (DHY4) deletion strains
contain significantly more 105-kDa Gas1p precursor than wild-type cells (DHY9). Precursor accumulation was slightly more pronounced in the case
of the emp24 deletion strain than in the erv25
deletion strain. In addition, strains deleted for two additional p24
genes, ERP1 (DHY8) and ERP2 (DHY7), exhibited an
accumulation of Gas1p precursor (Figure 3A). To assess this phenotype
more carefully in the case of DHY8 (ERP1::HIS3),
we analyzed Gas1p transport by pulse-chase analysis. Cells were pulse
labeled with 35S-Cys/Met for 5 min and then chased with an
excess of unlabeled amino acids. Like emp24- and
erv25-null strains, the erp1 deletion strain
exhibited a significant delay in Gas1p maturation (Figure 3B). This
result suggests that proteins encoded by genes ERP1 and
ERP2 play a role similar to Emp24p and Erv25p in Gas1p
transport.
|
Members of the p24 family have been postulated to encode cargo
receptors or adaptors for ER-to-Golgi transport (Schimmöller et al., 1995
; Stamnes et al., 1995
; Belden and
Barlowe, 1996
). We therefore considered the possibility that p24 family
members not affected in Gas1p or invertase secretion might be involved in transport of, for example, carboxypeptidase Y (CPY) or the pheromone
precursor prepro-
-factor. To obtain a measure of any defect in CPY
transport we looked for accumulation of CPY precursor in p24
deletion strains by Western blot analysis. In all p24 mutants CPY
was processed to the mature form, and no accumulation of the precursor
was observed (our unpublished results). This result argues that
transport of CPY in p24 deletion strains is normal, although by this
analysis we cannot exclude the possibility of very minor delays.
Similarly, pulse-chase analysis has revealed no defect in
-factor
transport in any of the p24 mutants constructed so far (our unpublished results).
Kar2p Secretion in p24 Mutants
Previous analysis has demonstrated that deletion of
EMP24 results in the secretion of Kar2p (BiP) into
the culture supernatant (Elrod-Erickson and Kaiser, 1996
). To determine
whether a deletion of any other p24 gene might result in a similar
phenotype, we washed cells growing in exponential cultures with fresh
medium to remove previously secreted Kar2p, and then proteins secreted into the culture supernatant after 2 and 4 h of incubation in fresh medium were TCA-precipitated before detecting Kar2p by Western blotting. Figure 4 shows a representative
experiment demonstrating that, like deletion of EMP24,
deletion of ERV25 results in significant levels of Kar2p
secretion into the culture supernatant. Densitometric analysis of these
data indicates that after a 4-h incubation in fresh medium,
emp24 mutants secrete at least 15 times more BiP, and
erv25 mutants secrete at least 14 times more BiP than
wild-type cells. Two additional mutants show marked increases in the
amount of BiP secretion into the growth medium; a strain deleted for ERP1 (DHY8) secretes at least 12 times more Kar2p, and an
erp2 deletion strain (DHY7) secretes at least nine times
more BiP than wild-type cells in the same experiment (Figure 4).
Remaining deletion strains all secrete more BiP than wild-type cells,
but the differences are less marked (all less than fivefold more BiP
than wild-type cells). All mutants contained identical amounts of
intracellular Kar2p as determined by Western blot analysis of total
cell extracts. These results further suggest that Erp1p and Erp2p share
a similar function with Emp24p and Erv25p.
|
Genetic Interactions of p24 Mutations
Mutations in EMP24 have previously been identified as
bypass of SEC13 deletion (bst1) mutations
(Elrod-Erickson and Kaiser, 1996
);
sec13 bst1 double
mutants are viable, whereas sec13-null mutants are otherwise
inviable. We tested the ability of deletion mutations in each of
ERP1-ERP6, as well as in ERV25, to
suppress a temperature-sensitive sec13-1 mutation. A cross
between a sec13-1 temperature-sensitive strain and strains
bearing mutations in either ERP1-ERP6 or ERV25
generated four viable spore products in all cases when spore
germination was perfomed at 23°C. The ability of all segregants from
at least two tetratype tetrads to grow at temperatures of 25, 30, 31, 32, 33, 34, 35, 36, and 37°C was tested by spotting 5 µl of 10-fold
serial dilutions from a log phase culture onto YEPD plates. In this
experiment emp24 sec13-1 double mutants were able to grow at
temperatures up to 33°C, whereas a sec13-1 mutant was
unable to grow at temperatures >30°C. Figure
5 demonstrates that mutations in two
additional genes, ERV25 and ERP1, produced a
similar phenotype in combination with a sec13-1
temperature-sensitive mutation. Both sec13-1
erv25::HIS3 and sec13-1 erp1::HIS1
strains grew at temperatures up to 33°C, whereas sec13-1
segregants from the same tetrad were unable to grow at temperatures
>30°C. In all other cases (strains deleted for ERP2,
ERP3, ERP4, ERP5, or ERP6)
we observed no sec13-1 suppression at any temperature.
|
One explanation for the lack of identifiable phenotypes in four of the
p24 deletion strains is that there is functional redundancy among
family members (Figure 1B). To address this possibility we created
double mutants in all of the most closely related pairs of p24 genes
(all pair-wise combinations of ERP1, ERP5, and
ERP6 and all pair-wise combinations of ERP2,
ERP3, and ERP4). The identity between these gene
pairs ranges from 70% in the case of ERP2 and ERP4 to 28% in the case of ERP3 and
ERP2. In all cases these double mutants were viable and
exhibited no significant growth defects. When we examined secretion of
Kar2p in these double mutants we found no evidence of additive
phenotypes; each double mutant secreted the same amount of Kar2p as the
most severely affected single mutant. Double mutants, furthermore,
showed no evidence of delays in CPY transport or
-factor secretion
(our unpublished results). To test this still further, we constructed
triple mutants of ERP1, ERP5, and ERP6
(ARY101) and ERP2, ERP3, and ERP4
(ARY102). These comprise all the yeast members of the
and
/
families, respectively, according to the terminology recently suggested
by Dominguez et al. (1998)
(also see Figure 1B). As before,
no growth defects were observed in these triple mutants, and no defects
in CPY and
-factor secretion were detected (our unpublished
results). Furthermore, we detected no additive effects on Kar2p or
Gas1p secretion.
Deletions in three genes, EMP24, ERV25, and ERP1, exhibit similar phenotypes with respect to Gas1p transport, Kar2p secretion, and sec13-1 suppression. These genes are not the most closely related at the amino acid sequence level; for example, Emp24p and Erv25p are the most closely related and are only 26% identical. Nevertheless, it remains possible that these gene products play redundant roles in transport. To test this idea and to examine the possibility that deletions in these genes might reveal synthetic interactions, we constructed a triple erp1, emp24, and erv25 deletion strain (ARY103). This strain was viable and exhibited no growth defects or further defects in protein transport. Deletion of ERP2 also results in similar defects in Gas1p and Kar2p transport. We also therefore constructed a strain (ARY104) containing disruptions of all four genes (EMP24, ERV25, ERP1, and ERP2) with similar defects in Gas1p and Kar2p transport. This strain was also viable and displayed no growth defects or additive effect on the Kar2p secretion phenotype.
To take a different approach we tested whether moderate overexpression
of related p24 genes from the TPI promotor might complement the Kar2p
secretion defect of erp1 and erp2 mutants.
TPI-p24 constructs were individually introduced into erp1
and erp2 mutants, and the Kar2p secreted over a 4.5-h
incubation was measured by Western blot analysis. Growth rates of all
strains were identical, and these levels of p24 overexpression did not
lead to an increase in Kar2p secretion in wild-type cells. The results
shown in Figure 6 demonstrate that in
both cases, introduction of the wild-type gene lowered the amount of
Kar2p secreted by erp1 and erp2 mutant cells as
expected (Figure 6, compare lanes 1 and 2). The amount of Kar2p
secreted by these complemented mutants was indistinguishable from that
secreted by wild-type cells. Normal Kar2p secretion in erp1
mutants was restored by both ERP1 and ERP6,
whereas the defect in erp2 mutants was suppressed by both
ERP2 and ERP4. Overexpression of EMP24
or ERV25 had no effect on the level of Kar2p secreted by
either mutant. ERP6 is very closely related to
ERP1 (58% identical), whereas ERP4 is closely
related to ERP2 (70% identical) (Figure 1B). These results
demonstrate that the function of ERP1 can be substituted by
elevated levels of ERP6 and that ERP2 function can be substituted by ERP4, at least as measured by Kar2p
secretion. This is the first evidence of functional redundancy among
p24 proteins.
|
p24 Protein Levels Are Interdependent
The biochemical and genetic experiments described above suggest
that Emp24p, Erv25p, Erp1p, and Erp2p function in a cooperative manner.
We therefore considered the possibility that these four proteins may
interact in a protein complex. This idea is consistent with earlier
results demonstrating that Erv25p and Emp24p can be cross-linked
together in COPII-coated vesicles and that the stability of these
proteins is interdependent (Belden and Barlowe, 1996
). To address the
question of whether Erp1p and Erp2p interact with Emp24p or Erv25p at a
biochemical level, we examined the levels of Emp24p and Erv25p in
emp24, erv25, erp1, and
erp2 deletion strains. As expected, Emp24p was not detected
in an emp24 deletion strain (DHY3); similarly, strains
carrying an ERV25 deletion contained no Erv25 protein (DHY4)
(Figure 7, lanes 5 and 6). Consistent with earlier analyses, Erv25 protein levels were significantly lower,
in our experiments almost undetectable, in a strain deleted for
EMP24 than in wild-type cells (Figure 7, compare lanes 6 and 9). Previous analysis has demonstrated that this is due to a decrease in Erv25p stability in the absence of Emp24p (Belden and Barlowe, 1996
). Also consistent is our observation of a threefold decrease in
Emp24p protein level in an erv25 deletion strain (Figure 7, lane 5). Significantly, both Emp24p and Erv25p levels were lower in
strains deleted for ERP1 (DHY8) or ERP2 (DHY7)
than in wild-type cells (Figure 7, lanes 1 and 2). Densitometric
analysis of these data suggests that Emp24p and Erv25p levels are
approximately threefold and sixfold lower, respectively, in the
ERP1::HIS3 deletion strain than in wild-type cells
(Figure 7, lane 1). These results therefore suggest that Emp24p and
Erv25p stability may be dependent not only on the presence of each
other but also on Erp1p and Erp2p. To test this idea further, we raised
Erp1p antibodies and examined Erp1 protein levels in strains deleted
for EMP24 and ERV25 and in five strains deleted
for the additional p24 genes identified in this study. Figure 7
demonstrates that, as expected, no Erp1 protein is detected in an
ERP1::HIS3 strain (Figure 7, lane 1). Significantly, the levels of Erp1p in strains deleted either for EMP24 or ERV25 are greatly diminished (virtually
undetectable) relative to wild-type and strains deleted for any of the
five remaining p24 genes (Figure 7, compare lanes 5 and 6 with lane 9).
These results strongly suggest that the stability of Erp1p depends on
the presence of Emp24p and Erv25p and that these three gene products
may function together in a complex.
|
Analysis of Erp1 protein levels in the additional p24 deletion strains
revealed that Erp1p levels were significantly reduced in a further p24
deletion strain; in a strain containing an
ERP2::HIS3 deletion (DHY7) the level of Erp1
protein was almost 10-fold lower than in the isogenic wild-type strain
(Figure 7, lane 2). The erp2 mutant also exhibited lower
levels of Emp24p (twofold lower) and Erv25p (threefold lower). These
observations suggest that Erp2p may also interact with Emp24p, Erv25p,
and Erp1p, although the reduction in Erp1p, Erv25p, and Emp24p protein
levels is less than what we have observed in other cases. We have
already noted above, however, that there is significant sequence
similarity between p24 family members such that functional redundancy
might mask interactions by the approach we have taken (Figure 7). To address this possibility we examined Emp24p, Erv25p, and Erp1p levels
in an erp2, erp3, erp4 triple mutant
(
/
family; Dominguez et al., 1998
; also see Figure
1B). However, we could find no further decrease in Emp24, Erv25, and
Erp1 protein levels over that seen in the single erp2
deletion strain. To study this further we looked at the level of the
Erp2 protein in the p24 deletion mutants. Strikingly, Erp2p was almost
undetectable in strains deleted for ERP1, EMP24,
or ERV25 (Figure 7, lanes 1, 5, and 6), indicating that the
stability of the Erp2 protein is dependent on the presence of Erp1p,
Emp24p, and Erv25p. These results again suggest that these four
proteins function together in a heteromeric complex. No significant
differences in the levels of Emp24p, Erv25p, or Erp1p were observed in
strains deleted for any of the additional four p24 genes
(ERP3-6) (Figure 7).
Erp1p and Erp2p Interact with Emp24p and Erv25p in a Heteromeric p24 Complex
The genetic and biochemical evidence described above demonstrates
that four p24 genes, EMP24, ERV25,
ERP1, and ERP2, can be mutated to give similar
phenotypes and that the levels of the p24 proteins encoded by these
four genes are interdependent. One explanation for these observations
might be that these four p24 proteins interact with one another in a
heteromeric p24 protein complex. To test this idea we
immunoprecipitated Erp1p from wild-type and p24 mutant cells. Figure
8A demonstrates that Erp1p was detected in immunoprecipitates from a wild-type strain but not from a mutant deleted for the ERP1 gene (Figure 8A, compare lanes 1 and
4). Quantitative immunoblot analysis of the
immunoprecipitate and of the cell extract before and after
immunoprecipitation demonstrated that, under these conditions, >90%
of the Erp1p in the extract was immunoprecipitated (Figure 8B). No
Erp1p was detected in immunoprecipitates with preimmune serum or
unrelated antibodies. No Erp1p was detected in immunoprecipitates from
strains deleted for Emp24p (Figure 8A, lane 3), consistent with the
Western blot analysis of Erp1p levels in EMP24-deleted cells
(Figure 7). We then determined the presence of other p24 proteins in
Erp1p immunoprecipitates. Emp24p, Erv25p, and Erp2p were all detected
in anti-Erp1p immunoprecipitates prepared from wild-type cells (Figure
8A, lanes 5, 9, and 13), whereas two unrelated membrane proteins, Dpm1p
and porin, were not detected. Quantitative immunoprecipitation
experiments in which cell extracts were compared before and after
immunoprecipitation revealed that ~30% of the Emp24p was depleted by
incubation with the Erp1p antibody (Figure 8B). For Erv25p the amount
depleted was ~29%, and for Erp2p it was ~34%. In each case the
amount of p24 protein depleted was broadly consistent with the amount
recovered in the immunoprecipitate (Figure 8B). As expected, Emp24p was not detected in anti-Erp1p immunoprecipitates prepared from an EMP24::HIS3 strain (Figure 8A, lane 7). We have
demonstrated that in this strain Erp1p is present at reduced levels
(Figure 7). Consistent with this observation, Erv25p and Erp2p were
also not detected in anti-Erp1p immunoprecipitates prepared from the
EMP24::HIS3 strain, even though Erv25p at least
was readily detected in whole cell extracts (Figure 7). Interestingly,
Emp24p, Erv25p, and Erp2p were still detected, albeit at reduced
levels, in Erp1p immunoprecipitates from cells carrying a deletion of
the ERP1 gene (Figure 8A, lanes 8, 12, and 16). To account
for this observation we considered the possibility that in
ERP1::HIS mutant cells, Emp24p, Erv25p, and Erp2p
might be coimmunoprecipitating with Erp5p and/or Erp6p, both closely
related to Erp1p (Figure 1). Although by Western blot analysis we did
not detect significant cross-reactivity of the anti-Erp1p antiserum
with Erp5/6p (Figure 7), a more-sensitive ELISA revealed that the Erp1p
antiserum, affinity purified against a C-terminal Erp1p peptide,
exhibits cross-reactivity with an equivalent peptide from Erp6p. To
test the idea that immunoprecipitation of Emp24p, Erv25p, and Erp2p is
dependent on Erp5p and Erp6p in the absence of Erp1p, we examined
anti-Erp1p precipitates from cells deleted for the ERP1,
ERP5, and ERP6 genes. Figure 8A, lanes 6, 10, and
14, shows that the simultaneous deletion of these three genes resulted
in immunoprecipitates devoid of Emp24p, Erv25p, and Erp2p,
demonstrating that coimmunoprecipitation of these p24 proteins is
dependent on Erp5p and/or Erp6p in the absence of Erp1p. This is the
first demonstration of a function for Erp5p and Erp6p, a function that
appears to be redundant with Erp1p, consistent with the strong sequence
similarities observed between these genes (Figure 1) and the ability of
ERP6 to complement the Kar2p secretion phenotype of
erp1 mutant cells (Figure 6).
|
To determine the specificity of Erp1p immunoprecipitations we prepared
whole cell extracts from cells metabolically labeled with
35S-methionine and -cysteine. Erp1p immunoprecipitates were
prepared from extracts from both wild-type cells and from a strain
deleted for the ERP1, ERP5, and ERP6
genes. Figure 9A shows that the only proteins that are specifically immunoprecipitated by the Erp1p antiserum migrate in the 24- to 30-kDa range. Comparison of the migration of these proteins with the migration of Emp24p, Erv25p, Erp1p, and Erp2p in a parallel experiment in which immunoprecipitates were prepared from unlabeled cells and p24 proteins detected by Western
blotting strongly suggests that the immunoprecipitated radiolabeled
proteins correspond to these same four p24 proteins (Figure 9B). In
addition, mass spectrometry analysis of Coomassie Blue-stained
gel bands from the Erp1p immunoprecipitates unambigously identified the
same four p24 proteins (our unpublished results). These data
demonstrate that under the conditions we have used the
coimmunoprecipitatation of Emp24p, Erv25p, and Erp2p with Erp1p is
completely specific.
|
The results described above strongly suggest that Erp1p is found in a
complex (or complexes) with Emp24p, Erv25p, and Erp2p. To determine
whether these four proteins are found in the same complex and to
determine the size of p24-containing complexes in yeast, we performed
gel filtration separation of yeast extracts followed by Western blot
analysis of the fractions with p24 antibodies (Figure
10). A significant proportion of Erp1p,
Erp2p, Emp24p, and Erv25p from wild-type cell extracts were found to
coelute at a molecular mass of ~100 kDa, consistent with these
four p24 proteins forming a heteromeric complex, as suggested by the
biochemical and genetic experiments described above (Figure 10A). Each
of the four p24 proteins also eluted at lower-molecular-mass positions, and it is therefore possible that p24 proteins exist in
lower-molecular-mass complexes or that, under these in vitro conditions
at least, p24 complexes are unstable. Only a minority of each p24
protein eluted from the column in fractions that would be expected to
contain p24 monomers. Interestingly, when extracts were prepared from erp1/erp5/erp6 triple deletion
mutants, Emp24p and Erv25p continued to coelute from the gel filtration
column but in later fractions, most consistent with p24 dimers (Figure
10B). In these cells the amount of Emp24p and Erv25p recovered was also
reduced relative to wild-type cells, consistent with earlier results
(Figure 7). Erp2p was previously shown to be undetectable in these
extracts (Figure 7). This result demonstrates that the presence of
Emp24p and Erv25p in higher-molecular-mass p24 complexes is dependent on the presence of Erp1p and/or Erp2p. Furthermore, in the absence of
Erp1p (resulting indirectly in the absence of Erp2p) most Emp24p and
Erv25p is present in p24 dimers.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study we have identified six additional members of the p24 family in the budding yeast S. cerevisiae. These are in addition to two previously identified p24 genes, EMP24 and ERV25, and we have therefore named these new genes ERP1-ERP6 for Emp24p- and Erv25p-related proteins. Because the genome of this organism has been sequenced in its entirety, this system affords the first opportunity to study the complete complement of p24 proteins in a eukaryotic cell.
All yeast p24 proteins are predicted to exhibit type I structural
organization similar to one another and to p24 proteins identified in
other species (Figure 1; Wada et al., 1991
; Holthuis et al., 1995
; Schimmöller et al., 1995
;
Stamnes et al., 1995
; Belden and Barlowe, 1996
; Blum
et al., 1996
; Fiedler et al., 1996
; Sohn et
al., 1996
; Rojo et al., 1997
; Dominguez et
al., 1998
). The eight p24 proteins identified in S. cerevisiae is the highest number found in any one species to date.
The predicted p24 proteins encoded by the six new ORFs fall into two
groups based on comparison of amino acid sequences (Figure 1).
Comparison of these sequences with those of other species demonstrates
that Erp1p, Erp5p, and Erp6p are members of the p24
family, and
Erp2p, Erp3p, and Erp4p are members of the
/
family, according to
nomenclature recently proposed by Dominguez et al. (1998)
(Figure 1B). Emp24p and Erv25p are the sole S. cerevisiae
members of the
and
families, respectively. The sequence and
structural similarities between p24 proteins from yeast and other
species suggest that the functions of these proteins have been
conserved through evolution.
We have demonstrated that none of the eight p24 genes is essential for
viability in budding yeast, and all deletion mutants grow at rates
equivalent to wild type, consistent with earlier observations for
EMP24 and ERV25 (Schimmöller et
al., 1995
; Belden and Barlowe, 1996
). Nevertheless, deletion of
EMP24, ERV25, ERP1, or ERP2 results in
a selective transport defect of Gas1p, a GPI-anchored cell surface
protein (Figure 3). Deletion of these same four genes also leads to
increased secretion of the ER resident protein Kar2p into the culture
supernatant (Figure 4). A further phenotype previously ascribed to
emp24 deletion mutants is shared by erv25 and
erp1 deletion mutants; all three mutant genes suppress, to
equal extents, a temperature-sensitive mutation in SEC13, a
COPII vesicle coat protein gene (Figure 5). Interestingly, we detected
no defect in invertase transport in erp1 or erp2
mutants, unlike in emp24 (Schimmöller et
al., 1995
) and erv25 mutants (Figure 2). Although not
identical, the similarity among emp24, erv25,
erp1, and erp2 mutant phenotypes led us to
conclude that these four gene products are likely to function, perhaps
together, in the early secretory pathway.
Because of the close sequence similarity of ERP1, ERP5, and ERP6 and of ERP2, ERP3, and ERP4, we considered the possibility of functional redundancy. However, by combining deletions we were unable to demonstrate any additive phenotypic effects, suggesting that if ERP5, ERP6, ERP3, and ERP4 have a function that is redundant with that of ERP1 and ERP2, they contribute only a minor proportion of the total p24 protein in the cell. This would be consistent with the minor Kar2p secretion defects exhibited by erp5, erp6, erp3, and erp4 mutants (Figure 4) and the lack of any other phenotype, although it remains possible that one or more of these genes may be required for an activity that we have not measured or that is only required under certain physiological conditions. Nevertheless, by moderately overexpressing ERP4 (70% identical to ERP2) or ERP6 (58% identical to ERP1), we demonstrated that these two genes, like the relevant wild-type genes, but not EMP24 or ERV25, are capable of restoring normal Kar2p secretion to erp2 or erp1 mutant cells, respectively (Figure 6). Taken together these results suggest that ERP4 shares a redundant function with ERP2, and ERP6 is redundant with ERP1, but that in vivo it is predominantly ERP1 and ERP2 that fulfill these roles.
To address the possibility that Emp24p, Erv25p, Erp1p, and Erp2p
function together at the same step of the secretory pathway, we first
asked whether the levels of all four of these proteins are
interdependent. Both Erp1p and Erp2p levels were almost undetectable in
emp24 and erv25 deletion mutants, demonstrating
that the steady-state levels of these proteins are dependent on both
Emp24p and Erv25p (Figure 7). Consistent with this, Erv25p levels were
also significantly lower in the emp24 deletion, as
previously described (Belden and Barlowe, 1996
), as well as in the
erp1 and erp2 deletion strains. In the case of
Erv25p, the decrease in protein level in an emp24 mutant was
shown to be a consequence of a decrease in Erv25p protein stability and
that Emp24p and Erv25p interact with one another in COPII-coated
vesicles (Belden and Barlowe, 1996
). The simplest explanation for our
observations is that Erp1p and Erp2p protein levels are dependent on
the presence of Emp24p and Erv25p, because a significant proportion of
these four p24 proteins function together in one or more heteromeric
p24 complexes.
To further investigate the possibility that Emp24p, Erv25p, Erp1p, and Erp2p interact, we immunoprecipitated Erp1p from wild-type and p24 mutant cells (Figures 8 and 9). Emp24p, Erv25p, and Erp2p specifically coimmunoprecipitated with Erp1p. These observations strongly suggest that Emp24p, Erv25p, Erp1p, and Erp2p function interdependently in a p24 protein complex. The strong interdependence of p24 protein levels suggests that, particularly in the case of Erp1p and Erp2p, which are both present at very low levels in the absence of Emp24p and Erv25p, a significant proportion of p24 protein in the cell is likely to be present in p24 complex(es). This idea is further supported by gel filtration chromatography of yeast extracts during which Erp1p, Erp2p, Erv25p, and Emp24p elute from the column at greater than their molecular mass, strongly supporting the idea that they exist in multimeric complexes in vivo. Significantly, there is a peak in the elution of all four p24 proteins at a molecular mass of ~100 kDa, consistent with the combined molecular mass of Erp1p, Erp2p, Emp24p, and Erv25p and strongly supporting the hypothesis that these four proteins interact in vivo (Figure 10). Furthermore, gel filtration experiments using erp1/erp5/erp6 mutant cells demonstrate that the presence of Emp24p and Erv25p in higher-molecular-mass p24 complexes is dependent on the presence of Erp1p and/or Erp2p. In the absence of Erp1p (resulting indirectly in the absence of Erp2p), most remaining Emp24p and Erv25p is present in p24 dimers. If these dimers have at least some residual functionality, this would explain why deletion of ERP1 and or ERP2 is less deleterious than deletion of EMP24 and/or ERV25 (Figures 2-4).
Erp1p is most similar to the mammalian p24 proteins GMP25 and gp25L
(
1 and
2; Dominguez et al., 1998
) (Figure 1B). Both gp25L (
1) and GMP25 (
2) contain a C-terminal sequence (KKLV) that
matches a KKXX consensus binding motif for COPI binding. Indeed, GMP25
(
2) has recently been demonstrated to strongly bind COPI subunits in
vitro (Dominguez et al., 1998
). Similarly, Erp1p contains a
potential COPI binding site (KQKIL) and binds COPI subunits very
efficiently (Rowley, Dejgaard, and Nilsson, unpublished observations).
Interestingly, mutation of the KK motif in GMP25 (
2) both reduced
COPI binding in vitro and resulted in the redistribution of GMP25
(
2) from the cis-Golgi network to later compartments of
the secretory pathway, including the cell surface, in transiently
transfected cells (Dominguez et al., 1998
). Remarkably, when
this mutant GMP25 (
2) was cotransfected with four additional
(nonmutated) p24 proteins (p23 [
1], p24 [
1], gp27 [
1],
and p26 [
2]) these too were found to redistribute to later
secretory compartments, suggesting that mammalian p24 proteins are
interdependent for their appropriate cellular localization. This
observation was supported by the observation that these same p24
proteins cofractionate when purified from rat liver Golgi membranes. It
is interesting to note that Emp24p, Erv25p, and Erp2p are most similar
to mammalian p24 (
1), p23 (
1), and gp27 (
1) or p26 (
2),
respectively; therefore both in yeast and mammalian cells p24 members
of the
,
,
, and
sequence families appear to interact. The
parallels between our findings in yeast and those of Dominguez et
al. (1998)
in mammalian cells suggest that the ability of p24
proteins to form heteromeric complexes has been conserved throughout
evolution. In this respect it is interesting to note that in other
model organisms with almost sequenced genomes (Schizosaccharomyces pombe and Caenorhabditis
elegans) these same p24 proteins appear to be represented in most
cases by a single member (Figure 1B), suggesting that these four p24
proteins may represent a core p24 complex.
The role of p24 proteins in membrane traffic is still unclear. Evidence
in both yeast and mammalian cells suggests that cargo molecules are
actively packaged into COPII-coated vesicles (Schekman and Orci, 1996
),
and p24 proteins have previously been suggested as candidates for cargo
receptors or adaptors (Schimmöller et al., 1995
;
Stamnes et al., 1995
). The effects on invertase
(emp24 and erv25 mutants) and Gas1p
(emp24, erv25, erp1, and
erp2) transport observed by Schimmöller et
al. (1995)
, Belden and Barlowe (1996)
, and ourselves are still
consistent with such a role. Nevertheless, we have not yet identified,
as predicted by this cargo receptor model, additional transport defects
that would suggest that p24 proteins play a role in the selective
concentration of cargo molecules such as CPY and
-factor into
COPII-coated vesicles, although we cannot exclude the possibility of
very minor defects below the level of detection in our experiments or
that we have not yet deleted the critical combination of p24 genes.
Recently, experiments from the Riezman laboratory have suggested the
existence of two parallel transport pathways from the ER to the Golgi
in yeast (Sütterlin et al., 1997
). It remains possible
that the p24 proteins identified here as playing a role in Gas1p
transport are only required for transport mediated by one of these two
pathways and that another family of "transport factors" is required
for incorporation of cargo molecules such as
-factor and CPY into a
second class of COPII-coated vesicle.
Several lines of evidence suggest that p24 proteins could play a role
in retrograde transport from the Golgi to the ER. This role might
involve a function in COPI vesicle formation or structure or perhaps a
role as a cargo receptor, adaptor, transport factor. First, in both
yeast and mammalian cells the C-terminal tails of at least a subset of
p24 proteins have been shown to interact with subunits of the COPI
vesicle coat (Fiedler et al., 1996
; Sohn et al.,
1996
; Dominguez et al., 1998
) and may be enriched in
COPI-coated vesicles, although there is conflicting evidence from
different studies (Rojo et al., 1997
). Second, deletion of p24 proteins in yeast results in secretion of elevated levels of the ER
resident protein Kar2p (Figure 4; Elrod-Erickson and Kaiser, 1996
),
suggesting that the Erd2p-dependent retrieval process may be defective
in these cells. This possibility is strengthened by our recent finding
that secretion of an HDEL-tagged version of pro-
factor in a
strain simultaneously deleted for EMP24, ERV25,
ERP1, and ERP2 is as fast as that of endogenous
factor, whereas HDEL-
factor is held back in the early secretory
pathway when expressed in a wild-type background (our unpublished
observations). The delay observed in Gas1p and invertase anterograde
transport does not exclude a role for p24 proteins in retrograde
traffic, because a number of studies in both yeast and mammalian cells have demonstrated that defects in retrograde transport can lead to
indirect effects on anterograde transport. For example, in yeast a
number of genes that are now known to encode subunits of the COPI coat
complex, and which exhibit complete blocks in retrograde transport when
mutant, were first identified by mutations that result in anterograde
transport defects (Hosobuchi et al., 1992
; Duden et
al., 1994
). Recently, Gaynor and Emr (1997)
have isolated new
temperature-sensitive alleles of SEC21 that encode the
subunit of the yeast COPI protein complex. In addition to a complete
block in retrograde transport, cells bearing these new alleles display
cargo-selective
factor and CPY anterograde transport defects,
whereas the transport of other cargo molecules, such as invertase,
proceeds normally. Recent experiments have demonstrated a Gas1p
anterograde transport defect in several COPI mutants, a phenotype that
was particularly pronounced in a ret1-1 mutant
(Sütterlin et al., 1997
). RET1 encodes the
-COP subunit of coatomer. The similarity between this phenotype and
the delay that we observe in emp24, erv25,
erp1, and erp2 mutants could be explained in two
ways. EMP24, ERV25, ERP1, and
ERP2 could encode rate-limiting Gas1p transport
factors that fail to be recovered to the ER in a
ret1-1 cell, resulting in an indirect delay in anterograde
Gas1p transport. Alternatively, Emp24p, Erv25p, Erp1p, and Erp2p, like
Ret1p, could be more directly involved in the retrograde transport
process. At present it is not possible to distinguish between these
possibilities. It is interesting to note that although both
sec21 and ret1-1 mutants do not show a defect in
invertase transport, both mutations result in a general decrease in the
glycosylation state of invertase (Gaynor and Emr, 1997
; Sütterlin
et al., 1997
). The invertase secreted by emp24 and erv25 mutants cells is also hypoglycosylated
(Schimmöller et al., 1995
; Figure 2), suggesting that
all these mutants may share a common underlying defect in function
within the early Golgi.
In conclusion, although the function of p24 proteins remains to be determined, we have demonstrated that four different yeast p24 proteins, Emp24p, Erv25p, Erp1p, and Erp2p, can be mutated to give similar phenotypes and that these four proteins interact in a p24 protein complex. Our results suggest that heteromeric p24 complexes may be a conserved feature of p24 function in all eukaryotic cells.
| |
ACKNOWLEDGMENTS |
|---|
We thank Mark Rose, Charlie Barlowe, and Howard Riezman for antibodies and Chris Kaiser for a sec13-1 temperature-sensitive mutant strain. We are grateful to Alan Lewis and Philippe Sanseau for bioinformatics assistance and to John Hillman for helping us prepare the figures. We are indebted to Pia Thömmes for help with gel filtration experiments.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
ar14034{at}glaxowellcome.co.uk.
| |
REFERENCES |
|---|
|
|
|---|
phylogeny inference package.
Cladistics
5, 164-166.This article has been cited by other articles:
![]() |
A. Lorente-Rodriguez, M. Heidtman, and C. Barlowe Multicopy suppressor analysis of thermosensitive YIP1 alleles implicates GOT1 in transport from the ER J. Cell Sci., May 15, 2009; 122(10): 1540 - 1550. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mesecke, A. Spang, M. Deponte, and J. M. Herrmann A Novel Group of Glutaredoxins in the cis-Golgi Critical for Oxidative Stress Resistance Mol. Biol. Cell, June 1, 2008; 19(6): 2673 - 2680. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aguilera-Romero, J. Kaminska, A. Spang, H. Riezman, and M. Muniz The yeast p24 complex is required for the formation of COPI retrograde transport vesicles from the Golgi apparatus J. Cell Biol., February 25, 2008; 180(4): 713 - 720. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A. Haass, M. Jonikas, P. Walter, J. S. Weissman, Y.-N. Jan, L. Y. Jan, and M. Schuldiner Identification of yeast proteins necessary for cell-surface function of a potassium channel PNAS, November 13, 2007; 104(46): 18079 - 18084. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Orlean and A. K. Menon Thematic review series: Lipid Posttranslational Modifications. GPI anchoring of protein in yeast and mammalian cells, or: how we learned to stop worrying and love glycophospholipids J. Lipid Res., May 1, 2007; 48(5): 993 - 1011. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hosaka, T. Watanabe, Y. Yamauchi, Y. Sakai, M. Suda, S. Mizutani, T. Takeuchi, T. Isobe, and T. Izumi A Subset of p23 Localized on Secretory Granules in Pancreatic {beta}-cells J. Histochem. Cytochem., March 1, 2007; 55(3): 235 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Welsh, A. H. Y. Tong, C. Boone, O. N. Jensen, and S. Otte Genetic and molecular interactions of the Erv41p-Erv46p complex involved in transport between the endoplasmic reticulum and Golgi complex J. Cell Sci., November 15, 2006; 119(22): 4730 - 4740. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Osterberg, H. Kim, J. Warringer, K. Melen, A. Blomberg, and G. von Heijne Phenotypic effects of membrane protein overexpression in Saccharomyces cerevisiae PNAS, July 25, 2006; 103(30): 11148 - 11153. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Inadome, Y. Noda, H. Adachi, and K. Yoda Immunoisolaton of the Yeast Golgi Subcompartments and Characterization of a Novel Membrane Protein, Svp26, Discovered in the Sed5-Containing Compartments Mol. Cell. Biol., September 1, 2005; 25(17): 7696 - 7710. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Paulhe, B. A. Imhof, and B. Wehrle-Haller A Specific Endoplasmic Reticulum Export Signal Drives Transport of Stem Cell Factor (Kitl) to the Cell Surface J. Biol. Chem., December 31, 2004; 279(53): 55545 - 55555. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Contreras, Y. Yang, D. G. Robinson, and F. Aniento Sorting Signals in the Cytosolic Tail of Plant p24 Proteins Involved in the Interaction with the COPII Coat Plant Cell Physiol., December 15, 2004; 45(12): 1779 - 1786. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sato COPII Coat Assembly and Selective Export from the Endoplasmic Reticulum J. Biochem., December 1, 2004; 136(6): 755 - 760. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tanaka, Y. Maeda, Y. Tashima, and T. Kinoshita Inositol Deacylation of Glycosylphosphatidylinositol-anchored Proteins Is Mediated by Mammalian PGAP1 and Yeast Bst1p J. Biol. Chem., April 2, 2004; 279(14): 14256 - 14263. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Bouw, R. Van Huizen, E. J.R. Jansen, and G. J.M. Martens A Cell-Specific Transgenic Approach in Xenopus Reveals the Importance of a Functional p24 System for a Secretory Cell Mol. Biol. Cell, March 1, 2004; 15(3): 1244 - 1253. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Emery, R. G. Parton, M. Rojo, and J. Gruenberg The trans-membrane protein p25 forms highly specialized domains that regulate membrane composition and dynamics J. Cell Sci., December 1, 2003; 116(23): 4821 - 4832. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sandmann, J. M. Herrmann, J. Dengjel, H. Schwarz, and A. Spang Suppression of Coatomer Mutants by a New Protein Family with COPI and COPII Binding Motifs in Saccharomyces cerevisiae Mol. Biol. Cell, August 1, 2003; 14(8): 3097 - 3113. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sato and A. Nakano Oligomerization of a Cargo Receptor Directs Protein Sorting into COPII-coated Transport Vesicles Mol. Biol. Cell, July 1, 2003; 14(7): 3055 - 3063. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Carney and B. J. Taylor logjam Encodes a Predicted EMP24/GP25 Protein That Is Required for Drosophila Oviposition Behavior Genetics, May 1, 2003; 164(1): 173 - 186. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Jenne, K. Frey, B. Brugger, and F. T. Wieland Oligomeric State and Stoichiometry of p24 Proteins in the Early Secretory Pathway J. Biol. Chem., November 22, 2002; 277(48): 46504 - 46511. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Friedmann, Y. Salzberg, A. Weinberger, S. Shaltiel, and J. E. Gerst YOS9, the Putative Yeast Homolog of a Gene Amplified in Osteosarcomas, Is Involved in the Endoplasmic Reticulum (ER)-Golgi Transport of GPI-anchored Proteins J. Biol. Chem., September 13, 2002; 277(38): 35274 - 35281. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Nickel, B. Brugger, and F. T. Wieland Vesicular transport: the core machinery of COPI recruitment and budding J. Cell Sci., August 15, 2002; 115(16): 3235 - 3240. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gulow, D. Bienert, and I. G. Haas BiP is feed-back regulated by control of protein translation efficiency J. Cell Sci., January 6, 2002; 115(11): 2443 - 2452. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rotter, R. P. Kuiper, G. Bouw, and G. J. M. Martens Cell-type-specific and selectively induced expression of members of the p24 family of putative cargo receptors J. Cell Sci., January 3, 2002; 115(5): 1049 - 1058. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Belden and C. Barlowe Distinct Roles for the Cytoplasmic Tail Sequences of Emp24p and Erv25p in Transport between the Endoplasmic Reticulum and Golgi Complex J. Biol. Chem., November 9, 2001; 276(46): 43040 - 43048. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Pentcheva and M. Edidin Clustering of Peptide-Loaded MHC Class I Molecules for Endoplasmic Reticulum Export Imaged by Fluorescence Resonance Energy Transfer J. Immunol., June 1, 2001; 166(11): 6625 - 6632. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Belden and C. Barlowe Deletion of Yeast p24 Genes Activates the Unfolded Protein Response Mol. Biol. Cell, April 1, 2001; 12(4): 957 - 969. [Abstract] [Full Text] |
||||
![]() |
S. Otte, W. J. Belden, M. Heidtman, J. Liu, O. N. Jensen, and C. Barlowe Erv41p and Erv46p: New Components of COPII Vesicles Involved in Transport between the ER and Golgi Complex J. Cell Biol., January 29, 2001; 152(3): 503 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kaiser Thinking about p24 proteins and how transport vesicles select their cargo PNAS, April 11, 2000; 97(8): 3783 - 3785. [Full Text] [PDF] |
||||
![]() |
L. F. Ciufo and A. Boyd Identification of a Lumenal Sequence Specifying the Assembly of Emp24p into p24 Complexes in the Yeast Secretory Pathway J. Biol. Chem., March 17, 2000; 275(12): 8382 - 8388. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Muniz, C. Nuoffer, H.-P. Hauri, and H. Riezman The Emp24 Complex Recruits a Specific Cargo Molecule into Endoplasmic Reticulum-derived Vesicles J. Cell Biol., March 6, 2000; 148(5): 925 - 930. [Abstract] [Full Text] [PDF] |
||||
![]() |
G Emery, M Rojo, and J Gruenberg Coupled transport of p24 family members J. Cell Sci., January 7, 2000; 113(13): 2507 - 2516. [Abstract] [PDF] |
||||
![]() |
R. P. Kuiper, H. R. Waterham, J. Rötter, G. Bouw, and G. J. M. Martens Differential Induction of Two p24delta Putative Cargo Receptors upon Activation of a Prohormoneproducing Cell Mol. Biol. Cell, January 1, 2000; 11(1): 131 - 140. [Abstract] [Full Text] |
||||
![]() |
L. Ellgaard, M. Molinari, and A. Helenius Setting the Standards: Quality Control in the Secretory Pathway Science, December 3, 1999; 286(5446): 1882 - 1888. [Abstract] [Full Text] |
||||
![]() |
M. Moussalli, S. W. Pipe, H.-P. Hauri, W. C. Nichols, D. Ginsburg, and R. J. Kaufman Mannose-dependent Endoplasmic Reticulum (ER)-Golgi Intermediate Compartment-53-mediated ER to Golgi Trafficking of Coagulation Factors V and VIII J. Biol. Chem., November 12, 1999; 274(46): 32539 - 32542. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Füllekrug, T. Suganuma, B. L. Tang, W. Hong, B. Storrie, and T. Nilsson Localization and Recycling of gp27 (hp24gamma 3): Complex Formation with Other p24 Family Members Mol. Biol. Cell, June 1, 1999; 10(6): 1939 - 1955. [Abstract] [Full Text] |
||||
![]() |
H. Higashio, Y. Kimata, T. Kiriyama, A. Hirata, and K. Kohno Sfb2p, a Yeast Protein Related to Sec24p, Can Function as a Constituent of COPII Coats Required for Vesicle Budding from the Endoplasmic Reticulum J. Biol. Chem., June 2, 2000; 275(23): 17900 - 17908. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Iodice, S. Sarnataro, and S. Bonatti The Carboxyl-terminal Valine Is Required for Transport of Glycoprotein CD8alpha from the Endoplasmic Reticulum to the Intermediate Compartment J. Biol. Chem., July 27, 2001; 276(31): 28920 - 28926. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Springer, E. Chen, R. Duden, M. Marzioch, A. Rowley, S. Hamamoto, S. Merchant, and R. Schekman From the Cover: The p24 proteins are not essential for vesicular transport in Saccharomyces cerevisiae PNAS, April 11, 2000; 97(8): 4034 - 4039. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lanoix, J. Ouwendijk, A. Stark, E. Szafer, D. Cassel, K. Dejgaard, M. Weiss, and T. Nilsson Sorting of Golgi resident proteins into different subpopulations of COPI vesicles: a role for ArfGAP1 J. Cell Biol., December 24, 2001; 155(7): 1199 - 1212. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||