![]() |
|
|
Vol. 10, Issue 6, 2033-2050, June 1999

§
and
*Department of Anatomy and Cell Biology, University of Western
Ontario, London, Ontario, Canada N6A 5C1;
Fred Hutchinson
Cancer Research Center, Seattle, Washington, 98109;
Department of Anatomy and Cell Biology, McGill
University, Montreal, Quebec, Canada H3A 2B2; and
Department of Pediatric Dentistry, School of Dental
Medicine, University of Connecticut Health Center, Farmington,
Connecticut 06030
| |
ABSTRACT |
|---|
|
|
|---|
To examine the trafficking, assembly, and turnover of connexin43 (Cx43) in living cells, we used an enhanced red-shifted mutant of green fluorescent protein (GFP) to construct a Cx43-GFP chimera. When cDNA encoding Cx43-GFP was transfected into communication-competent normal rat kidney cells, Cx43-negative Madin-Darby canine kidney (MDCK) cells, or communication-deficient Neuro2A or HeLa cells, the fusion protein of predicted length was expressed, transported, and assembled into gap junctions that exhibited the classical pentalaminar profile. Dye transfer studies showed that Cx43-GFP formed functional gap junction channels when transfected into otherwise communication-deficient HeLa or Neuro2A cells. Live imaging of Cx43-GFP in MDCK cells revealed that many gap junction plaques remained relatively immobile, whereas others coalesced laterally within the plasma membrane. Time-lapse imaging of live MDCK cells also revealed that Cx43-GFP was transported via highly mobile transport intermediates that could be divided into two size classes of <0.5 µm and 0.5-1.5 µm. In some cases, the larger intracellular Cx43-GFP transport intermediates were observed to form from the internalization of gap junctions, whereas the smaller transport intermediates may represent other routes of trafficking to or from the plasma membrane. The localization of Cx43-GFP in two transport compartments suggests that the dynamic formation and turnover of connexins may involve at least two distinct pathways.
| |
INTRODUCTION |
|---|
|
|
|---|
A gap junction channel is assembled when a hemichannel (connexon),
composed of six connexins, traffics to the cell surface and docks with
a hemichannel from a contacting cell (Bruzzone et al., 1996
;
Laird 1996
). These channels are typically found in tightly packed
arrays often referred to as gap junction plaques (Goodenough et
al., 1996
). Gap junctions allow for the intercellular passage of
small molecules, including important secondary messengers (e.g.,
Ca2+, inositol triphosphate, and cAMP)
(Flagg-Newton and Loewenstein, 1979
; Elfgang et al., 1995
).
Most cells grown in culture and many tissues express the gap junction
protein Cx43 (Goodenough et al., 1996
). Nevertheless,
studies to date have been unable to examine the life cycle of Cx43 in
living cells in real time. The relative interest in the mechanics and
regulation of gap junction assembly and removal has increased recently
as Cx43 and Cx37 have been shown to be essential for normal heart
development (Reaume et al., 1995
) and female fertility
(Simon et al., 1997
). In addition, connexin mutations have
been linked or associated with inherited prelingual deafness (Kelsell
et al., 1997
) and a form of Charcot-Marie-Tooth disease
(Bergoffen et al., 1993
).
In recent years, green fluorescent protein (GFP) has been identified as
a useful reporter protein (Chalfie et al., 1994
). The
inherent fluorescent properties of GFP have made it an excellent fusion
partner to study the trafficking, assembly, and secretion of both
soluble and integral membrane proteins (Hanakam et al., 1996
; Yano et al., 1997
). Most proteins when fused to GFP
retain their native targeting properties and traffic to the correct
organelle (Naray-Fejes-Toth and Fejes-Toth 1996
; Wang et
al., 1996
; Pedraza et al., 1997
). A fusion of GFP and
Tax-4 was used to examine the localization properties and function of
this cyclic nucleotide gated channel (Komatsu et al., 1996
).
The pH sensory protein (Hanakam et al. 1996
)
2-adrenergic
receptor (Barak et al., 1997
), major histocompatibility
complex class II (Wubbolts et al., 1996
), and glucose
transporter 4 (Dobson et al., 1996
) all were properly transported to the plasma membrane when fused to GFP. GFP fusion proteins have proven to be particularly informative in determining the
nature of endoplasmic reticulum-to-Golgi transport (Presley et
al., 1997
) and processes involved in protein secretion (Wacker et al., 1997
). To date, the trafficking and functional
characteristics of a connexin-GFP fusion protein have not been
characterized; however, when mRNA encoding a zebrafish connexin43.4
(Cx43.4)-GFP fusion protein was injected into a single-cell zebrafish
embryos, structures resembling gap junctions were observed (Essner
et al., 1996
).
The trafficking of a variety of integral membrane proteins from the site of biosynthesis in the endoplasmic reticulum to the plasma membrane has been intensely investigated. In our current study, we have generated a construct in which red-shifted GFP was fused to the carboxyl terminus of rat Cx43. Cx43-GFP was expressed in communication-competent and -incompetent mammalian cell lines. In all cases, Cx43-GFP was translated, transported to the plasma membrane, and assembled into gap junctions. Microinjection studies revealed that the fusion protein did not inhibit communication in communication-competent cells and was capable of assembling into functional gap junction channels in communication-deficient cell lines. Our time-lapse studies of living cells revealed Cx43-GFP within two populations of transport intermediates. The large transport intermediates were observed to form when pieces of gap junctions internalize. Once Cx43-GFP was delivered to the cell surface, it assembled into gap junction plaques that often coalesced within the plane of the cell membrane.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Engineering of Cx43-GFP Chimeric cDNA
Cx43 cDNA was PCR amplified from a Bluescript plasmid containing
Cx43 (obtained from Dr. Eric Beyer, University of Chicago, Chicago, IL
) using oligonucleotides GTGAAAGAGAGGTACCCAGAC to create a
KpnI site and GCCGGTTTAAGGATCCAGG to create a
BamHI site at the 5' and 3' ends of Cx43, respectively.
PWO DNA polymerase (Boehringer Mannheim, Indianapolis, IN) was
used for the reaction to ensure fidelity of the PCR reaction. PCR
products and the vector pEGFP-N1 (Clontech, Palo Alto, CA) were
digested with KpnI and BamHI, and the vector was
dephosphorylated with alkaline phosphatase (Boehringer Mannheim). GFP
was fused in frame to the carboxyl terminus of Cx43 with the addition
of a six-amino acid polylinker (GATCCACCGGTCGCCACC) (Figure
1). After ligation, competent MC1069 Escherichia coli were transformed with the plasmid, and
selected positive colonies were identified and digested with
EcoRI and EcoRI-BamHI restriction
endonucleases. Finally, the cDNA encoding the chimeric protein was
verified by the Applied Biosystems (Foster City, CA) dye terminator
cycle sequencing method.
|
Cell Lines and Culture Conditions
All media, sera, and culture reagents were obtained from Life Technologies (Burlington, Ontario, Canada), Becton Dickinson (St. Laurent, Quebec, Canada) or Sigma (St. Louis, MO). LipofectAMINE was obtained from Life Technologies. Normal rat kidney (NRK), Madin-Darby canine kidney (MDCK), HeLa, and Neuro2A (N2A) cells were all grown in Dulbecco's modified Eagle's medium supplemented with 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM glutamine.
Transfection of Mammalian Cells with cDNA Encoding Cx43-GFP
Mammalian cells grown to 50-75% confluency in 35- or 60-mm culture dishes were transfected in Opti-MEM1 medium (Life Technologies) containing LipofectAMINE and 1 µg of plasmid DNA (purified using a Qiagen [Hilden, Germany] Maxiprep column kit) for 5 h at 37°C. For transient transfections, the DNA/LipofectAMINE suspension was removed and replaced with culture medium. The efficiency of transfection was determined 24-48 h later by visualizing live or fixed cells under a fluorescence microscope. For selection of stably transfected MDCK, NRK, N2A, or HeLa cell lines, cells were trypsinized and plated at dilutions of 1:25 and 1:40 in the presence of 0.3-1.0 mg/ml G418. Selection media was changed every 3 d for 14-20 d. Individual colonies were selected with cloning cylinders, trypsinized, and expanded into clonal cell lines. Stably transfected cells were screened for Cx43-GFP expression by fluorescence microscopy.
Immunocytochemistry
Cells grown on coverslips were immunolabeled as previously
described by Laird et al. (1995)
. Briefly, cells were grown
on glass coverslips and fixed with 80% methanol and 20% acetone at
20°C or with 3.7% formaldehyde followed by 0.1% Triton X-100. Cells expressing Cx43-GFP were labeled with 1-5 µg/ml anti-Cx43 polyclonal antibody (Laird and Revel 1990
), a 1:200 dilution of anti-Cx43 monoclonal antibody (Chemicon, Temecula, CA; specific for
residues 252-270 of Cx43), a 1:500 dilution of a polyclonal antibody
specific for the medial Golgi protein MG-160 (Gonatas et
al., 1989
), or a 1:1000 dilution of anti-GFP polyclonal antibody (Clontech). Cells were washed six times over 30 min in PBS and incubated for 1 h in goat anti-mouse or donkey anti-rabbit
antibodies conjugated to Texas Red (Jackson ImmunoResearch, West Grove,
PA). Coverslips were rinsed in distilled water, mounted, and analyzed on a Zeiss (Thornwood, NY) LSM 410 inverted confocal microscope as
described previously (Laird et al., 1995
).
Conventional and Immunoelectron Microscopy
For morphological studies, MDCK cells and MDCK cells that
express Cx43-GFP were fixed for 1 h in 2.5% glutaraldehyde in 0.1 M cacodylate buffer, pH 7.2, gently scraped, and then pelleted at
1000 × g for 5 min. The pellets were resuspended and
embedded in 3% agarose for easier handling. Cells within agarose
blocks were washed several times with cacodylate buffer and postfixed with osmium-ferrocyanide (De Bruijn, 1973
). After rinsing with distilled water and staining with 0.5% aqueous uranyl acetate, blocks
were dehydrated in ascending concentrations of ethanol and embedded in
Polybed epoxy resin (Polysciences, Warrington, PA). Thin sections were
collected on 200-mesh copper grids and stained with uranyl acetate for
5 min, followed by lead citrate for 3 min. Electron micrographs were
taken on a Philips (Mahwah, NJ) CM10 transmission electron microscope
at 60 kV.
For immunolabeling studies, MDCK cells and MDCK cells that express
Cx43-GFP were fixed for 1 h with cold 0.1% glutaraldehyde and
fresh 3% paraformaldehyde in 0.1 M cacodylate buffer, pH 7.2. Cells
were rinsed three times in 0.1 M cacodylate buffer containing 1%
paraformaldehyde, scraped from the dish, and stored as a pellet. Blocks
of cells immobilized in agarose were washed several times with
cacodylate buffer, dehydrated in a graded series of methanol up to
90%, and then embedded in Lowicryl K4M (Polysciences) at
20°C. Sections were labeled with 20 µg/ml anti-Cx43 antibody (CT-360) or a 1:50-1:200 dilution of anti-GFP polyclonal antibody. The
sections were blocked with 1% BSA and 1% nonfat dry milk in PBS for
30 min and then incubated with primary antibody diluted in 1% BSA and
5% normal goat serum overnight at 4°C followed by secondary goat
anti-rabbit immunoglobulin G (IgG) conjugated to 10-nm gold particles
(Amersham, Arllington Heights, IL) for 1 h at room temperature.
Sections were stained with uranyl acetate and lead citrate and viewed
as described above.
Microinjection
For Neurobiotin injections, clusters of three or more contacting HeLa or NRK cells that had been transiently transfected with the cDNA encoding Cx43-GFP were selected as sites of microinjection. One cell in each cluster was pressure microinjected with 2.5% Neurobiotin (Molecular Probes, Eugene, OR). In some cases, NRK cells stably expressing Cx43-GFP were microinjected with 2.7% Neurobiotin containing 4.5 mg/ml rat IgG to mark the injected cell. In all cases, transfer was allowed to proceed for 10-20 min, followed by fixation with 3.7% formaldehyde in PBS for 10 min, permeabilization with 0.1% Triton X-100, and labeling with streptavidin conjugated to Texas Red (Molecular Probes) and, in some cases, with goat anti-rat IgG conjugated to FITC. Cells were viewed under a microscope equipped for epifluorescence, and the percentage of microinjected cells that transferred Neurobiotin were scored. To be scored as positive, Neurobiotin was required to have transferred to two or more contacting cells. As controls, wild-type HeLa or NRK cells and HeLa or NRK cells transfected with the plasmid containing GFP only were microinjected as described above.
For Lucifer yellow dye transfer, one cell within a cluster of HeLa or N2A cells expressing Cx43-GFP was microinjected with 1% Lucifer yellow in 0.15 M LiCl until the cell was brightly fluorescent (usually a few seconds). After 5 min, the percentage of microinjected cells that transferred Lucifer yellow was determined. As controls, wild-type HeLa and N2A cells were microinjected with Lucifer yellow as described above.
Western Immunoblotting
HeLa cells, HeLa cells expressing GFP, HeLa cells expressing
Cx43-GFP, or MDCK cells expressing Cx43-GFP were lysed in 2× Laemmli
sample buffer containing protease inhibitors as previously described
(Laird et al., 1995
). Lysates, together with recombinant GFP
protein (Clontech), were resolved on a 10% SDS-polyacrylamide gel with
a bisacrylamide:acrylamide ratio of 0.8:30 and transferred to
nitrocellulose. Immunoblots were labeled with 1 µg/ml
anti-Cx43 polyclonal antibody (specific for residues 2-21 of Cx43),
1:2000 diluted anti-Cx43 monoclonal antibody (Chemicon; specific for residues 252-270), or 1:2000 anti-GFP polyclonal antibody (Clontech). Finally, immunoblots were labeled with appropriate
secondary antibodies conjugated to 125I (ICN Biochemicals,
Costa Mesa, CA). The blots were air dried and exposed to Amersham
Hyperfilm-MP with an intensifying screen.
Imaging of Cx43-GFP in Living Cells
MDCK cells stably expressing Cx43-GFP were grown on 12-mm glass coverslips. Coverslips were inverted onto a glass-bottom 25-mm tissue culture dish, which contained 2 ml of Opti-MEM1 medium (Life Technologies) supplemented with 10 mM HEPES, pH 7.2. In some cases, live MDCK cells that express Cx43-GFP were treated with 1% Triton X-100 in situ, and images were collected before and after Triton X-100 treatment. Tissue culture dishes were placed on a 20/20 Technology (Mississauga, Ontario, Canada) temperature-controlled stage, and cells were maintained at 37°C for the duration of the experiment. Cells were imaged using a 488-nm argon/krypton laser line on a Zeiss LSM 410 inverted confocal microscope with a 63× oil (1.4 numerical aperture) objective. Optical scans were collected continuously at a scan speed of 32 s for periods up to 37.3 min The focus, contrast, or brightness settings remained constant during the course of image acquisition. For analysis, images were arranged sequentially in a movie sequence on LSM 410 software provided by Zeiss.
| |
RESULTS |
|---|
|
|
|---|
Expression of Cx43-GFP in Mammalian Cells
Cx43-deficient MDCK cells were transfected with cDNA encoding
Cx43-GFP to examine their ability to biosynthesize full-length Cx43-GFP
fusion protein. Western blots of cellular lysates from MDCK cells that
express Cx43-GFP immunolabeled with anti-GFP (Figure 2I, lane a), anti-Cx43 polyclonal (Figure
2I, lane b), or anti-Cx43 monoclonal (Figure 2I, lane c) revealed a
major protein band at 65 kDa with a minor species at 72 kDa. We also
chose to examine whether a communication-incompetent cell line was
capable of producing Cx43-GFP. Wild-type HeLa cells were negative for
both GFP and Cx43 (Figure 2II, lane b), whereas GFP was resolved at 30 kDa in HeLa cells transfected with cDNA encoding for GFP alone (Figure 2II, lane c). Similar to MDCK cells, the major species of the Cx43-GFP
chimera was resolved at 65 kDa in Cx43-GFP-expressing HeLa cells,
whereas minor Cx43-GFP species were detected at 72 and 79 kDa (Figure
2II, lane d). Moreover, immunoprecipitation of Cx43-GFP from
32Pi-labeled cells revealed that the chimera
was a phosphoprotein (our unpublished results). Recombinant GFP protein
was detected as expected at 30 kDa with an anti-GFP antibody (Figure
2II, lane a).
|
The Cx43-GFP Chimera Traffics to the Plasma Membrane and Assembles into Gap Junctions
We next chose to examine whether the Cx43-GFP chimera would
transport properly to the plasma membrane and form fluorescent puncta
at cell-cell interfaces. We used an MDCK cell line that does not
express Cx43 as our prototype, because the Cx43-GFP was readily
expressed in these cells (Figure 2I). In addition, we transfected cells
that were communication deficient (HeLa and N2A) to see whether
Cx43-GFP alone was sufficient to form gap junctions, and, finally, we
transfected cells that expressed wild-type Cx43 (NRK). In both
transiently and stably expressing cell lines, when we observed chimera
protein expression by fluorescence, we could observe puncta at
cell-cell interfaces (Figures 3-11).
Because NRK cells normally express abundant Cx43, transfection with the cDNA for Cx43-GFP would allow us to test whether the presence of the
chimera affects native gap junction formation. When Cx43-GFP was
expressed in NRK cells, gap junction-like staining was readily observed
in fixed cells at interfaces where adjoining cells both expressed
Cx43-GFP (Figure 3, B and C, arrows). In addition, gap junction plaques
were formed at interfaces between NRK cells expressing GFP-tagged Cx43
and untransfected cells, which likely contribute wild-type Cx43 (Figure
3, C and D, double arrows). Imaging of live NRK cells transfected with
cDNA encoding Cx43-GFP also revealed gap junction plaques (Figure 3D,
double arrows). In addition, this finding in live cells supports
early freeze-fracture results (Zampighi et al., 1988
),
because it demonstrated that gap junction channel clustering and plaque
formation are not artifacts of commonly used fixation or rapid freezing
protocols. As a control, imaging of live NRK cells expressing GFP only
demonstrated that this protein had no distinct localization pattern and
was found in both the cytoplasm and nucleus (Figure 3E). To examine
whether the paranuclear distribution of Cx43-GFP observed in NRK cells
was due to a Golgi apparatus localization, NRK cells expressing
Cx43-GFP (Figure 3F) were labeled with an antibody specific for MG-160,
a resident protein of the Golgi apparatus (Figure 3G). MG-160 was found
to colocalize with intracellular Cx43-GFP (Figure 3, F and G, arrows).
|
We also sought to immunologically colocalize Cx43 and GFP in both
communication-competent NRK cells and communication-deficient N2A cells
(Veenstra et al., 1992
) that had been transfected with cDNA
encoding Cx43-GFP. Cx43-GFP expressed in NRK cells (Figure 4, A and D) was colocalized with both
anti-GFP (Figure 4B) and anti-Cx43 (Figure 4E) antibodies with
essentially 100% overlap with the GFP fluorescence (Figure 4, C and
F). The additional immunostaining for Cx43 observed in NRK cells was
most likely due to the presence of wild-type Cx43 (Figure 4, E and F).
GFP fluorescence in N2A cells expressing Cx43-GFP (Figure 4, G and J)
colocalized with both anti-GFP (Figure 4H) and anti-Cx43 (Figure 4K)
antibody-labeling patterns (Figure 4, I and L), confirming that the
fusion protein contains both Cx43 and GFP moieties. Note that N2A cells
contained a larger intracellular pool of Cx43-GFP in a paranuclear
location reminiscent of the Golgi apparatus (Laird et al.
1995
) and the Golgi pool of Cx43-GFP observed in NRK cells (Figure 3).
Connexin-dependent hemichannel activity has been reported in the plasma
membrane of various cell types (Li et al., 1996
), but the
visualization of Cx43 in membranes where cells are not apposed has not
been well documented. Localization studies of Cx43-GFP in transfected
N2A cells revealed the chimeric protein at the cell surface of both
single cells (our unpublished results) and at sites where the
transfected N2A cell had no apposed neighbor (Figure 4, arrows).
|
Cx43-GFP Gap Junction Plaques Are Triton X-100 Resistant and Exhibit Normal Ultrastructure
Gap junctions have the property of being resistant to nonionic
detergents (Musil and Goodenough 1991
). Therefore, we treated cells
with detergent to determine whether the punctate fluorescent staining
we observed was also detergent resistant. Live MDCK cells that
express Cx43-GFP were imaged (Figure 5A)
and then treated with 1% Triton X-100 in situ and reimaged (Figure
5B). Densitometry of the images using NIH-Image (available at
http://rsb.info.nih.gov/nih-image) indicated that 54% of the
fluorescence intensity was lost in the paranuclear region compared with
a reduction of 17% at the cell-cell interface.
|
To examine the characteristics of Cx43-GFP at the ultrastructural
level, MDCK cells expressing Cx43-GFP were prepared for conventional
and immunoelectron microscopy analysis. Although parental MDCK cells
were rich in desmosomes and contained many multivesicular bodies, no
gap junction plaques were observed by conventional thin-section
electron microscopy (Figure 5C), and they were devoid of Cx43 by
Western immunoblots (our unpublished results). MDCK cells
expressing Cx43-GFP had many large gap junction plaques (Figure 5, D
and E). Confirmation that the gap junction plaques observed by
thin-section electron microscopy contained the Cx43-GFP fusion protein
was provided when thin sections were immunogold labeled for GFP (Figure
6, A and B) or Cx43 (Figure 6, C and D).
Gold particles decorating the gap junctional plaques are shown in
Figure 6 (arrows, all four panels). Together these results strongly
suggest that Cx43-GFP was assembled into normal gap junction plaques
that exhibit the biochemical property of being Triton X-100 resistant.
|
Cx43-GFP Does Not Inhibit Gap Junction Communication and Assembles into Functional Gap Junction Channels
To ascertain whether Cx43-GFP can inhibit communication in
communication-competent, Cx43-positive NRK cells, one cell in a colony
of NRK cells that expressed heterogeneous levels of Cx43-GFP was
comicroinjected with Neurobiotin and rat IgG (Figure
7, A and C, green, asterisk). Neurobiotin
spread extensively to cells that expressed high levels of Cx43-GFP
(Figure 7C, upper region, red) and to NRK cells that appear to have no
detectable fusion protein (Figure 7C, lower region, red). The cell that
was microinjected was detected by immunolabeling for rat IgG (Figure
7A, green in cytoplasm). Untreated NRK cells, NRK cells expressing GFP,
and NRK cells expressing the Cx43-GFP chimera effectively transferred Neurobiotin to greater than 88% of the neighboring cells (Table 1). Transfer was extensive with almost
all injections resulting in transfer to fourth tier cells.
|
|
To determine whether Cx43-GFP assembles into functional gap
junction channels, communication-deficient HeLa cells were stably transfected with cDNA encoding Cx43-GFP. Wild-type HeLa cells (Figure
8A) microinjected with Lucifer yellow
(Figure 8B) transferred dye to an average of 0.39 ± 0.13 cells
(202 injections; n = 5) with 23% of the microinjections
exhibiting a very low level of dye coupling (Table 1). Conversely, HeLa
cells stably expressing Cx43-GFP (Figure 8C) exhibited a subtle change
in morphology and a significant increase in transfer of Lucifer yellow
(Figure 8D), with dye spreading to an average of 3.01 ± 0.90 cells (p < 0.001; 217 injections) and with 78% of the
microinjections exhibiting dye coupling (Table 1). Similar subtle
changes in morphology were evident in HeLa cells transfected with
wild-type connexin cDNAs (Elfgang et al., 1995
). HeLa cells
expressing Cx43-GFP also significantly increased their ability to
transfer microinjected Neurobiotin (86% of microinjected cells) over
the levels observed in untreated HeLa cells (14% of microinjected
cells) or HeLa cells that expressed GFP alone (15% of microinjected
cells) (Table 1). The low level of apparent dye transfer that occurs
occasionally in the absence of Cx43-GFP was often very rapid, most
likely due to cytoplasmic bridges that exist between incompletely
divided daughter cells. In other cases, cell processes from an adjacent cell may have been injected at the same time as the primary cell. To
further examine whether the Cx43-GFP fusion protein was capable of
assembling into functional channels in other communication-deficient cells, we also studied N2A cells, because they have been reported to
express no known connexins and are unable to form gap junctions (Veenstra et al. 1992
). N2A cells expressing Cx43-GFP
(Figure 8E, arrows) were microinjected with Lucifer yellow (Figure 8F, asterisks), and dye was observed to transfer to multiple neighbors (Figure 8F). In only rare occasions was dye not detected in neighboring cells that expressed Cx43-GFP at cell-cell interfaces, possibly reflecting insufficient time for dye transfer. In quantification studies, wild-type N2A cells essentially showed no Lucifer yellow dye
transfer, with only 4% of the injections showing transfer to a single
neighbor (Table 1). However, after transfection with Cx43-GFP cDNA, N2A
cells exhibited a significant increase in dye coupling, because 93% of
the microinjected N2A cells transferred dye (Table 1).
|
Real-Time Cell Surface Clustering of Cx43-GFP Gap Junctions
To examine the fate of Cx43-GFP present at the
cell surface and in apparent gap junction structures, live MDCK cells
were imaged for 37.3 min (Figure 9).
Although, the majority of assembled gap junction plaques moved short
distances (0.05 µm) back and forth, they remained relatively
stationary during the time series of images (Figure 9, arrow). This
observation also demonstrated that the cells were not moving during the
time course of the experiment. However, several fluorescent gap
junction plaques moved within the plasma membrane and coalesced during
the 37.3-min time series (Figure 9, circle, insets). An interesting
feature of intracellular Cx43-GFP that cannot be effectively
demonstrated in static images (Figure 9) but is apparent when the data
are presented as a QuickTime movie sequence is that intracellular
transport intermediates migrate rapidly, and somewhat randomly, within
the cell (online version for Figure 9 available at
www.molbiolcell.org).
|
Cx43-GFP Trafficking Involves Two Populations of Transport Intermediates
To further examine the size and track the mobility of Cx43
transport intermediates, additional time-lapse imaging was performed on
MDCK cells that expressed Cx43-GFP. The pool of Cx43-GFP transport intermediates that exists in MDCK cells was found to be both
heterogeneous and differentially mobile (Figure
10). Although the resolution of the
fluorescence microscope is not sufficient to determine whether these
transport intermediates have strict vesicular characteristics, they
possess properties consistent with other GFP chimeras of exported
proteins and peptides (Kaether and Gerdes 1995
; Burke et
al., 1997
; Kaether et al., 1997
; Wacker et
al. 1997
). Clearly there were at least two subfamilies of Cx43-GFP
transport intermediates observed within MDCK cells. Given that there is
a resolution limit with fluorescent microscopy of 0.2 µm, we chose to
subcategorize the transport intermediates into small <0.5-µm (Figure
10F, arrows) and large 0.5- to 1.5-µm categories (Figure 10F, double
arrows). The smaller transport intermediates were typically more
numerous, but time series imaging revealed that both populations of
transport intermediates were highly mobile (online version for Figure
10 available at www.molbiolcell.org). On occasion, we have observed small transport intermediates apparently fusing with the plasma membrane, suggesting that they represent part of the secretory pathway
(our unpublished results).
|
Budding and Internalization of Cx43-GFP Gap Junctions in Real Time
To examine the possibility that some of the large transport
intermediates originated from the internalization of gap junctions or
pieces of gap junctions, we followed the fate of cell surface gap
junctions in live MDCK cells that express Cx43-GFP. In the course of
96 s, a piece of a gap junction appeared to bud and separate from
a row of existing gap junction plaques (Figure
11, C and D, arrows, insets). We
believe gap junctions or gap junction fragments indeed bud from the
plasma membrane, because these events were frequent, and it is possible
to see a reduction in the size of the cell surface gap junction from
which the bud originated (Figure 11, compare B and D insets).
Time-lapse imaging revealed that within minutes this internalized gap
junction migrated to a perinuclear position within the cytoplasm
(Figure 11, E-I, arrow; online version for Figure 11 available at
www.molbiolcell.org). This process of gap junction internalization may
account for a significant population of the large Cx43-GFP transport
intermediates that are seen in MDCK cells.
|
| |
DISCUSSION |
|---|
|
|
|---|
To examine the mechanisms of how Cx43 is transported to the plasma
membrane and assembled in mammalian cells, we engineered and expressed
a Cx43-GFP chimera that exhibits properties and characteristics of
wild-type Cx43. The fusion protein electrophoresed as a major protein
band at 65 kDa, which appears to be fully intact, because it was
detected using multiple antibodies to the N- and C-terminal portions of
Cx43 and to GFP. Moreover, Cx43-GFP was found to be a phosphoprotein
consistent with wild-type Cx43 (Crow et al., 1990
; Laird and
Revel 1990
; Laird et al., 1991
; Musil et al.,
1990
; Musil and Goodenough, 1991
). We have not ruled out the
possibility that a portion of Cx43-GFP may be ubiquitinated, because
wild-type Cx43 has been shown to be a suitable substrate for
ubiquitination (Laing and Beyer 1995
). When this fusion protein was
expressed in a variety of communication-competent and -incompetent mammalian cells, it was efficiently transported to the cell surface and
assembled into gap junction plaques. Comparative studies of fixed and
live cells, which expressed Cx43-GFP, revealed that clustering of gap
junction channels was not induced by fixation procedures but rather was
an inherent feature of gap junctions in living cells. Ultrastructural
analysis revealed that the Cx43-GFP chimera was assembled into large
gap junction plaques that exhibit the classic pentalaminar, gap
junctional profile. Previously, it has been demonstrated that gap
junction plaques assembled from wild-type Cx43 exhibit a resistance to
Triton X-100 solubility (Musil and Goodenough 1991
). Similarly, gap
junction plaques assembled from Cx43-GFP also exhibit a resistance to
Triton X-100 in situ. Consequently, based on biochemical and
morphological parameters, gap junctions assembled from Cx43-GFP exhibit
the same characteristics as gap junctions assembled from wild-type Cx43.
We investigated the possibility that Cx43-GFP might inhibit
communication in communication-competent cells because expression of a
Cx43-
-galactosidase fusion protein inhibited gap junctional communication in NIH3T3 cells (Sullivan and Lo 1995
). However, functional studies in NRK cells that expressed low to high levels of
Cx43-GFP showed extensive Neurobiotin transfer, eliminating the
possibility that the fusion protein was capable of inhibiting communication in communication-competent NRK cells at these levels of
protein expression. More importantly, when Cx43-GFP was expressed in
communication-deficient HeLa or N2A cells, functional channels capable
of passing both Lucifer yellow and/or Neurobiotin were assembled. These
results were consistent with the findings of Martin et al.
(1998)
, in which Cx43-aequorin fusion protein was found to assemble
into functional gap junction channels in communication-deficient HeLa
cells. Whether Cx43-GFP is being assembled into homomeric channels or
recruiting undefined connexins from the communication-deficient HeLa or
N2A cells remains unclear. Given that both of these cell types have no
apparent expression of endogenous connexins and are communication
deficient, we propose that homomeric channels composed of Cx43-GFP are
functional. This conclusion is further supported by recent
electrophysiological recordings on N2A cells that express punctate
Cx43-GFP at cell-cell interfaces (e.g., Figure 8E). Electrical
coupling in these cells was only observed when plaques were visible via
intrinsic Cx43-GFP fluorescence, and the single-channel conductance
observed was very similar to wild-type (~100 pS) Cx43 channels
(Verselis, personal communication).
The generation of a Cx43-GFP chimera that exhibits wild-type Cx43
characteristics allowed us to address the mechanisms of connexin
trafficking and gap junction assembly in living cells. Consistent with
previous biochemical and functional studies that showed that Cx43 gap
junction hemichannels exist on the surface of mammalian cells (Beyer
and Steinberg 1991
; Li et al. 1996
), we were able to
visualize constitutive levels of nonjunctional Cx43-GFP on the surface
of N2A transfectants. This finding suggests that there is no
requirement for a cell-cell contact signal for Cx43-GFP to traffic to
the cell surface. This is particularly interesting because we and
others have shown that a calcium-dependent cell-cell adhesion event is
necessary for gap junction plaque channel formation (Musil et
al. 1990
; Jongen et al., 1991
; Meyer et al.,
1992
). It may be the case that some clones of N2A cells, which express
relatively large amounts of Cx43-GFP, are not efficient at forming
adherens and gap junctions. This results in a cell surface accumulation
of nonjunctional Cx43-GFP, as may be the case when some wild-type
connexins are expressed in N2A cells (Rup et al., 1993
).
However, because we can also observe low levels of nonjunctional
Cx43-GFP in other mammalian cells, we suggest that the sensitivity of
red-shifted GFP when fused to Cx43 allows for an apparent visualization
of hemichannel intermediates in channel formation. Together, these
results would suggest that downstream signaling via cadherins is not
necessary for recruitment of connexins or Cx43-GFP to the cell surface
but is probably necessary for junctional channel formation.
It has been known for some time that connexins are dynamic molecules
with half-lives of 1-5 h (Fallon and Goodenough 1981
; Traub et
al., 1987
; Laird et al. 1991
). The results from
connexin pulse-chase studies suggest that gap junctions are constantly being formed and removed from the cell surface. Because the Cx43-GFP fusion protein exhibited characteristics of wild-type Cx43, it was
possible to examine the life cycle of a connexin in living cells
including the transport mechanisms involved in delivering connexins to
the plasma membrane, the mobility of gap junctions within the plasma
membrane, and the removal of gap junctions from the cell surface.
Time-lapse imaging of Cx43-GFP revealed that gap junction plaques
within the plasma membrane exhibit a range of mobility. It is possible
to speculate that the relative immobility of the majority of gap
junction plaques is due to a direct or indirect attachment to the
cytoskeletal network. Although microfilaments have been reported to be
necessary for Cx43 channel clustering (Wang and Rose 1995
), it remains
unclear as to role of cytoskeletal elements in plaque formation or
maintenance. The resistance of many Cx43-GFP gap junctions to Triton
X-100 in situ further suggests that many gap junctions are likely to be
relatively immobile within the plasma membrane. In some areas of the
plasma membrane, time-lapse imaging revealed that gap junctions are
mobile and coalesce to form large fluorescent clusters. It is unlikely
that membrane ruffling, which characteristically occurs at free cell
edges, can account for the coalescence and changes in the shape of
Cx43-GFP fluorescent signals within the plasma membrane as this dynamic movement of gap junctions occurs at sites of cell-cell contact. Although our ultrastructural analysis of MDCK cells expressing Cx43-GFP
revealed large gap junction plaques, it is not possible to determine
whether plaques are fusing within the plasma membrane. Moreover,
whether laterally mobile gap junction plaques represent newly formed
gap junctions or gap junctions that are soon to be internalized and
degraded remains to be investigated.
A prominent feature of our time-lapsed movies of MDCK cells that
express Cx43-GFP is the persistence of intracellular transport intermediates. Based on the apparent size of the fluorescence emanating
from the GFP moiety and the limits of fluorescent microscopy, we have
subcategorized these structures as small (<0.5 µm) and large
(0.5-1.5 µm). An interesting feature of both populations of Cx43-GFP
transport intermediates is that they exhibit rapid, intermittent, and
somewhat random movement often migrating distances of 5-10 µm. The
rapid movement of the Cx43-GFP transport intermediates may reflect a
microtubule-dependent mechanism, which has previously been proposed for
the chromogranin B-GFP-positive vesicles (Wacker et al.
1997
). In preliminary studies, we have demonstrated that the total
distance of displacement was reduced in both small and large transport
intermediates by ~50% when cells are treated with nocodazole (our
unpublished results), suggesting that microtubules play a role in
Cx43-GFP trafficking. The fact that the smaller Cx43-GFP transport
intermediates represent a size reminiscent of untagged or GFP-tagged
secretory vesicles (Oberhauser and Fernandez 1995
; Chen et
al., 1996
; Chen et al., 1997
; Burke et al.
1997
; Wacker et al. 1997
) suggests that these structures may
represent transport of Cx43-GFP to the cell surface. Although further
investigation is necessary, in some movie sequences these small
transport intermediates that exhibit short periods of directed movement
have occasionally been observed to associate with the plasma membrane.
Experimentally, we were able to determine that at least a portion of
the larger transport intermediates were generated from the rapid
budding and internalization of gap junction fragments. Time-lapse
imaging revealed that only one cell of an adjoining pair of cells
internalized the entire gap junction fragment, and no splitting of gap
junctions has been observed to date. These internalized gap junctions
may be similar or identical to the annular gap junctions that have been
seen in electron micrographs (Larsen and Hai 1978
; Severs et
al., 1989
; Naus et al., 1993
; Murray et al.,
1997
). In some cases, these internalized gap junctions could be
followed as they migrated away from the cell surface, whereas in other
cases they disappeared quickly, possibly because of degradation. At
present it is not possible to determine whether all of the large
intracellular transport intermediates that we observe in living cells
originate from the internalization of a gap junction, but it appears
that this represents at least one pathway for gap junction removal. An
alternative pathway that may exist for removal of gap junctions could
be dispersal or degradation of the plaque in situ. In N2A cells, we
have observed punctate fluorescence that decreases rapidly in intensity
in a manner that is not indicative of photobleaching. To date, we have
not been able to reliably follow the fate of Cx43-GFP in living cells
for more than 40 min because of photobleaching, stage shifting, and optical drift. Once these technical limitations have been overcome, we
plan to examine the assembly and fate of individual gap junctions for
several hours and correlate connexin half-lives with gap junction plaque turnover. Nevertheless, in our live cell studies we have obtained convincing evidence of gap junction internalization (Figure 11), which we believe represents a part of the turnover cycle. Consequently, although one might consider many Cx43-GFP gap junction plaques to be static, we expect that they are dynamic, as would be
predicted from the turnover kinetics of wild-type Cx43.
In summary, we have engineered and characterized a novel Cx43-GFP fusion protein, which maintains many characteristics of wild-type Cx43, including its ability to oligomerize and assemble into functional gap junction channels. The tracking of Cx43-GFP in living cells has allowed us to identify two populations of highly mobile transport intermediates that are involved in trafficking Cx43-GFP during dynamic gap junction renewal. Time-lapse imaging also revealed that the larger transport intermediates are generated from the internalization of gap junctions or fragments of gap junctions. Analysis of living cells also revealed that many gap junctions are relatively immobile, whereas others cluster at the cell surface, suggesting possible direct or indirect transient linkages to cytoskeletal elements. This fusion protein, when expressed and examined in living cells, will continue to allow us to elucidate the mechanism(s) and regulation of gap junction assembly and removal from the cell surface in steady-state cells and during cell division.
| |
ACKNOWLEDGMENTS |
|---|
We thank Drs. J.J.M. Bergeron, P. Walton, and Q. Shao for helpful insights and comments on this study. We also thank Lana Tan and Jon Gordon for assistance in generating and customizing the movies. This research was supported by Medical Research Council of Canada operating grant MT-12241 (to D.W.L.) and National Institutes of Health research grant GM-55632 (to P.D.L.). M.D. was supported by a Medical Research Council of Canada grant (to Dr. Bergeron).
| |
FOOTNOTES |
|---|
Online version of this article contains video material
for Figures 9-11. Online version available at www.molbiolcell.org.
§ Present Address: Mayo Clinic and Foundation, Rochester, MN, 55905.
¶ Corresponding author. E-mail address: dwlaird{at}julian.uwo.ca.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Simek, J. Churko, Q. Shao, and D. W. Laird Cx43 has distinct mobility within plasma-membrane domains, indicative of progressive formation of gap-junction plaques J. Cell Sci., February 15, 2009; 122(4): 554 - 562. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gilleron, C. Fiorini, D. Carette, C. Avondet, M. M. Falk, D. Segretain, and G. Pointis Molecular reorganization of Cx43, Zo-1 and Src complexes during the endocytosis of gap junction plaques in response to a non-genomic carcinogen J. Cell Sci., December 15, 2008; 121(24): 4069 - 4078. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. L. Hutnik, C. E. Pocrnich, H. Liu, D. W. Laird, and Q. Shao The Protective Effect of Functional Connexin43 Channels on a Human Epithelial Cell Line Exposed to Oxidative Stress Invest. Ophthalmol. Vis. Sci., February 1, 2008; 49(2): 800 - 806. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Solan, L. Marquez-Rosado, P. L. Sorgen, P. J. Thornton, P. R. Gafken, and P. D. Lampe Phosphorylation at S365 is a gatekeeper event that changes the structure of Cx43 and prevents down-regulation by PKC J. Cell Biol., December 17, 2007; 179(6): 1301 - 1309. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-Q. Gong, Q. Shao, S. Langlois, D. Bai, and D. W. Laird Differential Potency of Dominant Negative Connexin43 Mutants in Oculodentodigital Dysplasia J. Biol. Chem., June 29, 2007; 282(26): 19190 - 19202. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Piehl, C. Lehmann, A. Gumpert, J.-P. Denizot, D. Segretain, and M. M. Falk Internalization of Large Double-Membrane Intercellular Vesicles by a Clathrin-dependent Endocytic Process Mol. Biol. Cell, February 1, 2007; 18(2): 337 - 347. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lai, D.-N. Le, W. A. Paznekas, W. D. Gifford, E. W. Jabs, and A. C. Charles Oculodentodigital dysplasia connexin43 mutations result in non-functional connexin hemichannels and gap junctions in C6 glioma cells J. Cell Sci., February 1, 2006; 119(3): 532 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Hunter, R. J. Barker, C. Zhu, and R. G. Gourdie Zonula Occludens-1 Alters Connexin43 Gap Junction Size and Organization by Influencing Channel Accretion Mol. Biol. Cell, December 1, 2005; 16(12): 5686 - 5698. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Thomas, K. Jordan, J. Simek, Q. Shao, C. Jedeszko, P. Walton, and D. W. Laird Mechanisms of Cx43 and Cx26 transport to the plasma membrane and gap junction regeneration J. Cell Sci., October 1, 2005; 118(19): 4451 - 4462. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Laing, B. C. Chou, and T. H. Steinberg ZO-1 alters the plasma membrane localization and function of Cx43 in osteoblastic cells J. Cell Sci., May 15, 2005; 118(10): 2167 - 2176. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Roscoe, G. I. L. Veitch, X.-Q. Gong, E. Pellegrino, D. Bai, E. McLachlan, Q. Shao, G. M. Kidder, and D. W. Laird Oculodentodigital Dysplasia-causing Connexin43 Mutants Are Non-functional and Exhibit Dominant Effects on Wild-type Connexin43 J. Biol. Chem., March 25, 2005; 280(12): 11458 - 11466. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M Berthoud, P. J Minogue, J. G Laing, and E. C Beyer Pathways for degradation of connexins and gap junctions Cardiovasc Res, May 1, 2004; 62(2): 256 - 267. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E.M. Martin and W.H. Evans Incorporation of connexins into plasma membranes and gap junctions Cardiovasc Res, May 1, 2004; 62(2): 378 - 387. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lin, J. Zhou, P. S. Zelenka, and D. J. Takemoto Protein Kinase C{gamma} Regulation of Gap Junction Activity through Caveolin-1-Containing Lipid Rafts Invest. Ophthalmol. Vis. Sci., December 1, 2003; 44(12): 5259 - 5268. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hoffmann, T. Gloe, U. Pohl, and S. Zahler Nitric oxide enhances de novo formation of endothelial gap junctions Cardiovasc Res, November 1, 2003; 60(2): 421 - 430. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Cowan, M. Jones, L. M. Garcia, S. Noria, P. J. del Nido, and F. X. McGowan Jr Hypoxia and Stretch Regulate Intercellular Communication in Vascular Smooth Muscle Cells Through Reactive Oxygen Species Formation Arterioscler. Thromb. Vasc. Biol., October 1, 2003; 23(10): 1754 - 1760. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Contreras, J. C. Saez, F. F. Bukauskas, and M. V. L. Bennett Gating and regulation of connexin 43 (Cx43) hemichannels PNAS, September 30, 2003; 100(20): 11388 - 11393. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qin, Q. Shao, S. A. Igdoura, M. A. Alaoui-Jamali, and D. W. Laird Lysosomal and Proteasomal Degradation Play Distinct Roles in the Life Cycle of Cx43 in Gap Junctional Intercellular Communication-deficient and -competent Breast Tumor Cells J. Biol. Chem., August 8, 2003; 278(32): 30005 - 30014. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Lagree, K. Brunschwig, P. Lopez, N. B. Gilula, G. Richard, and M. M. Falk Specific amino-acid residues in the N-terminus and TM3 implicated in channel function and oligomerization compatibility of connexin43 J. Cell Sci., August 1, 2003; 116(15): 3189 - 3201. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Oshima, T. Doi, K. Mitsuoka, S. Maeda, and Y. Fujiyoshi Roles of Met-34, Cys-64, and Arg-75 in the Assembly of Human Connexin 26. IMPLICATION FOR KEY AMINO ACID RESIDUES FOR CHANNEL FORMATION AND FUNCTION J. Biol. Chem., January 10, 2003; 278(3): 1807 - 1816. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Cooper and P. D. Lampe Casein Kinase 1 Regulates Connexin-43 Gap Junction Assembly J. Biol. Chem., November 15, 2002; 277(47): 44962 - 44968. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Lauf, B. N. G. Giepmans, P. Lopez, S. Braconnot, S.-C. Chen, and M. M. Falk Dynamic trafficking and delivery of connexons to the plasma membrane and accretion to gap junctions in living cells PNAS, August 6, 2002; 99(16): 10446 - 10451. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qin, Q. Shao, H. Curtis, J. Galipeau, D. J. Belliveau, T. Wang, M. A. Alaoui-Jamali, and D. W. Laird Retroviral Delivery of Connexin Genes to Human Breast Tumor Cells Inhibits in Vivo Tumor Growth by a Mechanism That Is Independent of Significant Gap Junctional Intercellular Communication J. Biol. Chem., August 2, 2002; 277(32): 29132 - 29138. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Sarma, F. Wang, and M. Koval Targeted Gap Junction Protein Constructs Reveal Connexin-specific Differences in Oligomerization J. Biol. Chem., May 31, 2002; 277(23): 20911 - 20918. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. F. Bukauskas, A. Bukauskiene, V. K. Verselis, and M. V. L. Bennett Coupling asymmetry of heterotypic connexin 45/ connexin 43-EGFP gap junctions: Properties of fast and slow gating mechanisms PNAS, May 14, 2002; 99(10): 7113 - 7118. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Windoffer, M. Borchert-Stuhltrager, and R. E. Leube Desmosomes: interconnected calcium-dependent structures of remarkable stability with significant integral membrane protein turnover J. Cell Sci., April 15, 2002; 115(8): 1717 - 1732. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. D. Lampe, Q. Qiu, R. A. Meyer, E. M. TenBroek, T. F. Walseth, T. A. Starich, H. L. Grunenwald, and R. G. Johnson Gap junction assembly: PTX-sensitive G proteins regulate the distribution of connexin43 within cells Am J Physiol Cell Physiol, October 1, 2001; 281(4): C1211 - C1222. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Teubner, B. Odermatt, M. Guldenagel, G. Sohl, J. Degen, F. F. Bukauskas, J. Kronengold, V. K. Verselis, Y. T. Jung, C. A. Kozak, et al. Functional Expression of the New Gap Junction Gene Connexin47 Transcribed in Mouse Brain and Spinal Cord Neurons J. Neurosci., February 15, 2001; 21(4): 1117 - 1126. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. M. Martin, G. Blundell, S. Ahmad, R. J. Errington, and W. H. Evans Multiple pathways in the trafficking and assembly of connexin 26, 32 and 43 into gap junction intercellular communication channels J. Cell Sci., January 11, 2001; 114(21): 3845 - 3855. [Abstract] [Full Text] [PDF] |
||||
![]() |
K Jordan, R Chodock, A. Hand, and D. Laird The origin of annular junctions: a mechanism of gap junction internalization J. Cell Sci., January 2, 2001; 114(4): 763 - 773. [Abstract] [PDF] |
||||
![]() |
G. V. Childs Editorial: Green Fluorescent Proteins Light the Way to a Better Understanding of the Function and Regulation of Specific Anterior Pituitary Cells Endocrinology, December 1, 2000; 141(12): 4331 - 4333. [Full Text] [PDF] |
||||
![]() |
S. Boitano and W. H. Evans Connexin mimetic peptides reversibly inhibit Ca2+ signaling through gap junctions in airway cells Am J Physiol Lung Cell Mol Physiol, October 1, 2000; 279(4): L623 - L630. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Pal, X. Liu, D. Mackay, A. Shiels, V. M. Berthoud, E. C. Beyer, and L. Ebihara Connexin46 mutations linked to congenital cataract show loss of gap junction channel function Am J Physiol Cell Physiol, September 1, 2000; 279(3): C596 - C602. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Paemeleire, P. E. M. Martin, S. L. Coleman, K. E. Fogarty, W. A. Carrington, L. Leybaert, R. A. Tuft, W. H. Evans, and M. J. Sanderson Intercellular Calcium Waves in HeLa Cells Expressing GFP-labeled Connexin 43, 32, or 26 Mol. Biol. Cell, May 1, 2000; 11(5): 1815 - 1827. [Abstract] [Full Text] |
||||
![]() |
J. E. Saffitz, J. G. Laing, and K. A. Yamada Connexin Expression and Turnover : Implications for Cardiac Excitability Circ. Res., April 14, 2000; 86(7): 723 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Falk Connexin-specific distribution within gap junctions revealed in living cells J. Cell Sci., January 11, 2000; 113(22): 4109 - 4120. [Abstract] [PDF] |
||||
![]() |
A. W. Ashton, R. Yokota, G. John, S. Zhao, S. O. Suadicani, D. C. Spray, and J. A. Ware Inhibition of Endothelial Cell Migration, Intercellular Communication, and Vascular Tube Formation by Thromboxane A2 J. Biol. Chem., December 10, 1999; 274(50): 35562 - 35570. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Mitic, E. E. Schneeberger, A. S. Fanning, and J. M. Anderson Connexin-Occludin Chimeras Containing the ZO-binding Domain of Occludin Localize at MDCK Tight Junctions and NRK Cell Contacts J. Cell Biol., August 9, 1999; 146(3): 683 - 693. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Mao, J. Bechberger, D. Lidington, J. Galipeau, D. W. Laird, and C. C. G. Naus Neuronal Differentiation and Growth Control of Neuro-2a Cells After Retroviral Gene Delivery of Connexin43 J. Biol. Chem., October 27, 2000; 275(44): 34407 - 34414. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. F. Bukauskas, K. Jordan, A. Bukauskiene, M. V. L. Bennett, P. D. Lampe, D. W. Laird, and V. K. Verselis Clustering of connexin 43-enhanced green fluorescent protein gap junction channels and functional coupling in living cells PNAS, March 14, 2000; 97(6): 2556 - 2561. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||