Molecular Biology of the Cell click for CBE Life Science Education Page

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, S.
Right arrow Articles by Drubin, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, S.
Right arrow Articles by Drubin, D. G.

Vol. 10, Issue 7, 2265-2283, July 1999

Sla2p Is Associated with the Yeast Cortical Actin Cytoskeleton via Redundant Localization Signals

Shirley Yang,* M. Jamie T. V. Cope, and David G. Drubindagger

Department of Molecular and Cell Biology, University of California, Berkeley, California 94720-3202

Submitted November 25, 1998; Accepted April 20, 1999
Monitoring Editor: David Botstein

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERNCES

Sla2p, also known as End4p and Mop2p, is the founding member of a widely conserved family of actin-binding proteins, a distinguishing feature of which is a C-terminal region homologous to the C terminus of talin. These proteins may function in actin cytoskeleton-mediated plasma membrane remodeling. A human homologue of Sla2p binds to huntingtin, the protein whose mutation results in Huntington's disease. Here we establish by immunolocalization that Sla2p is a component of the yeast cortical actin cytoskeleton. Deletion analysis showed that Sla2p contains two separable regions, which can mediate association with the cortical actin cytoskeleton, and which can provide Sla2p function. One localization signal is actin based, whereas the other signal is independent of filamentous actin. Biochemical analysis showed that Sla2p exists as a dimer in vivo. Two-hybrid analysis revealed two intramolecular interactions mediated by coiled-coil domains. One of these interactions appears to underlie dimer formation. The other appears to contribute to the regulation of Sla2p distribution between the cytoplasm and plasma membrane. The data presented are used to develop a model for Sla2p regulation and interactions.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERNCES

SLA2 (Synthetic Lethal with ABP1), also known as END4 and MOP2, is essential in yeast for correct organization of the cortical actin cytoskeleton (Holtzman et al., 1993). It is also required for endocytosis and for accumulation or maintenance of a plasma membrane ATPase at the cell surface (Raths et al., 1993; Na et al., 1995). Sla2p might therefore facilitate actin-mediated plasma membrane remodeling.

Cells lacking Sla2p are temperature sensitive for growth. In addition, they exhibit a disorganized actin cytoskeleton, and their cell surface growth is depolarized (Holtzman et al., 1993). Instead of the characteristic ellipsoid cell shape displayed by wild-type diploid cells, sla2 mutants are spherical. The cortical actin patches, normally spatially restricted to growing domains within the cell cortex, are no longer concentrated at the surface of the bud and instead are distributed evenly across the surface of the mother cell and the bud. Finally, sla2 mutant cells accumulate post-Golgi vesicles, possess an abnormally thick cell wall, and do not undergo the wild-type bipolar budding pattern (Mulholland et al., 1997; Yang et al., 1997). Several of these defects are characteristic of mutants affecting the cortical actin cytoskeleton.

A deletion mutation of SLA2 is synthetically lethal with null alleles of at least three genes encoding components of the cortical actin cytoskeleton. These genes are ABP1 (Holtzman et al., 1993), which encodes a protein containing a C-terminal Src homology 3 domain and an N-terminal ADF homology domain (Drubin et al., 1990; Lappalainen et al., 1998), SRV2 (Lila and Drubin, 1997), which encodes a protein that binds to actin monomers and to adenylyl cyclase, a component of the Ras signaling pathway in yeast (Freeman et al., 1995, 1996), and SAC6 (Holtzman et al., 1993), which encodes the actin filament-bundling protein fimbrin. A deletion mutant of SLA2 is also synthetic lethal with a deletion mutant of GCS1. Gcs1p is a GTPase-activating protein for Arf proteins in yeast that also appears to have a direct effect on actin dynamics (Blader et al., 1999). These genetic interactions suggest that Sla2p, Sac6p, Srv2p, Abp1p, and Gcs1p contribute to common properties of the cytoskeleton.

SLA2 encodes a protein of 968 amino acids with a predicted molecular mass of 109 kDa. Homologues of Sla2p have been identified in nematodes, fruit flies, mice, and humans. Hip1p, a human homologue of Sla2p, binds to huntingtin, the protein product of the Huntington's disease (HD) gene (Kalchman et al., 1997; Wanker et al., 1997). Thus, studies of Sla2p might provide insights into the etiology of HD. Sla2p and related proteins all share a similar arrangement of three predicted coiled-coil regions (amino acids 360-580, 700-730, and 930-960 of Sla2p), as well as a C-terminal domain similar to the C terminus of talin, a protein found in focal adhesion plaques (Figure 1A). Talin contains at least three actin-binding sites, one of which, amino acids 2269-2541, spans the region that shows homology to Sla2p (Hemmings et al., 1996). Indeed, this region of Sla2 has been shown by in vitro biochemical studies to bind to actin (McCann and Craig, 1997).


View larger version (33K):
[in this window]
[in a new window]
 
Figure 1.   Domain arrangement of Sla2p. (A) Schematic diagram of identifiable domains in Sla2p. The three predicted coiled-coil forming domains are indicated, as well as glutamine- and proline-rich regions and the C-terminal talin-like domain. (B) The COILS program (Lupas et al., 1991) was used to predict the potential coiled-coil-forming domains of Sla2p and its homologues in humans (Hip1p) and nematodes (GenBank accession number 1353119). The probability of coiled coil formation is plotted as a function of the amino acid position in the protein. All three proteins are ~950 amino acids in length, and, in addition to sharing secondary structure, they show ~20% identity over their lengths.

Previous studies have shown that Sla2p is a peripheral membrane protein (Na et al., 1995; Wesp et al., 1997) and is likely to be part of a protein complex in vivo. In addition, Sla2p sediments as a single peak at ~10.6 S, which correlates to 220 kDa, or about twice its molecular mass (Wesp et al., 1997). This behavior required the presence of the large, central coiled-coil domain. Wesp and colleagues (1997) performed a domain analysis in an attempt to correlate Sla2p's function with its various regions. A Sla2p N-terminal deletion protein lacking amino acids 114-284 was unable to restore endocytosis, actin organization, and growth at high temperature in sla2Delta mutant cells. Because none of the other deletion mutants of Sla2p exhibited this severe lack of activity, they concluded that the N-terminal region of Sla2p is indispensable for its cellular activity. Somewhat surprisingly, the talin-like domain was shown to be dispensable for endocytosis and growth at high temperature. Finally, as well as appearing to be involved in the formation of either a dimer or a multiprotein complex, the central coiled-coil domain of Sla2p was found to be required for endocytosis in genetic backgrounds mutant for ABP1 or SRV2 (Wesp et al., 1997).

In this study, we report on the cellular localization of Sla2p, demonstrating that it is a component of actin cortical patches. We also provide further analysis showing that different domains of the protein interact with each other and thereby regulate the localization and activity of Sla2p.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERNCES

Strains and Growth Conditions

Yeast strains used in this study are listed in Table 1. Standard yeast genetic procedures and media were used (Rose et al., 1990). Except where noted, yeast strains were grown at 25°C in rich YPD media.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.  Yeast strains used in this study

Plasmid Constructions and Other DNA Manipulations

All DNA manipulations were performed by standard techniques (Maniatis et al., 1982; Ausubel et al., 1989). The PCR was used to create restriction enzyme sites for cloning purposes or to build gene disruption constructs (Lorenz et al., 1995). Plasmids used in this study are listed in Table 2.

                              
View this table:
[in this window]
[in a new window]
 
Table 2.  Plasmids used in this study

GST-Sla2p Fusion Proteins

Different portions of SLA2 were cloned into pGEX-2T or pGEX-3X (Amersham Pharmacia Biotech, Piscataway, NJ) to create GST fusion proteins. The GST moiety could be cleaved from the fusion protein because pGEX-2T contains a thrombin cleavage site, and pGEX-3X contains a Factor Xa site. To construct a plasmid encoding a GST-Sla2p fusion containing amino acids 664-968 of Sla2p (pDD356), BamHI linkers were added to a 1.1-kb RsaI SLA2 fragment, which was then was cloned into the BamHI site of pGEX-2T. For the GST-Sla2p fusion protein expressing amino acids 503-968 of Sla2p (pDD358), a plasmid containing SLA2 was digested with PstI and AatII. The ends of the 1.4-kb fragment were filled in using T4 DNA polymerase. BamHI linkers were then added, and the fragment was cloned into the BamHI site of pGEX-3X. To construct a plasmid encoding the GST-Sla2p fusion expressing amino acids 90-547 of Sla2p (pDD361), a plasmid containing SLA2 was digested with BstYI. The resulting 1.4-kb fragment was subcloned into the BamHI site of pGEX-2T. The resulting plasmids were screened by restriction analysis for those containing the insert in the correct orientation.

pDD356 and pDD358 produce soluble fusion proteins, which were induced and purified as described (Ausubel, 1990). Fusion proteins were eluted from the glutathione-agarose beads with an excess of free glutathione (5 mM, pH 8.0; Sigma, St. Louis, MO). Alternatively, thrombin (Sigma) or Factor Xa (Boehringer Mannheim, Indianapolis, IN) was used to cleave and, in doing so, solubilize the Sla2p portion of the fusion protein. pDD361 produces mainly insoluble fusion protein. However, an "inclusion body" preparation from a strain expressing this plasmid provided partially purified protein that was used for generating antibodies (see below). Cells were prepared in the same manner as above, except that here the majority of the fusion protein is insoluble and present in the pellet. The fusion protein comprised most (90%) of the protein in the pellet. To purify the protein, the pellet was solubilized using sample buffer containing 2% SDS and then run on an SDS-PAGE gel. Protein was eluted from the gel as described in (Drubin et al., 1988).

Antibodies

Antibodies against Sla2p were raised in New Zealand White rabbits, essentially as described in (Harlow and Lane, 1988). To generate antibodies against the Sla2p C terminus, Sla2p amino acids 664-968 were fused to GST (pDD356). A GST fusion protein containing Sla2p amino acids 90-547 (pDD361) was used to generate the Sla2p N-terminal antibodies. The GST-Sla2 fusion from pDD356 was not further purified after glutathione elution from Sepharose beads, whereas the GST-Sla2 fusion protein from pDD361 was purified by excision of Coomassie blue-stained bands from SDS-PAGE gels. Approximately 100 µg of fusion protein were used for each injection. Freund's complete adjuvant was used for the first immunization, and Freund's incomplete adjuvant was used for subsequent injections (days 21, 36, and 78).

Antisera were affinity purified against Sla2p as follows. The GST-Sla2 fusion protein from pDD358 (amino acids 503-968 of Sla2p) was cleaved with Factor Xa and then purified further by excision of Coomassie blue-stained bands from SDS-PAGE gels. The protein was coupled to cyanogen bromide (CNBr)-activated beads, generating a column containing only Sla2p amino acids 503-968. This column was then used for affinity purification of the C-terminal antibody. The resulting affinity-purified antiserum recognized a protein with apparent molecular mass of 116 kDa in immunoblots of whole-cell extracts (1:5000 dilution) (Figure 2A). This band was absent in sla2Delta whole-cell extract. However, the antiserum also recognized another protein with apparent molecular mass of 35 kDa in whole-cell extract from wild-type or sla2Delta cells. Cross-reactivity of the antibody with this protein did not effect the localization of Sla2p by indirect immunofluorescence, however, because sla2Delta cells showed only faint background staining using this antibody. For the N-terminal antibody, antisera were first adsorbed to GST-coupled CNBr beads to deplete the anti-GST antibodies. The GST-Sla2 fusion protein from pDD361 was purified in the same manner as that used for the rabbit injections and coupled to CNBr beads. Additionally, a smaller amount of soluble GST-Sla2 fusion protein was purified by excision of Coomassie blue-stained bands from SDS-PAGE gels and then coupled to CNBr-activated beads to generate an affinity column containing only the GST-Sla2 fusion protein. Antisera affinity-purified on either column recognized similar proteins in immunoblots, although lower-titer antiserum was obtained using the latter column. These antisera (1:5000) recognized a protein with apparent molecular mass of 116 kDa that is absent in sla2Delta whole-cell extract. They also recognized less strongly a protein with apparent molecular mass of 70 kDa that is present in sla2Delta whole-cell extract. However, the reactivity against the 70-kDa protein was variable and not always observed.

Polyclonal rabbit anti-myc antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

Immunofluorescence Microscopy

Yeast cells grown to early exponential phase in either YPD or supplemented synthetic media were prepared for immunofluorescence as described previously (Pringle et al., 1991). The cold methanol-acetone fixation-permeabilization step, which is required for anti-actin reactivity, is not required for anti-Sla2p reactivity but results in better staining (probably because of the flattening of the cells allowing easier visualization of the staining pattern). Both anti-N- and anti-C-terminal affinity-purified rabbit anti-Sla2p antisera were used for immunofluorescence at a dilution of 1:50. Anti-actin guinea pig antiserum (Mulholland et al., 1994) was used at a 1:1000 dilution. Detection was accomplished by applying either FITC-conjugated goat anti-rabbit or FITC-conjugated goat anti-guinea pig antibodies (Cappel/Organon Teknika, Malvern, PA) at a dilution of 1:1000 or CY3-conjugated sheep anti-rabbit antibodies (Sigma) at a dilution of 1:200. Cells were visualized with a Zeiss Axioscop fluorescence microscope with an HB100 W/Z high-pressure mercury lamp and a Zeiss 100× Plan-Neofluar oil immersion objective (Carl Zeiss, Thornwood, NY). Images were captured electronically using a 200-E charge-coupled device camera (Sony Electronics, San Jose, CA) using Northern Exposure software (Phase 3 Imaging Systems, Milford, MA).

Endocytosis Assays

Endocytosis was assayed using the internalization of Lucifer yellow (LY; Sigma-Aldrich-Fluka, Milwaukee, WI) as a marker, according to the method described by Dulic et al. (1991).

Creation of a Diploid Strain Expressing myc Epitope-tagged and Histidine-tagged Sla2p

A 10-histidine tag flanked by BamHI sites was placed at the N terminus of Sla2p using a PCR-stitching strategy. All PCR reactions used high-fidelity DNA polymerases, and all relevant constructs were sequenced for accuracy. Two first-round PCR reactions were performed between 1) primers Sla2Htag5 (CAGGATGATGATTCGGA-TCCTCATCATCATCATCATCATCATCATCATCATGGGGATCCA -AACTGATCATGAATTGTAC) and M13Universal (GTAAAACGAC-GGCCAGTG) and 2) primers Sla2Htag6 (GTACAATTCATGATCAGTTTGGATCCCCATGATGATGATGATGATGATGATGATG-ATGAGGATCCGAATCATCATCCTG) and Sla2Htag7 (GATGTTAC-CGATGCATGC) using pDD550 as template, which is an EcoRI genomic fragment containing SLA2 inserted into pBluescript II SK+ (Stratagene, La Jolla, CA). The products of the first two PCR reactions were mixed and reamplified using the outside primers M13Universal and Sla2Htag7. The resulting amplified DNA was digested with HindIII and PflMI and used to replace a HindIII-PflMI fragment from pDD550, generating an SLA2 gene encoding Sla2p with a C-terminal 10-His tag (... DDDSDPHHHHHHHHHHGDPNstop), flanked by BamHI sites.

The 10-His tag was replaced with a 6-myc tag (6xMEQKLISEEDLNE) flanked by BamHI sites. A NotI site was placed after the predicted polyadenylation signals 3' of SLA2 using the mutagenic primer Sla2NotIins (CATATCACATCTCTGGCGGCCGCTACCATTTTGCTTC). The URA3 gene, flanked by NotI sites (from pJC56, which is pBluescript II SK+ containing URA3 flanked by SmaI/XbaI and NotI sites; our unpublished data) was inserted to generate auxotrophically marked constructs. During these manipulations, pUC118 and pGEM-9Z were used as intermediate vectors.

The EcoRI-digested inserts from pDD551 (10-His C-terminal tagged Sla2 with URA3 marker in pUC118) and pDD552 (6-myc C-terminal tagged Sla2 with URA3 marker in pGEM-9Z) were used to transform DDY1166, which contains the HIS3 gene in place of the deleted SLA2 gene. Colonies that were Ura+ and His- were selected, and the insertion of tagged SLA2 was confirmed by PCR using JCYNL243F (CTGGATCCTTGACAATGTTAC) and JCYNL243R (CTACTACTGTCTGAAGAGC) as primers. Both the 10-His and 6-myc constructs (in DDY1550 and DDY1551, respectively) complemented various sla2 null phenotypes fully (our unpublished results). DDY1551 was crossed with DDY131 and sporulated, and haploid, Ura+, and Matalpha progeny were identified (DDY1554). DDY1550 and DDY1554 were crossed to create diploid yeast (DDY1556) containing one copy of SLA2 tagged with 6-His and one copy tagged with 6-myc. DDY1551 and DDY1554 were crossed to create diploid yeast (DDY1557) with both copies of SLA2 tagged with 6-myc.

Fractionation of Yeast Cell Extracts

Cell extracts for sucrose gradient fractionation were prepared using a liquid nitrogen grinding method. Exponentially growing cells were harvested by centrifugation and washed once with cold double-distilled H2O and once with buffer C (50 mM HEPES, pH 7.4, 50 mM KCl, 2 mM MgCl2, 1 mM EDTA, and 1 mM DTT). Cells were then resuspended into an equal-weight volume of buffer C with the addition of protease inhibitors (antipain, leupeptin, pepstatin A, chymostatin, and aprotinin at 1 µg/ml and 10 µM PMSF and 1 mM benzamidine). The cell suspension was then drop frozen in liquid nitrogen. Depending on the amount of material, cells were lysed either manually using a mortar and pestle, or in a 1-l Waring blender. Liquid nitrogen was used liberally to ensure that cells remained frozen at all times. The cell lysate was then thawed at room temperature to obtain crude extract. All subsequent steps were performed at 4°C. At this point, if detergent-solubilized extract was desired, Nonidet P-40 was added to 0.2%. The lysate was then spun at 1000 × g to clear unlysed cells and cell debris. The extract was then spun at 100,000 × g to obtain the high-speed supernatant fraction for loading onto the sucrose gradient. The pellet and supernatant fractions were assayed by immunoblotting to determine the amount of Sla2p present; usually, Sla2p was present at approximately equal levels in both fractions.

For isolation of 6-histidine-tagged Sla2p, the above procedure was modified as follows: no EDTA was present in the extraction buffer, and 15 mM beta -mercaptoethanol was used instead of DTT. Also, a medium-speed centrifugation was introduced (15,000 × g for 10 min), after which the pellet was resuspended in modified buffer C plus 100 mM NaCl and 0.5% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid. The resulting solutions were spun at 250,000 × g for 30 min. The supernatants were preincubated with Sepharose CL-6B beads (Amersham-Pharmacia Biotech) to remove proteins that bind to this matrix nonspecifically, and then applied to an Ni-NTA column (Qiagen, Chatsworth, CA). The columns were washed, and the bound protein was eluted according to the manufacturer's instructions. The high-speed supernatant derived from the medium-speed pellet (i.e., the material that was extractable only in the presence of high salt and detergent) was termed the membrane extract.

Sucrose Gradients

Linear sucrose gradients (11 ml of 3-30%) in buffer C were prepared in Ultra-Clear centrifuge tubes (Beckman, Palo Alto, CA). Samples (400 µl) of yeast extract or protein molecular mass standards were layered on top. The gradients were spun at 34,000 rpm in an SW41 rotor for 15 h at 4°C. Fractions (400 µl) were removed manually and then assayed on SDS-PAGE. Immunoblotting was used to determine the position of various proteins. Native high-molecular-mass proteins (thyroglobulin, 669 kDa; ferritin, 440 kDa; catalase, 232 kDa; aldolase, 158 kDa; and BSA, 66 kDa) (Pharmacia, Piscataway, NJ) were used to calibrate the gradients. For immunoblots, anti-Srv2p antibody (Freeman et al., 1996) was used at a dilution of 1:5000, anti-Sac6p antibody (Drubin et al., 1988) at 1:500, and anti-Abp1p antibody at 1:5000 (Drubin et al., 1988). HRP-conjugated secondary antibody was used at 1:5000, and detected using the ECL chemiluminescence kit (Amersham, Arlington Heights, IL).

Sla2p Deletions and Truncation

Sla2p C-terminal truncation mutants were generated using a PCR gene deletion strategy (Lorenz et al., 1995). Oligonucleotides containing 54 or 55 nucleotides (nt) homologous to portions of SLA2 and 20 or 21 nt homologous to pRS vector sequences flanking URA3 were used as primers in PCR reactions amplifying the URA3 gene. All PCR reactions used primer SY16 (5'-AAATATATTTATATTAACGTTTATCTTTAT-ATATAAAAAGTACAATTCATGATCACTGTGCGGTATTTCACA-CCGC-3'), which contains 55 nt homologous to the 3' region of SLA2 immediately following its stop codon as well as 21 nt homologous to a region 3' of the URA3 gene. The other primer used in the PCR reaction contains 54 nt homologous to various regions of the SLA2 (depending on the desired truncation), a stop codon, and 20 nt homologous to a region 5' of the URA3 gene (~100 nt before the URA3 start codon). Primer SY18 (5'-GTTGCCACTGCTGACAAAATTGTCAAATCCTCAGAACACTTACGT -GTTGACGTTTGAGATTGTACTGAGAGTGCACC-3') contains homology until amino acid 768, primer SY20 (5'-CTATACTCCCAG-TTGCGTCAAGAGCATCTAAATCTTTTACCTCGTTTTAAAAAAT -GAGATTGTACTGAGAGTGCACC-3') contains homology until amino acid 501, and primer SY21 (5'-GGTGCAGCTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAGCCGGACTTCTGAGATTGTAC TG-AGAGTGCACC-3') contains homology until amino acid 359.

The resulting PCR products consist of the URA3 gene flanked by ~50 nt of SLA2 sequence. They were purified using the Qiaquick PCR purification kit (Qiagen) and then used to transform wild-type diploid yeast (DDY426). If integrated at the SLA2 locus, the PCR construct should delete a specific amount SLA2 (depending on the construct) and insert the URA3 gene. PCR was performed on genomic DNA from Ura+ transformants to determine whether the PCR product integrated at the SLA2 locus. The presence of a truncated gene product of the predicted length was further confirmed by immunoblotting using an Sla2p antibody. The heterozygous diploids were then sporulated to generate haploids expressing a truncated Sla2p. Homozygous diploids were obtained by mating the appropriate haploids.

Two NsiI sites are naturally present in SLA2, one before codon 33 and one after codon 896. Additional NsiI sites were inserted before codon 751, codon 502, or codon 360 through PCR using primers SY5 (5'-GCATGCATAGTTGCCACTGCTGAC-3') and SY7 (5'-GTTGCTGCTGTTGCGAAG-3'), SY6 (5'-GCATGCATACTGCAGTTAAAGGT-C-3') and SY7, or SY26 (5'-GCATGCATATGGGCCAATCAACAAG-CC-3') and SY7 respectively. Primers SY26 and SY34 (5'-CGATGCA-TACTAGGCATCCAGAATAGGGTTC-3') were used to insert an NsiI site before codon 360 and to insert an NsiI site and a stop codon after codon 576. The PCR-generated NsiI fragments were then used to replace the normal NsiI fragment of pDD353 or pDD354 (SLA2 in pRS313; Sikorski and Hieter, 1989) or YEP430 (Ma et al., 1987). All PCR-generated DNA that was not later replaced with plasmid DNA was sequenced, and no PCR-induced base pair changes were found. Thus, eight plasmids were obtained (Table 2): pDD362 (sla2Delta 33-750 in pRS313), pDD363 (sla2Delta 33-750 in YEP430), pDD364 (sla2Delta 33-501 in pRS313), pDD365 (sla2Delta 33-501 in YEP430), pDD367 (sla2Delta 33-359 in pRS313), pDD368 (sla2Delta 33-359 in YEP430), pDD369 (sla2Delta 33-359,576stop in pRS313), and pDD370 (sla2Delta 33-359,576stop in YEP430). To construct a GAL1 promoter-driven sla2Delta 33-750 (pDD366), the NsiI fragment of pDD362 was used to replace the NsiI fragment of pDD355, a plasmid containing GAL1-SLA2. In the above cloning procedures, when necessary, pBluescript, which contains no NsiI sites, was used as the shuttle vector. Primer SY23 (5'-GCACAAATGCAGCCGGACTTCGATGCCATATTGGAAAGCGGTATC-3') was used with the Clontech Transformer Mutagenesis kit (Clontech, Palo Alto, CA) to delete Sla2p codons 360-576, generating pDD371 (sla2Delta 360-575 in pRS313) and pDD372 (sla2Delta 360-575 in YEP430).

Two-Hybrid Interactions

Residues 503-968 of Sla2p were fused to the Gal4p DNA-binding domain by cloning the BamHI fragment of pDD356 into pAS1-CYH2 (Durfee et al., 1993) (to generate pDD373). Residues 768-968 of Sla2p were fused to the Gal4p DNA-binding domain by cloning the HincII-RsaI SLA2 fragment into pAS1-CYH2 (to generate pDD374). SY11 (5'-CGGGATCCTGCAGTTAAAGGTG-3') and SY12 (5'-GCGGATCCTCAGTCAACACGTAAGTG-3') were used as primers in a PCR reaction to create BamHI sites flanking Sla2p residues 502-767, and the resulting fragment was cloned into pACTII (Durfee et al., 1993) (which contains the Gal4p activation domain) to generate pDD375. SY13 (5'-CGCCATGGATGCCATATTGGAAAGCGG-3') and SY12 were used as primers in a PCR reaction to create NcoI and BamHI sites flanking Sla2p residues 575-767. The resulting fragment was cloned into pACTII to generate pDD376. SY14 (5'-CGCCATGGTTGCCACTGCTGAC-3') and SY15 (5'-GCGGATCCTTATTCGGATGTGAAGTCCAA-3') were used as primers in a PCR reaction to create NcoI and BamHI sites flanking Sla2p residues 751-930. The resulting fragment was cloned into pAS1-CYH2 to generate pDD377. SY29 (5'-CGCCATGGATTCAGATCTGCAGAAAGCG-3') and SY31 (5'-GCGGATCCTCAGGCATCCAGAATAGGG-3') were used as primers in a PCR reaction to create NcoI and BamHI sites flanking Sla2p residues 5-576. The resulting fragment was subcloned into pACTII to generate pDD379 or into pAS1-CYH2 to generate pDD378. All PCR products were sequenced to confirm the absence of any Taq polymerase-generated errors or were replaced with plasmid DNA. The plasmids were transformed into yeast strain Y190 (Durfee et al., 1993). Immunoblotting of whole-cell extract from these strains, using either anti-Sla2p antibody or anti-hemagglutinin antibody (both pACTII and pAS1-CYH2 contain a hemagglutinin tag), confirmed the expression of a fusion protein of the expected size. To determine whether the different proteins can interact with each other, pairwise combinations of the plasmids were transformed into Y190. This strain contains the Escherichia coli lacZ gene and the HIS3 gene under control of the GAL1 promotor. If the proteins bind to each other, the cells can grow in media (His-/3-AT) lacking histidine and containing 25 mM 3-aminotriazole, and beta -galactosidase is expressed. The plasmids pAS1-CYH2, pACTII, pSE1111, and pSE1112, and the yeast strain Y190 were kindly provided by Steve Elledge (Baylor College of Medicine, Houston, TX). The actin 2-hybrid plasmids were kindly provided by David Amberg (State University of New York, Health Science Center, Syracuse, NY).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERNCES

Immunolocalization of Sla2p

The genetic interactions and morphological defects of the sla2 mutants show that Sla2p is necessary for the correct functioning of the cortical actin cytoskeleton. To determine the cellular localization of Sla2p, we raised polyclonal antisera against its N terminus (aa 90-547) and its C terminus (aa 664-968). Both antisera recognize a 116-kDa protein that is absent in sla2Delta extracts (Figure 2A), and both produce similar immunofluorescence staining patterns (below).


View larger version (50K):
[in this window]
[in a new window]
 
Figure 2.   Subcellular localization of Sla2p. (A) Affinity-purified anti-Sla2p antibodies recognize a 116-kDa protein species in wild-type yeast whole-cell extracts. Lanes 1 and 2, immunoblot using the affinity-purified antibody against the C terminus of Sla2p. Lanes 3 and 4, immunoblot using affinity-purified antibody against the N terminus of Sla2p. Lanes 1 and 3 contain whole-cell extract from wild-type cells. Lanes 2 and 4 contain whole-cell extract from sla2Delta cells. (B) Indirect immunolocalization shows that Sla2p localizes to cortical structures the yeast cell. This localization largely, but not completely, overlaps with that of cortical actin. Arrows indicate patches that contain actin but no detectable Sla2p. Arrowheads show patches that contain Sla2p but no detectable actin. Double-headed arrows indicate actin cables, which contain no Sla2p. Diploid wild-type (DDY288; a and b) and sla2Delta cells (DDY540; c and d) were processed for immunofluorescence using affinity-purified antibody against the C terminus of Sla2p and anti-yeast actin antibodies, as described in MATERIALS AND METHODS. (a and c) Fluorescein staining of actin structures. (b and d) CY3 staining of Sla2p structures.

In wild-type cells, Sla2p localizes to cortical patches at the growing surfaces of the cell (Figure 2). The Sla2p staining pattern, however, is distinct from that of actin. First, although staining is detectable in medium- and large-budded cells, the staining is strongest in unbudded and small budded cells. Second, Sla2p colocalizes with the actin cortical patches, but it appears that not every actin cortical patch contains Sla2p (Figure 2B). Finally, Sla2p appears to be present in some cortical patches independent of actin. This is most apparent in medium- and large-budded cells, in which only ~45% of Sla2p patches overlap with actin patches, compared with an 85% overlap in unbudded and small-budded cells. Similarly, only ~40% of actin patches in medium- and large-budded cells also contain Sla2p, compared with 85% in unbudded and small-budded cells. Thus, a subset of the actin patches contains Sla2p, and a subset of the Sla2p patches contains actin. The latter observation is consistent with the ability of Sla2p to achieve a partial polarized cortical localization in cells lacking filamentous actin (Ayscough et al., 1997).

Furthermore, we also observed that known actin cortical patch components (i.e., Abp1p, Sac6p, and cofilin) colocalize 100% with cortical actin, and their localization is unchanged in sla2Delta mutants (our unpublished results).

Effects of Sla2p Deletion and Truncation Mutations on Cell Growth Properties

Sla2p shares with its homologues in other organisms an extensive, internal, predicted coiled-coil region. In addition, its C terminus is similar to that of talin and contains an actin-binding site (McCann and Craig, 1997). Previously, Wesp et al. (1997) determined that only the N terminus of Sla2p is absolutely essential for growth at high temperatures, for endocytosis, and for correct actin cytoskeleton organization. In strains carrying mutations in ABP1 or SRV2, the large central coiled-coil domain of Sla2p becomes essential for the above-listed functions as well.

The in vivo roles of the various Sla2p domains, however, have yet to be fully explored. To further identify and clarify the roles of Sla2p domains, we have produced eight new truncation and deletion mutants of SLA2 (summarized in Figure 3) and have tested these for their ability to complement the various phenotypes caused by a complete deletion of SLA2. Our analysis supports conclusions reached by Wesp et al. (1997) but also provides novel insights, which lead us to propose a revised model for Sla2p function.


View larger version (67K):
[in this window]
[in a new window]
 
Figure 3.   Expression and temperature growth profile of Sla2p deletion proteins. (A) C-terminal deletions. Crude extracts were prepared from wild-type (full-length Sla2p; DDY426) and mutant cells containing the Sla2p C-terminal deletions Sla2Delta 768-968 (DDY1194), Sla2Delta 501-968 (DDY1195), and Sla2Delta 360-968 (DDY1196), grown at 25°C, and then shifted to 37°C for 3 h. Equal cell equivalents (based on A600 absorbance) were immunoblotted using the N-terminal Sla2p antibody. Cells expressing wild-type or Sla2p C-terminal deletion mutants were then replica plated and grown for 36 h (37 and 34°C), 48 h (30 and 25°C), 72 h (20°C), or 5 d (14°C) on YPD plates before being photographed. (B) N-terminal and central coiled-coil domain deletions. Crude extracts were prepared from wild-type (DDY426) cells containing pRS313 (empty vector) and sla2Delta (DDY540) cells containing pDD367 (Sla2Delta 33-359), pDD364 (Sla2Delta 33-501), pDD362 (Sla2Delta 33-750), pDD371(Sla2Delta 360-575), pDD369(Sla2Delta 33-359, 576stop), or vector alone, grown at 25°C, and then shifted to 37°C for 3 h. Equal cell equivalents from the 25°C cultures or the 37°C-shifted cultures were immunoblotted using the C-terminal Sla2p antibody, except for extracts containing pDD369, in which case the N-terminal Sla2p antibody was used. Wild-type and sla2Delta cells containing vector alone or expressing these Sla2p deletion mutants were then replica plated and grown for 2 d (37 and 34°C), 3 d (30 and 25°C), 5 d (20°C), or 8 d (14°C) on SC-his plates before being photographed as shown. The first spot of each panel represents growth with a low-copy-number plasmid, and the second spot represents growth with a high-copy-number plasmid. (C) Sla2Delta 33-750 overexpression is recessive-lethal. Wild-type and sla2Delta cells expressing either Sla2Delta 33-750 under the control of the galactose-inducible GAL1 promotor or containing vector alone (pYES-R) were grown on glucose- or galactose-containing media at 25 or 37°C for 72 h before being photographed. (1) Wild-type cells expressing vector only (pYES-R). (2) Wild-type cells containing galactose-inducible Sla2Delta 33-750. (3) sla2Delta cells containing vector only. (4) sla2Delta cells expressing galactose-inducible Sla2Delta 33-750.

First, the importance of Sla2p's C terminus was explored by creating three Sla2p C-terminal truncation mutants (Figure 3A), each of which was integrated into the genome. Sla2pDelta 768-968 expresses residues 1-767 and lacks the entire talin homology region. This mutant is almost identical to the sla2Delta talin mutant described by Wesp et al. (1997), which expresses residues 1-766. Sla2pDelta 501-968 expresses residues 1-500, a region that includes two-thirds of the predicted large coiled-coil region and terminates at the end of a predicted leucine zipper motif. Sla2pDelta 360-968 expresses residues 1-359 and lacks this predicted coiled-coil region altogether. Immunoblots performed on yeast extracts generated from strains expressing the different C-terminal truncation mutants showed that each expressed a protein of approximately the predicted size (Figure 3A).

Although sla2Delta mutant cells are unable to grow at 34°C or above (Figure 3B, vector alone) all of the C-terminal truncation mutants were able to grow at 34°C. In addition, only cells carrying the largest truncation, sla2Delta 360-968, failed to grow at 37°C (Figure 3A). These results suggest that the N-terminal third of Sla2p is sufficient to fulfill a critical role of Sla2p and perhaps represents the essential functional region of Sla2p, consistent with the observations of Wesp et al. (1997).

To delineate further the functionality of the N-terminal region of Sla2p, three Sla2p N-terminal deletion mutations were generated (Figure 3B). Sla2pDelta 33-750 comprises almost solely the talin-like domain. Sla2pDelta 33-501 contains the talin-like domain and the 250 amino acids preceding it. Sla2pDelta 33-359 contains both the extensive internal coiled-coil region and the talin-like domain but lacks the N-terminal third of the protein. These Sla2p deletion mutants were introduced into sla2Delta mutant cells on either low- or high-copy plasmids and were tested for expression (Figure 3B).

One of the three Sla2p N-terminal deletion mutants, Sla2pDelta 33-359, rescued the temperature sensitivity of the sla2Delta cells (Figure 3B). Thus, the N terminus is not absolutely required for Sla2p functionality. A less severe deletion (of residues 114-284) did not support growth in the hands of Wesp et al. (1997). The reason for this discrepancy is unknown (possibilities discussed below). Overexpression of Sla2pDelta 33-750, the talin-like domain, not only failed to support growth at the higher temperatures, but it seemed to have a deleterious effect on growth, in contrast to the overexpression of full-length Sla2p, which has no effect on cell growth (our unpublished results). To characterize this deleterious effect further, the Sla2pDelta 33-750 deletion protein was expressed from the powerful GAL1 promoter (pDD366). Overexpression of the talin-like domain in sla2Delta cells was lethal, even at 25°C (Figure 3C). Wild-type cells transformed with pDD366 or plasmid vector alone, however, showed no obvious difference in their ability to grow on galactose, showing that this effect is recessive. Additional effects of overexpression of the talin-like domain are discussed below.

In the experiments described above, only a portion of the large predicted coiled-coil domain (residues 360-500), as well as the first 32 Sla2p residues, were found to be indispensable for growth at high temperatures. To test the importance of the central coiled-coil domain in Sla2p function directly, two additional deletion mutants were generated. Sla2pDelta 360-575 lacks the entire predicted coiled-coil domain, whereas Sla2pDelta 33-359,576stop comprises almost solely the predicted coiled-coil domain. These mutants were again expressed in sla2Delta cells on either low- or high-copy plasmids and were tested for expression (Figure 3B). We found that sla2Delta cells expressing the various constructs had growth characteristics similar to those of cells carrying vector alone (Figure 3B). Intriguingly, the corresponding coiled-coil deletion of Wesp et al. (1997), which removes residues 376-573, was able to complement most of the sla2 mutant phenotype. This result is further discussed below.

Effects of Sla2 Deletion Mutations on Cell Morphology and Actin Organization

The relative ability of different Sla2p mutants to rescue the temperature-sensitive growth of sla2Delta mutant cells is a sensitive measure of function. However, the evaluation of growth properties alone does not provide insight into the nature of the underlying defects in cells expressing the Sla2p mutants. Therefore, we next examined the effects of sla2 mutations on actin cytoskeleton organization. The data presented below indicate that Sla2p is capable of mediating the polarization of actin patches in the absence of either the C-terminal 468 residues or the N-terminal 360 residues (or, more specifically, residues 33-359). Effects on the actin cytoskeleton thus parallel effects on growth at high temperatures, suggesting that the ability to develop polarized actin cytoskeleton organization is required for growth at high temperatures.

The actin cytoskeletons of cells expressing the different Sla2p deletion mutants were visualized after growth at 25 and 37°C. The phenotypes were generally more severe at 37°C (our unpublished results). Cells grown at 25°C are shown in Figure 4, and results are summarized in Figure 5. sla2Delta mutant cells expressing Sla2pDelta 360-968 (Figure 4D), Sla2pDelta 360-575 (Figure 4H), Sla2pDelta 33-501 (Figure 4F), or Sla2pDelta 33-359,576stop (Figure 4I) all exhibited morphological and actin phenotypes similar to those observed for the null mutant. These cells were round, they exhibited an increased number of cortical actin patches, and their patches were not restricted to the bud.


View larger version (75K):
[in this window]
[in a new window]
 
Figure 4.   Actin cytoskeleton organization in sla2Delta cells and cellular localization of the Sla2 deletion mutant proteins. The yeast strains are those described in Figure 3, A and B, with all plasmids being low copy number (CEN), except for pDD368, which is a high-copy-number (2 µ) plasmid expressing Sla2Delta 33-359. Cells were grown at 25°C and were then fixed and stained with either anti-actin antibodies, or anti-Sla2p antibodies, as indicated. Cells expressing Sla2pDelta 360-968, Sla2pDelta 501-968, and Sla2pDelta 33-359,576stop were stained with the N-terminal Sla2p antibody. The remaining cells were stained with the C-terminal Sla2p antibody.


View larger version (32K):
[in this window]
[in a new window]
 
Figure 5.   Sla2p domain analysis summary. The phenotypes of the Sla2p C-terminal truncation and N-terminal deletion mutants are summarized. The schematics indicate the regions of Sla2p expressed in each case and reflect the domain arrangement shown in Figure 1A. The phenotypic analysis was performed in sla2Delta cells expressing the different Sla2p mutants, from either a genomic copy (the three C-terminal mutants were integrated into the genome) or from a high- or low-copy-number plasmid (the five N-terminal deletion mutants).

sla2Delta mutant cells expressing Sla2pDelta 501-968 (Figure 4C) or Sla2pDelta 33-359 (Figure 4E) were also round, but they exhibited largely polarized cortical actin patches. These patches did look "chunkier" (i.e., larger and less discrete) than those in wild-type cells. When these mutant cells were grown at 37°C, they still retained a polarized actin cytoskeleton, but the actin patches became even chunkier (our unpublished results).

sla2Delta cells expressing Sla2pDelta 768-968, lacking the talin-like domain, do not exhibit any obvious defects in actin organization at 25°C (Figure 4B). These cells retain a polarized actin cytoskeleton at 37°C but exhibit fainter cables and chunkier cortical patches (our unpublished results). On the other hand, expression of the talin domain alone (Sla2pDelta 33-750) not only failed to restore wild-type morphology to sla2Delta cells but resulted in a more abnormal actin cytoskeleton (Figure 4G). These cells seem to contain more cortical actin, and some cells also contain actin "cables," which appear much thicker than those seen in wild-type cells. The exaggerated actin cables could be stained by rhodamine-phalloidin (our unpublished results), indicating that they contain filamentous actin. Thus, they are different from the actin bars that are found in some actin cytoskeleton mutants and that are thought to consist of aggregates of monomeric or denatured actin. Effects of expression of the talin-like domain alone on actin organization were seen in wild-type background and therefore are dominant.

sla2Delta cells exhibit an abnormal budding pattern (Yang et al., 1997). Of the eight mutants, only Sla2pDelta 768-968 restored the wild-type bipolar budding pattern in MATa/MATalpha cells. Again, no dominant effects were observed.

Endocytosis in sla2 Mutants

We tested the ability of the sla2 truncation and deletion mutants to undergo fluid phase endocytosis as assayed by the ability to take up LY an concentrate it the vacuole. The ability of the sla2 mutants to endocytose closely followed their ability to grow at high temperatures. Cells expressing Sla2pDelta 768-968, Sla2pDelta 501-968, or Sla2pDelta 33-359 were able to endocytose LY at both 25 and 37°C, whereas cells expressing the five remaining mutants were unable to do so even at 25°C. Additionally, overexpression of the five plasmid-based sla2 mutants in wild-type cells did not affect their ability to endocytose LY; therefore, the mutants did not confer any dominant effects.

Cellular Localization of the Sla2p Deletion Proteins

The generation of polyclonal antibodies capable of detecting Sla2p localization by indirect immunofluorescence allowed us to determine the effect of the eight sla2 mutations on the cellular localization of Sla2p. Double labeling with Sla2p and actin antibodies was performed for each mutant and is shown in Figure 4.

Sla2pDelta 768-968 (Figure 4B) exhibited a localization indistinguishable from that of full-length Sla2p. sla2Delta mutants expressing either Sla2pDelta 501-968 (Figure 4C) or Sla2pDelta 33-359 (Figure 4E) contain chunkier actin cortical patches near or in the bud, and the mutant Sla2p colocalizes with these patches. Although there seems to be more Sla2pDelta 360-968 in the cytoplasm, this protein is still present in cortical patches but at apparently reduced levels (Figure 4D). Sla2pDelta 360-575 (Figure 4H) still localizes to cortical patches, but these patches were evenly spread over both mother and bud, and, intriguingly, many seem not to contain actin. Sla2pDelta 33-750 (Figure 4G) colocalizes with actin cortical patches and the aberrant thick actin cables. The remaining two deletion proteins, Sla2pDelta 33-501 (Figure 4F) and Sla2pDelta 33-359,576stop (Figure 4I) both exhibited cytoplasmic localization and not cortical patch localization.

Full-length Sla2p displays partially polarized cortical localization in cells treated with the actin depolymerizing drug latruculin A (latA) (Ayscough et al., 1997). We assayed the localization pattern of the three Sla2p C-terminal truncation mutants (Sla2pDelta 768-968, Sla2pDelta 501-968, and Sla2pDelta 360-968) when cells were grown in the presence of latA. All three mutants displayed some partially polarized cortical localization (our unpublished results).

Thus, both the N-terminal 360 residues and the C-terminal talin-like domain of Sla2p are capable of localizing to cortical actin patches independent of the rest of the protein. In addition, the N-terminal third of Sla2p seems to achieve its localization independently of filamentous actin, whereas evidence discussed below points to actin as the localization signal for the C-terminal talin-like domain.

Synthetic Lethality with abp1Delta and sac6Delta

sla2Delta is synthetic lethal with abp1Delta and sac6Delta mutants (Holtzman et al., 1993). We tested the sla2 deletion and truncation mutants for synthetic lethality with either abp1Delta or sac6Delta mutations. Seven of the eight deletion mutants were synthetic lethal with both abp1Delta and sac6Delta , the exception being sla2Delta 768-968, which was not synthetic lethal with either abp1Delta or sac6Delta . The sla2Delta 768-968 abp1Delta double mutant exhibited no growth defects. However, the sla2Delta 768-968 sac6Delta double mutant exhibited a narrower temperature range permissive for growth than that of the sac6Delta single mutant. Although the sac6Delta mutant can grow at 34°C, the sla2Delta 768-968 sac6Delta double mutant was unable to grow at 34°C and grew only poorly at 30°C. This synergistic genetic interaction is striking, because the sla2Delta 768-968 single mutant is very healthy and exhibits few discernible growth defects. Thus, the functionality provided by both the C-terminal and the N-terminal regions of Sla2p becomes important for viability in the absence of either Abp1p or Sac6p, with the talin-like domain being only partially dispensable.

Interaction of Sla2p Domains

The Sla2p talin-like domain (expressed and purified from E. coli) binds to actin in vitro (McCann and Craig, 1997) and is similar to a domain of talin that binds to actin (Hemmings et al., 1996). Therefore, it is not surprising that Sla2pDelta 33-750, which encompasses the talin-like domain, localizes to actin structures in vivo. What is harder to explain is the cytoplasmic localization of Sla2pDelta 33-501, which contains the entire talin-like domain plus the 250 amino acids N-terminal to this domain. The presence of the additional 250 amino acids somehow precludes binding of the talin-like domain to the actin cytoskeleton. This observation could be explained if the 250-amino acid region directly binds to the talin homology region, thereby occluding its actin localization signal. An alternative possibility is that the mutant protein aberrantly binds to another protein, which then obstructs the actin-binding signal in the talin homology region. Because we had observed that Sla2p residues 503-968 expressed and purified from E. coli do not bind to actin in vitro (our unpublished results), the self-interaction hypothesis was tested.

The two-hybrid system was used to test whether different domains of Sla2p could interact with each other. The following Gal4p DNA-binding domain fusions were made: Sla2p residues 503-968 (pDD373), 768-968 (pDD374), 751-930 (pDD377), and 5-576 (pDD378). The following Gal4p activation domain fusions were also created: Sla2p residues 502-767 (pDD375), 575-767 (pDD376), 5-358 (pDD381), and 5-576 (pDD379). Interactions with actin were also tested using actin fusion proteins. A pair of protein chimeras known to interact with each other, SNF1 (pSE1112) and SNF4 (pSE1111), were used as a positive control (Celenza et al., 1989). All the pair-wise plasmid combinations were tested to determine whether they could activate HIS3 expression (Figure 6) and also activate lacZ expression (our unpublished results).


View larger version (63K):
[in this window]
[in a new window]
 
Figure 6.   Sla2p two-hybrid interactions. Yeast strain Y190 containing the indicated plasmids was replica plated either onto medium containing histidine (His+ plates), or onto medium lacking histidine and containing 3-aminotriazole (His-/3AT plates). If the DNA-binding domain fusion protein and DNA activation domain fusion protein interact with each other, the cells are able to grow on media lacking histidine. The Snf1p-Snf4p pair serves as a positive control. Plates were scored for growth after 2-3 d of growth at 25°C. Positive interactions were also verified by detection of lacZ expression (our unpublished results).

Of the internal Sla2 interactions tested, only Sla2768-968 in combination with Sla2502-767 or Sla2575-767, as well as Sla25-578 in combination with Sla25-578, were positive (Figure 6, A and B). Note that amino acids 768-968, but not amino acids 503-968, interacted with amino acids 502-767. This suggests that the binding site for the Sla2502-767 fusion present in Sla2768-968 is occluded in Sla2503-968. Sla2503-968 is similar to the deletion mutant Sla2pDelta 33-501, which exhibits cytoplasmic localization in vivo despite containing an actin-binding site. These observations are consistent with the hypothesis that the site in Sla2p that mediates localization to actin is masked in Sla2pDelta 33-501 by an intra- or intermolecular interaction.

Furthermore, although Sla2751-930 in combination with Sla2575-767 did not activate HIS3 expression, Sla2768-968 in combination with Sla2575-767 was able to do so (Figure 6). Therefore, the predicted coiled-coil forming residues 930-968 are essential for the association of the talin-like domain with residues 575-767, which themselves contain a second region of predicted coiled-coil that is evolutionarily conserved (Figure 1).

We also tested the ability of the various Sla2p domains to interact with actin in the two-hybrid assay and found that only the talin-like domain (Sla2768-968) was capable of doing so. In addition, residues 930-968 (a predicted coiled-coil region) were essential for this interaction. This result agrees with the in vitro results of McCann and Craig (1997), who found that residue 957 is essential for actin binding. Thus, the same predicted Sla2p coiled-coil region that is necessary for actin binding is also necessary for self-association. No other region of Sla2p, including the construct containing residues 503-968, was capable of interacting with actin in our assay.

Finally, we observed that Sla2p fragment 1-575 could interact with itself, and that residues 360-575, the central predicted coiled-coil region, are essential for this interaction. A clone containing this coiled-coil domain alone was also retrieved from a two-hybrid library when residues 5-576 of Sla2p were used as bait (our unpublished results).

Evidence That Sla2p Is a Dimer In Vivo

Wesp et al. (1997) demonstrated that the central coiled-coiled domain of Sla2p mediated the formation of a complex that sediments at ~220 kDa. This complex might have resulted from dimerization of Sla2p or from the binding of another protein(s) to Sla2p. Our two-hybrid analysis showed that this coiled-coil domain is capable of interacting with itself, suggesting that the 220-kDa complex might be an Sla2p dimer. To test this result biochemically, Sla2p was tagged with either multiple histidines or multiple myc epitopes (see Figure 7A). Extracts were prepared from diploid yeast expressing either one copy of 10-His-Sla2p and one copy of 6-myc-Sla2 (DDY1156) or two copies of 6-myc-Sla2 (DDY1157). From these strains, the His-tagged Sla2p was isolated on a Ni-agarose column (see Figure 7B). Membrane-extracted 10-His-Sla2p was found to be associated with 6-myc-Sla2p, indicating that the two tagged versions of Sla2p form a complex with each other in vivo. A similar result was obtained with Sla2p extracted from the cytoplasm. This result, together with the evidence described above, strongly suggests that Sla2p dimerizes in a manner mediated by its central coiled-coil domain.

Fractionation of Sla2p and Sla2p N-terminal Deletion Mutants

We determined the fractionation profile of some of the actin-binding proteins encoded by genes that when mutated exhibit synthetic lethality with sla2 mutants (see Figure 8). We performed this analysis to test the possibility that these proteins exist in complexes with Sla2p. Abp1p eluted in fractions ranging from ~4.5 S (65 kDa) to 11.3 S, with more protein present in the earlier fractions. Srv2p eluted in fractions ranging from 11.3 to 19.5 S (670 kDa), with more protein present in the later fractions. Sac6p eluted as two distinct peaks, one at 4.5 S and the other at 19.5 S. Because Sla2pDelta 33-750 (a protein that associates with actin patches and cables) and Sla2pDelta 33-501 (a protein with cytoplasmic localization) showed vastly different cellular localizations when localized by immunofluorescence (Figure 4), the distribution of these mutant proteins was also analyzed by velocity sedimentation (see Figure 8) and gel filtration (our unpublished results).

The presence or absence of full-length Sla2p had no effect of the fractionation properties of either deletion mutant (our unpublished results). Sla2pDelta 33-501 sedimented at 4.5 S (66 kDa), in accordance with the size of the monomeric protein (see Figures 3 and 8). Intriguingly, although a portion of Sla2pDelta 33-750 sedimented below 4.5 S (as expected for its monomeric size), most of this protein was found at 19.5 S, suggesting that it is in a large, ~670-kDa complex. (see Figure 8). Thus, Sla2pDelta 33-750 is present in a significantly larger complex than the one containing full-length Sla2p (220 kDa). As described above, two other actin-binding proteins, Sac6p and Srv2p, also sediment at 19.5 S.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERNCES

Yeast cells lacking Sla2p have previously been demonstrated to contain a defective actin cytoskeleton, wherein the cortical actin patches are no longer concentrated at the surface of the bud (Holtzman et al., 1993). These cells also exhibit defects in actin-mediated functions, such as endocytosis (Raths et al., 1993), the bipolar budding pattern (Yang et al., 1997), and abnormal post-Golgi secretory vesicle accumulation (Mulholland et al., 1997).

In this study, we demonstrate that Sla2p is a component of the cortical actin cytoskeleton. Sla2p localizes to only a subset of the actin cortical patches, as well as to cortical patches apparently free of actin (Figure 2), despite containing an actin-binding site (McCann and Craig, 1997). This is in contrast to previously characterized actin-binding proteins, such as Abp1p or cofilin, which are present in all actin patches and absent from patches devoid of actin (Drubin et al., 1988; Moon et al., 1993). (These proteins also maintain their actin patch localization even in sla2Delta mutant cells [our unpublished results].) An additional difference is that these actin-binding proteins (Abp1p and cofilin) became localized to the cytoplasm when cells were treated with the actin-depolymerizing drug latA (Ayscough et al., 1997). In contrast, Sla2p still exhibited cortical localization, and this localization appeared appropriately polarized to one end of the cell in ~20% of the latA-treated cells (Ayscough et al., 1997). This and additional observations discussed below suggest that Sla2p interacts with cortical proteins in addition to actin.

The colocalization of Sla2p with actin is most evident early in the cell cycle, in unbudded and small-budded cells, suggesting that its interaction with actin might be especially important during these stages and that its localization and functionality is regulated during the cell cycle. This suggestion is reinforced by the observation that Sla2p is localized almost exclusively to the cytoplasm in stationary phase yeast cells (our unpublished results). A number of hypotheses to explain the observation that Sla2p patches do not always contain actin can be posited. First, Sla2p may play a regulatory role in actin cortical patch formation. For example, Sla2p might help nucleate actin polymerization or recruit and stabilize the correct components of cortical patches as they initially form; thus the patches containing Sla2p but no detectable actin may mark the future sites of actin patch formation. This hypothesis is supported by the observation that sla2Delta mutants are defective in nucleation of actin assembly in permeabilized cells (Li et al., 1995). Alternatively, Sla2p may remain behind after an actin patch has been disassembled. A third possibility is that the cortical patches that contain Sla2p alone (compared with those that contain both Sla2p and actin) constitute separate functional entities. Further studies using differentially colored green fluorescent protein-tagged fusions of Sla2p and actin in living cells might shed light on this issue.

To elucidate first the function of Sla2p in actin assembly and distribution and second to investigate the regulation of Sla2p distribution, we generated eight Sla2p truncation or deletion mutants (Figures 3 and 5). Previously, Wesp et al. (1997) had also generated and characterized some Sla2p deletion mutants. They reported that only the N-terminal domain (specifically residues 114-284) is required for growth at 37°C, for endocytosis, and for polarized actin. In addition, a portion of the predicted central coiled-coil domain of Sla2p becomes necessary for the above activities when Srv2p is absent from the cell or when the Src homology 3 domain of Abp1p is deleted. In contrast, the C-terminal talin-like domain of Sla2p was dispensable under all conditions tested. We have created a different set of deletion proteins (the only overlapping one is Sla2pDelta 768-968) and subjected them to a complementary set of analyses, including actin localization, Sla2p localization, and two-hybrid interactions. These experiments have produced novel insights regarding the regulation and important functional regions of the protein.

We found that Sla2p missing large portions of either its N- or C-terminal domain was still largely functional. Both Sla2pDelta 501-968 and overexpressed Sla2pDelta 33-359 could fully rescue the temperature sensitivity of sla2Delta cells and restore the polarized placement of the cortical actin patches and endocytosis (Figures 3 and 4). (Unlike full-length Sla2p, these mutants did not allow growth in the absence of Sac6p or Abp1p and did not restore the bipolar budding pattern.) These Sla2p mutants colocalized with the cortical actin patches (Figure 4). Thus, both the N- and C-terminal domains of Sla2p contain a cortical patch localization signal, and this localization is probably key to the functionality of these Sla2 deletion proteins. In addition, the N terminus of Sla2p seems to localize to the cell cortex independently of actin, because this domain still exhibits partially polarized cortical localization in cells lacking filamentous actin.

A closer examination of the indispensable functional regions of Sla2p demonstrates that there is a surprising amount of redundancy within Sla2p. As stated above, we observed that either the N or C terminus (but not both) of Sla2p can be removed without greatly perturbing its functional activity. These two deletion mutants have in common the central predicted coiled-coil region (as well as the first 32 residues). Although we found that a Sla2p deletion mutant entirely lacking this domain (Delta 360-575) exhibited no functional activity, Wesp et al., (1997) characterized a slightly less complete deletion of the predicted coiled-coil domain (Delta 376-573) and found that it was capable of complementing most of the sla2 null mutant's deficiencies. The different boundaries likely contributed to the different functionalities of the deletion proteins and could also explain the discrepancy between our observations and those of Wesp et al. (1997) concerning the importance of the N terminus of Sla2p.

Because very few residues of Sla2p were present in all of our active Sla2p deletion proteins, the results of the Sla2p domain analysis suggest that the protein comprises several functional modules. Removal of any one portion causes relatively little perturbation, but more extensive deletion leads to loss of function. The basic requirements for Sla2p function would appear to be 1) a cortical localization signal and 2) an additional domain, perhaps for contacting another constituent of the cortical patches.

In addition, every deletion mutation we made resulted in some loss of function. For example, we observed that removal of the C-terminal talin homology region of Sla2p had little effect on the actin cytoskeleton or cell growth under optimal conditions (Figures 3 and 4), consistent with the results reported by Wesp et al., (1997). At 37°C, however, we observed that the actin cytoskeleton had fainter cables and chunkier cortical patches if the talin-like domain was deleted (our unpublished results). In addition, this truncation mutation showed a synthetic negative synergism with a sac6Delta mutant (causing inviability at 34°C). Intriguingly, expression of the C-terminal talin homology region (Sla2pDelta 33-750) by itself resulted in a dominant phenotype. Cells appeared to exhibit more filamentous actin structures, larger and more abundant actin cortical patches, and thick actin cables (Figure 4). Thus, the Sla2p talin homology domain may promote actin polymerization or stabilize F-actin structures.

Consistent with the observations that the Sla2p talin-like domain pellets with F-actin (McCann and Craig, 1997), we found that this domain interacts with actin in the two-hybrid system (Figure 6). However, as assayed through the two-hybrid system, no other region of Sla2p exhibited an interaction with actin, supporting the view that Sla2p makes actin-dependent and independent interactions with the cell cortex. Furthermore, a construct containing an additional 265 amino acids N-terminal of the talin-like domain did not interact with actin, suggesting that the actin-binding site may be masked, somehow, in this construct.

High overexpression of the Sla2p talin-like domain results in death in sla2Delta cells. In contrast, overexpression of full-length Sla2p, or of a large C-terminal fragment of Sla2p (Sla2pDelta 33-501), has no detectable dominant effect on cell growth or on the actin cytoskeleton. The excess Sla2p appears to be mainly cytoplasmic and not present in cortical patches, as judged by indirect immunofluorescence (our unpublished results). These results suggest that sequences N-terminal to the talin homology domain may be able to mask the talin-like region of Sla2p, through either a direct inter- or intramolecular interaction (see Figure 9). There are precedents in which intramolecular interactions affect the accessibility of functional domains in other cytoskeletal proteins, including vinculin, a component of focal adhesions, and ezrin, a membrane-cytoskeletal linking protein. The N-terminal domains of ezrin and vinculin bind to their C-terminal domains, thereby masking an F-actin-binding sites (Gary and Bretscher, 1995; Johnson and Craig, 1994, 1995). Phosphatidyl inositol bisphosphate, which is also thought to regulate cytoskeletal proteins, such as profilin (Lassing and Lindberg, 1985), can disrupt vinculin self-association, thus exposing its talin- and actin-binding sites (Gilmore and Burridge, 1996).

In support for a model invoking regulation of Sla2p association with the cell cortex via intramolecular interaction, we found using the two-hybrid system that the C-terminal talin homology domain of Sla2p binds specifically to the 250-residue segment immediately upstream of it (Figure 6). This interaction is dependent on Sla2p residues 930-968 and on residues 567-767, both of which contain evolutionarily conserved domains that are predicted to form alpha-helical coiled coils. As mentioned above, residues 930-968 are also necessary for actin binding. Thus, Sla2p can self-associate, and this self-association is predicted to mask the actin-binding site (see Figure 9). How the Sla2p intramolecular (or intermolecular) interactions may be regulated has not yet been investigated. Sla2p is phosphorylated (our unpublished results), and this provides one potential means of regulation.

The large central coiled-coil region mediates Sla2p dimerization (Figure 7). Dimerization may be necessary for full functionality. In addition, the central coiled-coil domain might interact with other cytoskeletal proteins; this region has been shown to interact with Rvs167p using the two-hybrid system (Wesp et al., 1997). Specific interaction between the putative alpha-helical coiled-coil regions of one protein with another protein has been reported previously (Spencer et al., 1997). In addition, the Sla2p human homologue Hip1p binds to huntingtin, the protein whose mutation results in HD, and this interaction is mediated by the conserved central putative coiled-coil region of Hip1p (Kalchman et al., 1997).


View larger version (78K):
[in this window]
[in a new window]
 
Figure 7.   Sla2p intramolecular interaction in vivo. (A) Haploid yeast expressing Sla2p, tagged with multiple histidines, or multiple myc epitopes, were extracted as described in MATERIALS AND METHODS, and the supernatants from high-speed centrifugations were subjected to SDS-PAGE. The proteins were transferred to nitrocellulose and probed with either anti-Sla2p (C-terminal antibody) or anti-myc antibodies, as shown. The anti-myc antibody detects only the myc-tagged Sla2p and a background band at ~90 kDa. (B) Heterozygous diploid 6myc-SLA2/10His-SLA2 yeast (DDY1556) and homozygous diploid 6myc-SLA2/6myc-SLA2 yeast (DDY1557) were extracted as described in MATERIALS AND METHODS. Solubilized membrane extract was applied to a Ni-agarose column, which binds the histidine-tagged Sla2 (lane 6) but not the myc-tagged Sla2 (lane 5). The Western blot was probed with anti-Sla2 antibodies. When His-tagged Sla2 from the heterozygous yeast binds to the column (and is thus lost from the flow-through; lane 4), myc-tagged Sla2 is brought with it (lane 6), indicating that Sla2 is capable of complexing with itself in vivo.

Crude fractionation of yeast extract suggested that the majority of Sla2p is present in a large, membrane-associated complex (Figure 8). Fractionation of wild-type yeast extract on a sucrose gradient showed that full-length Sla2p sediments at 11.3 S, which corresponds to ~220 kDa (assuming a globularly shaped protein). The talin homology region, however, sedimented at 19.5 S (670 kDa). Two other cortical cytoskeletal proteins, Sac6p and Srv2p, also sediment at 19.5 S. Intriguingly, null alleles of all three genes, SLA2, SAC6, and SRV2, are synthetically lethal with each other. Thus, the 19.5 S complex might contain all three proteins, providing internal functional redundancy, and represent a subunit or a building block of a "cortical patch."


View larger version (25K):
[in this window]
[in a new window]
 
Figure 8.   Sedimentation behavior of Sla2p and other cytoskeletal proteins. Velocity sedimentation was performed on a wild-type yeast extract using a 3-30% sucrose gradient as described in MATERIALS AND METHODS section. Fractions were immunoblotted with the indicated antibodies. (For Sla2p, the C-terminal antibody was used.) Where indicated, extracts were derived from sla2Delta cells expressing either Sla2pDelta 33-750 or Sla2pDelta 33-501. The size standards shown are BSA (4.5 S), catalase (11.3 S), and thyroglobulin (19.5 S).

Sla2p presumably contacts other proteins to promulgate its effects (shown as X, Y, and Z in Figure 9). Because the N- and C-terminal regions are independently capable of localization to cortical patches, they both must interact with cortically located components. Furthermore, because the majority of Sla2p is localized to the cytoplasm in stationary (Go) cultures, or when Sla2p is overexpressed, negative regulation and/or the requirement for a positive signal must occur at both termini. From our results, we believe that the switch at the C-terminus involves inhibition of self-association mediated by the two small predicted coiled-coil domains of Sla2p. Whether this interaction also regulates the N-terminal binding is unknown; however, this is unlikely because in the absence of the C terminus, the protein still seems to be correctly localized and functional. It is possible that a number of signals and switches are involved. Additionally, the binding partners for Sla2p might themselves be targets of regulation, providing an indirect method of regulating Sla2p distribution.


View larger version (47K):
[in this window]
[in a new window]
 
Figure 9.   Model of Sla2p regulation and interactions. Sla2p exists in the cytoplasm and associated with cortical actin patches. Localization to the cortex is probably necessary for activity. Based on the N-terminal deletion and C-terminal truncation analysis of Sla2p, both termini of the protein contain a cortical actin patch localization signal. The unknown proteins that mediate Sla2p's cortical patch localization are denoted X and Y. The C terminus has been demonstrated to contain an actin-binding site, so Y might be actin. The large, central coiled-coil domain potentially interacts with other proteins (Z). Indeed, Rvs167p has been reported to bind this domain of Sla2p in two-hybrid studies (Wesp et al., 1997). Rvs167 binds to Abp1p, which itself binds to Srv2p and to actin. When expressed alone, however, the coiled-coil domain is cytoplasmic, and thus this link seems to be insufficient for Sla2p localization. Regulation of the distribution and function of Sla2p could potentially be accomplished through interaction with any of a number of proteins. We have shown, however, that the actin-binding site located in the C-terminal talin-like domain is likely to be inactivated through a self-association with the upstream small coiled-coil domain of the protein. This interaction may also be sufficient to block the N-terminal and coiled-coil domain binding sites for proteins X and Z, as shown ii, or additional switches and signals may be involved, as depicted in i.

    ACKNOWLEDGMENTS

This work was supported by a grant to D.G.D. from the National Institutes of Health (GM-50399) and by a Human Frontier Science Program fellowship to M.J.T.V.C.

    FOOTNOTES

* Present address: Baylor College of Medicine, Department of Microbiology and Immunology, Houston, TX 77030.

dagger Corresponding author. E-mail address: drubin{at}uclink4.berkeley.edu.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERNCES


Molecular Biology of the Cell
Vol. 10, 2265-2283, July 1999
Copyright © 1999 by The American Society for Cell Biology



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
A. Kaufmann and P. Philippsen
Of Bars and Rings: Hof1-Dependent Cytokinesis in Multiseptated Hyphae of Ashbya gossypii
Mol. Cell. Biol., February 1, 2009; 29(3): 771 - 783.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
Y. Higuchi, J.-y. Shoji, M. Arioka, and K. Kitamoto
Endocytosis Is Crucial for Cell Polarity and Apical Membrane Recycling in the Filamentous Fungus Aspergillus oryzae
Eukaryot. Cell, January 1, 2009; 8(1): 37 - 46.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. Wilbur, C.-Y. Chen, V. Manalo, P. K. Hwang, R. J. Fletterick, and F. M. Brodsky
Actin Binding by Hip1 (Huntingtin-interacting Protein 1) and Hip1R (Hip1-related Protein) Is Regulated by Clathrin Light Chain
J. Biol. Chem., November 21, 2008; 283(47): 32870 - 32879.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. N. Bagriantsev, E. O. Gracheva, J. E. Richmond, and S. W. Liebman
Variant-specific [PSI+] Infection Is Transmitted by Sup35 Polymers within [PSI+] Aggregates with Heterogeneous Protein Composition
Mol. Biol. Cell, June 1, 2008; 19(6): 2433 - 2443.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
C. Le Clainche and M.-F. Carlier
Regulation of Actin Assembly Associated With Protrusion and Adhesion in Cell Migration
Physiol Rev, April 1, 2008; 88(2): 489 - 513.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. L. Repass, R. J. Brady, and T. J. O'Halloran
Dictyostelium Hip1r contributes to spore shape and requires epsin for phosphorylation and localization
J. Cell Sci., November 15, 2007; 120(22): 3977 - 3988.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. Toshima, J. Y. Toshima, M. C. Duncan, M. J. T.V. Cope, Y. Sun, A. C. Martin, S. Anderson, J. R. Yates III, K. Mizuno, and D. G. Drubin
Negative Regulation of Yeast Eps15-like Arp2/3 Complex Activator, Pan1p, by the Hip1R-related Protein, Sla2p, during Endocytosis
Mol. Biol. Cell, February 1, 2007; 18(2): 658 - 668.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
T. M. Newpher, F.-Z. Idrissi, M. I. Geli, and S. K. Lemmon
Novel Function of Clathrin Light Chain in Promoting Endocytic Vesicle Formation
Mol. Biol. Cell, October 1, 2006; 17(10): 4343 - 4352.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
J. B. Moseley and B. L. Goode
The Yeast Actin Cytoskeleton: from Cellular Function to Biochemical Mechanism
Microbiol. Mol. Biol. Rev., September 1, 2006; 70(3): 605 - 645.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. Yoshiuchi, T. Yamamoto, H. Sakane, J. Kadota, J. Mochida, M. Asaka, and K. Tanaka
Identification of Novel Mutations in ACT1 and SLA2 That Suppress the Actin-Cable-Overproducing Phenotype Caused by Overexpression of a Dominant Active Form of Bni1p in Saccharomyces cerevisiae
Genetics, June 1, 2006; 173(2): 527 - 539.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. E. Ganusova, L. N. Ozolins, S. Bhagat, G. P. Newnam, R. D. Wegrzyn, M. Y. Sherman, and Y. O. Chernoff
Modulation of Prion Formation, Aggregation, and Toxicity by the Actin Cytoskeleton in Yeast
Mol. Cell. Biol., January 15, 2006; 26(2): 617 - 629.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. S. Chang, K. Henry, M. I. Geli, and S. K. Lemmon
Cortical Recruitment and Nuclear-Cytoplasmic Shuttling of Scd5p, a Protein Phosphatase-1-targeting Protein Involved in Actin Organization and Endocytosis
Mol. Biol. Cell, January 1, 2006; 17(1): 251 - 262.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
I. G. Mills, L. Gaughan, C. Robson, T. Ross, S. McCracken, J. Kelly, and D. E. Neal
Huntingtin interacting protein 1 modulates the transcriptional activity of nuclear hormone receptors
J. Cell Biol., July 18, 2005; 170(2): 191 - 200.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. Castagnetti, R. Behrens, and P. Nurse
End4/Sla2 is involved in establishment of a new growth zone in Schizosaccharomyces pombe
J. Cell Sci., May 1, 2005; 118(9): 1843 - 1850.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. J. Stefan, S. M. Padilla, A. Audhya, and S. D. Emr
The Phosphoinositide Phosphatase Sjl2 Is Recruited to Cortical Actin Patches in the Control of Vesicle Formation and Fission during Endocytosis
Mol. Cell. Biol., April 15, 2005; 25(8): 2910 - 2923.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. E. Irazoqui, A. S. Howell, C. L. Theesfeld, and D. J. Lew
Opposing Roles for Actin in Cdc42p Polarization
Mol. Biol. Cell, March 1, 2005; 16(3): 1296 - 1304.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-Y. Chen and F. M. Brodsky
Huntingtin-interacting Protein 1 (Hip1) and Hip1-related Protein (Hip1R) Bind the Conserved Sequence of Clathrin Light Chains and Thereby Influence Clathrin Assembly in Vitro and Actin Distribution in Vivo
J. Biol. Chem., February 18, 2005; 280(7): 6109 - 6117.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
Y. Sun, M. Kaksonen, D. T. Madden, R. Schekman, and D. G. Drubin
Interaction of Sla2p's ANTH Domain with PtdIns(4,5)P2 Is Important for Actin-dependent Endocytic Internalization
Mol. Biol. Cell, February 1, 2005; 16(2): 717 - 730.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. G. Roth
Phosphoinositides in Constitutive Membrane Traffic
Physiol Rev, July 1, 2004; 84(3): 699 - 730.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. E. Y. Engqvist-Goldstein, C. X. Zhang, S. Carreno, C. Barroso, J. E. Heuser, and D. G. Drubin
RNAi-mediated Hip1R Silencing Results in Stable Association between the Endocytic Machinery and the Actin Assembly Machinery
Mol. Biol. Cell, April 1, 2004; 15(4): 1666 - 1679.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Guilherme, N. A. Soriano, S. Bose, J. Holik, A. Bose, D. P. Pomerleau, P. Furcinitti, J. Leszyk, S. Corvera, and M. P. Czech
EHD2 and the Novel EH Domain Binding Protein EHBP1 Couple Endocytosis to the Actin Cytoskeleton
J. Biol. Chem., March 12, 2004; 279(11): 10593 - 10605.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. J. Baggett, K. E. D'Aquino, and B. Wendland
The Sla2p Talin Domain Plays a Role in Endocytosis in Saccharomyces cerevisiae
Genetics, December 1, 2003; 165(4): 1661 - 1674.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. B. Meriin, X. Zhang, N. B. Miliaras, A. Kazantsev, Y. O. Chernoff, J. M. McCaffery, B. Wendland, and M. Y. Sherman
Aggregation of Expanded Polyglutamine Domain in Yeast Leads to Defects in Endocytosis
Mol. Cell. Biol., November 1, 2003; 23(21): 7554 - 7565.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. W. Gourlay, H. Dewar, D. T. Warren, R. Costa, N. Satish, and K. R. Ayscough
An interaction between Sla1p and Sla2p plays a role in regulating actin dynamics and endocytosis in budding yeast
J. Cell Sci., June 15, 2003; 116(12): 2551 - 2564.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. S. Chang, K. Henry, B. L. Wolf, M. Geli, and S. K. Lemmon
Protein Phosphatase-1 Binding to Scd5p Is Important for Regulation of Actin Organization and Endocytosis in Yeast
J. Biol. Chem., December 6, 2002; 277(50): 48002 - 48008.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Kaminska, B. Gajewska, A. K. Hopper, and T. Zoladek
Rsp5p, a New Link between the Actin Cytoskeleton and Endocytosis in the Yeast Saccharomyces cerevisiae
Mol. Cell. Biol., October 15, 2002; 22(20): 6946 - 6948.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. R. Henry, K. D'Hondt, J. Chang, T. Newpher, K. Huang, R. T. Hudson, H. Riezman, and S. K. Lemmon
Scd5p and Clathrin Function Are Important for Cortical Actin Organization, Endocytosis, and Localization of Sla2p in Yeast
Mol. Biol. Cell, August 1, 2002; 13(8): 2607 - 2625.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Li, L.-S. Chin, A. I. Levey, and L. Li
Huntingtin-associated Protein 1 Interacts with Hepatocyte Growth Factor-regulated Tyrosine Kinase Substrate and Functions in Endosomal Trafficking
J. Biol. Chem., July 26, 2002; 277(31): 28212 - 28221.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Legendre-Guillemin, M. Metzler, M. Charbonneau, L. Gan, V. Chopra, J. Philie, M. R. Hayden, and P. S. McPherson
HIP1 and HIP12 Display Differential Binding to F-actin, AP2, and Clathrin. IDENTIFICATION OF A NOVEL INTERACTION WITH CLATHRIN LIGHT CHAIN
J. Biol. Chem., May 24, 2002; 277(22): 19897 - 19904.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. V. HUBBERSTEY and E. P. MOTTILLO
Cyclase-associated proteins: CAPacity for linking signal transduction and actin polymerization
FASEB J, April 1, 2002; 16(6): 487 - 499.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Mochida, T. Yamamoto, K. Fujimura-Kamada, and K. Tanaka
The Novel Adaptor Protein, Mti1p, and Vrp1p, a Homolog of Wiskott-Aldrich Syndrome Protein-Interacting Protein (WIP), May Antagonistically Regulate Type I Myosins in Saccharomyces cerevisiae
Genetics, March 1, 2002; 160(3): 923 - 934.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. K. Mishra, N. R. Agostinelli, T. J. Brett, I. Mizukami, T. S. Ross, and L. M. Traub
Clathrin- and AP-2-binding Sites in HIP1 Uncover a General Assembly Role for Endocytic Accessory Proteins
J. Biol. Chem., November 30, 2001; 276(49): 46230 - 46236.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. M. Edelman and J. A. Gally
Degeneracy and complexity in biological systems
PNAS, October 31, 2001; (2001) 231499798.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Metzler, V. Legendre-Guillemin, L. Gan, V. Chopra, A. Kwok, P. S. McPherson, and M. R. Hayden
HIP1 Functions in Clathrin-mediated Endocytosis through Binding to Clathrin and Adaptor Protein 2
J. Biol. Chem., October 12, 2001; 276(42): 39271 - 39276.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
A. E.Y. Engqvist-Goldstein, R. A. Warren, M. M. Kessels, J. H. Keen, J. Heuser, and D. G. Drubin
The actin-binding protein Hip1R associates with clathrin during early stages of endocytosis and promotes clathrin assembly in vitro
J. Cell Biol., September 17, 2001; 154(6): 1209 - 1224.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
B. L. Drees, B. Sundin, E. Brazeau, J. P. Caviston, G.-C. Chen, W. Guo, K. G. Kozminski, M. W. Lau, J. J. Moskow, A. Tong, et al.
A protein interaction map for cell polarity development
J. Cell Biol., August 6, 2001; 154(3): 549 - 576.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Waelter, E. Scherzinger, R. Hasenbank, E. Nordhoff, R. Lurz, H. Goehler, C. Gauss, K. Sathasivam, G. P. Bates, H. Lehrach, et al.
The huntingtin interacting protein HIP1 is a clathrin and {alpha}-adaptin-binding protein involved in receptor-mediated endocytosis
Hum. Mol. Genet., August 1, 2001; 10(17): 1807 - 1817.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. M. Asleson, E. S. Bensen, C. A. Gale, A.-S. Melms, C. Kurischko, and J. Berman
Candida albicans INT1-Induced Filamentation in Saccharomyces cerevisiae Depends on Sla2p
Mol. Cell. Biol., February 15, 2001; 21(4): 1272 - 1284.
[Abstract] [Full Text]


Home page
JCBHome page
G.-C. Ochoa, V. I. Slepnev, L. Neff, N. Ringstad, K. Takei, L. Daniell, W. Kim, H. Cao, M. McNiven, R. Baron, et al.
A Functional Link between Dynamin and the Actin Cytoskeleton at Podosomes
J. Cell Biol., July 24, 2000; 150(2): 377 - 390.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D Pruyne and A Bretscher
Polarization of cell growth in yeast
J. Cell Sci., January 2, 2000; 113(4): 571 - 585.
[Abstract] [PDF]


Home page
J. Cell Sci.Home page
B. Keon, P. Jedrzejewski, D. Paul, and D. Goodenough
Isoform specific expression of the neuronal F-actin binding protein, drebrin, in specialized cells of stomach and kidney epithelia
J. Cell Sci., January 1, 2000; 113(2): 325 - 336.
[Abstract] [PDF]


Home page
JCBHome page
A. E.Y. Engqvist-Goldstein, M. M. Kessels, V. S. Chopra, M. R. Hayden, and D. G. Drubin
An Actin-binding Protein of the Sla2/Huntingtin Interacting Protein 1 Family Is a Novel Component of Clathrin-coated Pits and Vesicles
J. Cell Biol., December 27, 1999; 147(7): 1503 - 1518.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. M. Edelman and J. A. Gally
Degeneracy and complexity in biological systems
PNAS, November 20, 2001; 98(24): 13763 - 13768.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, S.
Right arrow Articles by Drubin, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, S.
Right arrow Articles by Drubin, D. G.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]