|
|
|
|
Vol. 10, Issue 8, 2519-2530, August 1999
Max-Delbrück-Laboratorium, D-50829 Köln, Germany
Submitted March 1, 1999; Accepted June 3, 1999| |
ABSTRACT |
|---|
|
|
|---|
The split-Ubiquitin (split-Ub) technique was used to map the molecular environment of a membrane protein in vivo. Cub, the C-terminal half of Ub, was attached to Sec63p, and Nub, the N-terminal half of Ub, was attached to a selection of differently localized proteins of the yeast Saccharomyces cerevisiae. The efficiency of the Nub and Cub reassembly to the quasi-native Ub reflects the proximity between Sec63-Cub and the Nub-labeled proteins. By using a modified Ura3p as the reporter that is released from Cub, the local concentration between Sec63-Cub-RUra3p and the different Nub-constructs could be translated into the growth rate of yeast cells on media lacking uracil. We show that Sec63p interacts with Sec62p and Sec61p in vivo. Ssh1p is more distant to Sec63p than its close sequence homologue Sec61p. Employing Nub- and Cub-labeled versions of Ste14p, an enzyme of the protein isoprenylation pathway, we conclude that Ste14p is a membrane protein of the ER. Using Sec63p as a reference, a gradient of local concentrations of different t- and v-SNARES could be visualized in the living cell. The RUra3p reporter should further allow the selection of new binding partners of Sec63p and the selection of molecules or cellular conditions that interfere with the binding between Sec63p and one of its known partners.
| |
INTRODUCTION |
|---|
|
|
|---|
Search algorithms can identify membrane proteins and often successfully predict their topology. Fluorescence microscopy allows the determination of their cellular localization. However, to perform their function, membrane proteins very often assemble into protein complexes and temporarily relocate to sites in the cell that differ from their steady-state residence. With the current methods at hand, these processes are difficult to study.
Sec63p, as part of the tetrameric and the heptameric Sec complex in the
yeast Saccharomyces cerevisiae, is a membrane protein of the
endoplasmic reticulum (ER) (Rothblatt et al., 1989
; Deshaies et al., 1991
; Brodsky and Schekman, 1993
). The tetrameric
Sec62/63p complex and the trimeric Sec61p-complex constitute the main
components of the translocation machinery responsible for delivering
polypeptides across the membrane of the ER. The tetrameric Sec62/63p
complex harbors, in addition to Sec63p, the integral membrane proteins Sec62p and Sec71p and the peripheral membrane protein Sec72p (Deshaies et al., 1991
; Panzner et al., 1995
). The trimeric
Sec61p complex forms the actual gate across the membrane and consists
of the membrane proteins, Sec61p, Sss1p, and Sbh1p. Both complexes can exist as individual entities or as parts of the heptameric Sec complex
(for review see Rapoport et al., 1996
). The modular
structure of the translocation machinery allows Sec61p to accept a wide variety of polypetides as translocation substrates. The trimeric Sec61
complex associates with Sec62/63p to translocate polypeptides that are
either already completely or partially synthesized. Alternatively, the
trimeric Sec61 complex is found in association with translating ribosomes (Görlich et al., 1992
). Here the signal
sequence-containing nascent chain is very probably transferred via the
signal recognition particle directly to the trimeric Sec61
complex to forge a tight seal between Sec61p and the ribosome (Walter
and Johnson, 1994
; Beckmann et al., 1997
). The already
substantial number of proteins that interact with Sec63p may become
still larger since Sec63p is also involved in the retrograde transfer
of proteins from the lumen of the ER back into the cytosol (Plemper
et al., 1997
). In addition, Sec63p plays a role in the
homotypic fusion of nuclear membranes during the mating of yeast (Ng
and Walter, 1996
).
The split-Ub method can monitor interactions between proteins in the
living cell (Johnsson and Varshavsky, 1994
). It is based on the
reassembly of the N- and C-terminal halves (Nub and
Cub) of Ubiquitin (Ub). The reassembled quasi-native Ub is
recognized by the ubiquitin-specific proteases (UBPs). The UBPs cleave
any C-terminally attached polypeptide from Cub and thereby
provide an immediate readout of the Nub-Cub
reassociation. Two mutations were engineered into Nub.
Nua and Nug carry an alanine or a glycine in
position 13 of Nub. Both have a lower affinity for
Cub than Nub, the wild-type version carrying an
isoleucine in this position. It was shown that Nub and
Cub reassemble quite efficiently. However, Nua
or Nug only interact with Cub once both Ub
peptides are linked to proteins that are close to each other. Under
these conditions, Cub interacts more strongly with
Nua than with Nug (Johnsson and Varshavsky,
1994
). The split-Ub technique measures the local concentration, integrated over time, between the coupled Nub and
Cub. For convenience, the phrases proximity and distance
are sometimes used as abbreviations for this parameter.
We set out to apply the split-Ub method to the analysis of membrane proteins. Using a new reporter for the detection of the Nub-Cub assembly we could monitor the interactions of Sec63p with other members of the translocation machinery and start to map its molecular environment in vivo.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of Test Proteins
The Cub-RUra3 reporter module was constructed by PCR
amplification. The fragment covered residues 35-76 of UBI4
and a SalI and BamHI site to bring the fragment
in front of the LACI-URA3 gene fusion (Ghislain et
al., 1996
). The sequence between the C terminus of Cub
and the LACI sequence of the RURA3 reads:
GGT GGT AGG CAC GGA TCC. The last two residues
of the Cub and the N-terminal arginine of the
RURA3 are printed in bold letters; the BamHI site
is underlined. SEC63-Cub-RURA3 was
constructed by PCR amplification of the last 445 base pairs (bp) of the
coding sequence of SEC63 not including the stop codon by
using genomic DNA of S. cerevisiae as a template. The ends
of the PCR product contained restriction sites to allow the in-frame
fusion with the Cub-RURA3 module located in the
vector pRS305 (Sikorski and Hieter, 1989
). The short linker sequence
between the last codon of SEC63 and the first codon of
Cub reads: GAA GGC GGG TCG ACC GGT. The last codon of SEC63 and the first codon
of Cub are in bold letters; the SalI site is
underlined. The vector was cut at its unique PstI site in
the SEC63-containing fragment and transformed into the
S. cerevisiae strains JD51 and JD55 to yield, through
homologous recombination, the integrated cassette that expressed
Sec63-Cub-RUra3p from the native promoter of
SEC63 and a short C-terminal fragment of SEC63
comprising its last 448 bp. Integration was confirmed by PCR.
SEC63-Cub-Dha was created in a similar manner.
The linker between SEC63 and the Cub-Dha module reads: GAA GGC GGG TCG ACC ATG TCG GGG GGG. The last codon of SEC63 and the first codon of Cub
are printed in bold letters. The Cub-Dha module is
described by Johnsson and Varshavsky (1994)
.
FUR4-Cub-RURA3 was created similar to
SEC63-Cub-RURA3. The PCR product
containing the last 952 bp of the ORF of the FUR4 gene were
inserted in front of the Cub-RURA3 module
located in the pRS303 vector using an EagI and a
SalI site at the ends of the PCR product. The linker between
the last codon (bold letters) of FUR4 and the first codon of
Cub (bold letters) reads: ATT GGG TCG
ACC GGT. The SalI site is underlined. The
vector was cut at the unique EcoRI site in the
FUR4-derived fragment to create, through homologous
recombination, a C-terminal fragment of the gene of 955 bp and the
integrated cassette that expressed Fur4-Cub-RUra3p from the
FUR4 promoter. Integration was confirmed by PCR. Two
nucleotide exchanges were found in the FUR4 PCR product when
compared with the corresponding sequence in the yeast genome database
leading to an Asp and Glu in position 421 and 617 of the
Fur4p-construct instead of the Asn and Val encoded in the genomic
sequence. Since Fur4p-Cub-RUra3p still conferred
5-fluoroorotic acid (5-FOA) sensitivity to the transformed yeast, we
inferred that the Cub construct is functional.
STE14-Cub-RURA3 was constructed using
two primers to amplify the complete ORF of STE14 using
genomic DNA as a template. The PCR product was inserted between the
Cub-RURA3 module and the
PMET25-promoter in the vector pRS315. The linker between the last codon (bold letters) of STE14 and the first
codon of Cub (bold letters) reads: ATA GGG
TCG ACC GGT. The SalI site is underlined.
The same PCR product was inserted between the
PGAL1-promoter and Dha to create STE14-Dha in
the pRS314 vector. The sequence between the last codon of
STE14 and Dha reads: ATA GGG TCG ACC TTA ATG CAG
AGA TCT GGC ATC ATG GTT. The last codon of STE14
and the first two codons of Dha are underlined. The sequence connecting
the last codon of SEC62 (underlined) and Dha of
SEC62-Dha in pRS314 reads: AAC GGC GGG TCG ACC
TTA ATG CAG AGA TCT GGC ATC ATG GTT.
TOM20-Cub-RURA3 was constructed
similar to STE14-Cub-RURA3. The PCR
product was inserted between the PCUP1-promoter and the
Cub-RURA3 module in the vector pRS315. The
linker between the last codon of TOM20 (bold letters) and
the first codon of Cub (bold letters) reads: GAC
GGG TCG ACC GGT. The SalI site is underlined.
The Nub-constructs were assembled from the
PCUP1-Nub-cassette and a PCR fragment
containing the ORF or part of the ORF of the desired gene to finally
reside in the vector pRS314, pRS313, or pRS304. A BamHI site
was used to bring the Nub in frame with the PCR product.
The linker between the last codon of Nub (bold letters) and
the first codon of the following ORF (bold letters) reads: GG
ATCCCT GGC GTC for TOM22,
GG ATCCCT GGG TCT GGG ATG for
SEC61 and SSH1, GG ATC CCT GGG GAT ATG for SNC1, SSO1,
TPI1, GUK1, GG ATC
CCT GGG GAT TCC for VAM3.
The BamHI site is underlined.
Nub-SEC61 was constructed by targeted
integration of a Nub-SEC61-containing fragment
into SEC61 of the S. cerevisiae strain JD53. A
fragment containing the first 875 bp of the SEC61 ORF was
amplified by PCR and inserted downstream of the pRS304- or pRS303-based
PCUP1-Nub cassette, using the flanking
BamHI and EcoRI sites. For targeted integration,
the plasmid was linearized at the unique StuI site in the
SEC61 ORF to create the yeasts NJY61-I, -A, and -G.
Integration was confirmed by PCR. To construct Nub-Ssh1p, a
fragment of 680 bp was amplified by PCR and inserted downstream of the
pRS304-based PCUP1-Nub cassette using the
flanking BamHI and XhoI sites. The vector was cut
for targeted integration at the unique ClaI site in the
SSH1 ORF to create the yeast strains NJY78-I, -A, -G, and -VI. Integration was confirmed by PCR. The construction of
Nub-SEC62, -SED5, -STE14,
and -BOS1 was described in Dünnwald et al.
(1999)
. The functionality of Nub-Sed5p and -Sec62p was
confirmed by complementing a yeast strain carrying a ts mutation in the
corresponding gene. Nub-Sso1p, Nub-Guk1p, and
Nub-Tpi1p were shown to support growth of S. cerevisiae cells under conditions where the corresponding, unmodified protein was not expressed. Nub-Snc1p, -Tom22p,
-Vam3p, and -Ssh1p were not tested. The functionality of
Nub-Sec61p in the strain NJY61-I was tested by repeating
the transformation of JD53 with a StuI cut vector bearing a
shift in the reading frame between Nub and
SEC61. As a consequence, no full-length Sec61p should be
expressed in the transformed haploids, but only the N-terminal fragment
from the first 875 bp of the SEC61 ORF. Viable haploids
would document that the N-terminal fragment of Sec61p can substitute
for the full-length protein. However, the occasional colonies that were
obtained after transformation were shown by PCR to always harbor a
native SEC61 in addition to the modified
Nub-SEC61 allele carrying the frame shift
between the Nub and the SEC61 ORF. This shows
that in the strain NJY61-I, the essential function of Sec61p was
contributed by Nub-Sec61p.
Immunoblotting
Cell extraction for immunoblotting was performed
essentially as described (Johnsson and Varshavsky, 1994
). Proteins were
fractionated by SDS-12.5% PAGE and electroblotted on nitrocellulose
membranes (Schleicher & Schuell, Dassel, Germany), using a semidry
transfer system (Hoeffer Pharmacia Biotech, San Francisco, CA).
Blots were incubated with a monoclonal anti-ha antibody (Babco,
Richmond, CA), and bound antibody was visualized using horseradish
peroxidase-coupled rabbit anti-mouse antibody (Bio-Rad, Hercules, CA),
the chemiluminescence detection system (Boehringer, Mannheim, Germany),
and x-ray films (Kodak, Rochester, NY).
Growth Assay and Mating Assay
Yeast-rich (YPD) and synthetic minimal media with 2% dextrose
(SD) or 2% galactose (SG) were prepared as described (Dohmen et
al., 1995
). S. cerevisiae cells were grown at 30°C in
liquid selective media containing uracil. Cells were diluted in water and 4 µl were spotted on agar plates, selecting for the presence of
the fusion constructs but lacking uracil or containing 1 mg/ml 5-FOA
(WAK-Chemie, Bad Soden, Germany) and 50 µg/ml uracil. The same
dilutions were spotted on plates containing uracil to check for cell
numbers. The plates were incubated at 30°C for 3-5 d unless stated
otherwise. Mating tests were performed as described (Michaelis and
Herskowitz, 1988
).
Deletion of STE14
The open reading frame of STE14 was replaced by the
dominant kanr marker essentially as described by
Güldener et al. (1996)
. The PCR primers used for the
construction of the kanr disruption cassette were 5'-
CCCCCTCTTTCATTGTGGTCACCGTTTTTGAAC ACAACCAGCTGAAGCTTCGTACGC and
5'-CACAAAAATCCAGTCCATAACTAACACAATCATTACTAGCATAGGCCACTA-GGTGATCTG. Underlined are the sequences immediately preceding the ATG or following
the stop codon of the coding sequence of STE14 (Sapperstein et al., 1994
). Transformed yeast cells were selected for
kanr integration by Geneticin (Life Technologies, Paisley,
Scotland), and the deletion was verified by diagnostic PCR and the
mating deficiency of the cells.
| |
RESULTS |
|---|
|
|
|---|
Experimental Strategy
Sec63p was extended at its C terminus with Cub that
was linked to an N-terminally modified version of the enzyme Ura3p
(RUra3p) to create Sec63-Cub-RUra3p (Sec63CRUp) (Figures
1 and 2).
Due to the topology of Sec63p, CRUp points into the cytosol of the cell
(Feldheim et al., 1992
). By coexpressing a set of
Nub-fusion proteins (Nub-X in Figure 1), we
first attempted to distinguish between Sec63p-interacting and
-noninteracting proteins. Pathway 1: X is a protein that strongly
interacts with Sec63p. Nub and Cub reassemble
to the quasi-native Ub, and RUra3p is cleaved by the UBPs. Since the
N-terminal residue of the released RUra3p is an arginine, rapid
degradation of RUra3p by the enzymes of the N-end rule ensures that the
cells stop dividing on plates lacking uracil (Ura
). 5-FOA
is converted by Ura3p into 5-fluorouracil, which is toxic for the cell.
Therefore the rapid degradation of RUra3p due to the interaction
between protein X and Sec63p allows the cells to grow on plates
containing 5-FOA (FOAR) (Ghislain et al., 1996
;
Johnsson and Varshavsky, 1997
; Varshavsky, 1997
). Pathway 2: X is a
protein that does not interact with Sec63p. The linked Nub
and Cub do not or only partially reassemble to the
quasi-native Ub. The cells retain sufficient unclipped Sec63CRUp to
stay Ura+ and 5-FOA-sensitive (FOAS). As an
alternative to the RUra3p reporter, Sec63p-Cub was extended by the enzyme dihydrofolate reductase that carries an ha tag at its C
terminus (Sec63-Cub-Dha). The cleaved Dha remains stable in
the cytosol and can be detected together with the unclipped fusion
protein by immunoblotting with antibodies directed
against the ha epitope (Johnsson and Varshavsky, 1994
).
|
|
The Interaction between the Two Membrane Proteins, Sec62p and Sec63p, Can Be Monitored by the Split-Ub Assay In Vivo
Sec63CRUp and Sec63-Cub-Dha were integrated into
diploid cells via homologous recombination to replace one native copy
of Sec63p. Tetrad analysis of the sporulated diploids validated that both Sec63-Cub-fusion proteins are functional (our
unpublished observation). Since the two spores containing the modified
versions of Sec63p grew slightly slower, the interaction assay was
performed in diploid cells. To test the interaction between Sec62p and
Sec63p, the Nub-moiety was linked to the cytosolic
N-terminus of Sec62p (Figure 2). Nub-Sec62p is functional
(Dünnwald et al., 1999
). Immunoblot
analysis of protein extracts from cells expressing Sec63-Cub-Dha together with Nub- or
Nua-Sec62p showed that Sec63-Cub-Dha is
completely converted into Sec63-Cub and Dha.
Nug-Sec62p still induces more than 60% cleavage (Figure
3A). The ratio of cleaved to uncleaved
Cub-Dha matches the ratio seen for the interaction between
two correspondingly labeled Nub- and Cub-zipper
proteins, reinforcing the interpretation of a tight interaction between Sec62p and Sec63p (Johnsson and Varshavsky, 1994
). Bos1p, a membrane protein of the ER that does not interact with Sec63p, induces significant cleavage of Sec63-Cub-Dha when labeled with
Nub, but hardly induces any cleavage when labeled with
Nua or Nug (Figures 2 and 3A).
|
Cells harboring Sec63CRUp grow on medium lacking uracil. The same cells
coexpressing Nub-, Nua- or
Nug-Sec62p grow on medium containing uracil but fail to
grow on medium lacking uracil (Figure 3B). To test whether this new
phenotype of the Sec63CRUp containing cells is due to the ability of
Nub-Sec62p to induce cleavage and the rapid degradation of
RUra3p, we expressed the same Nub/Cub combination in congenic yeast cells harboring a deletion of
UBR1 (Figure 3B). UBR1 encodes the recognition
component of the N-end rule pathway, and proteins bearing destabilizing
N-terminal residues that are rapidly degraded in wild-type cells are
stabilized in
ubr1 cells (Bartel et al.,
1990
). Since
ubr1 cells carrying Nub-Sec62p
and Sec63CRUp are still Ura+, we conclude that in wild-type
cells bearing Sec63CRUp, Nub-Sec62p causes the cleavage and
degradation of RUra3p.
The measured proximity between Nub-Sec62p and Sec63CRUp is
a strong indicator, albeit not proof, that Sec63p and Sec62p are components of one protein complex. If the efficient reassociation of
Nug-Sec62p and Sec63CRUp is a consequence of a direct
protein interaction, overexpression of the unlabeled Sec62p should
displace its Nub-labeled counterpart in the complex. As a
consequence, the local concentration between Nub-Sec62p and
Sec63CRUp will decrease, less RUra3p will be cleaved, and the cells
will start to grow on plates lacking uracil. We expressed the
unmodified Sec62p and a Sec62p derivative that carries the Dha
extension at its C terminus (Sec62-Dha) from the inducible
PGAL1-promoter in the presence of Nug-Sec62p
and Sec63CRUp. The triply transformed cells were spotted on plates
lacking uracil that either contained glucose to repress or contained
galactose to induce the expression of Sec62p or Sec62-Dha. The growth
of the cells on plates that lacked uracil but contained galactose
confirmed the displacement of Nug-Sec62p by Sec62p or
Sec62-Dha (Figure 4A). To verify the specificity of this experiment, the competition was repeated with the
membrane protein Ste14p and the cytosolic Triose phosphate isomerase
(Tpi1p) that were expressed from the PGAL1-promoter and
C-terminally extended by the Dha module (Ste14-Dha) or the ha-epitope
(Tpi1-ha). Dha and ha served in these constructs as a tag to allow the
immunodetection of the correspondingly labeled proteins. In contrast to
the expression of Sec62p or Sec62-Dha, the overexpression of Ste14-Dha
and Tpi1-ha had no effect on the growth of the cells harboring
Sec63CRUp and Nug-Sec62p (Figure 4A).
Immunoblots confirmed the expression of all ha-bearing
proteins (Figure 4C), and a Sec62p-specific antibody confirmed the
expression of the PGAL1-driven Sec62p (our unpublished
observation). Using the Sec62p-specific antibody, we could also
demonstrate that the expression of Nug-Sec62p was not
influenced by galactose (our unpublished observation). To
semiquantitatively measure the influence of Sec62p overexpression on
the interaction between Nug-Sec62p and Sec63CRUp, roughly
10,000 cells were plated on galactose-containing medium without uracil,
and the yeast colonies were counted after 4 d (Figure 4B).
Approximately 800 colonies were recovered upon overexpression of
Sec62p, and 400 colonies were recovered upon overexpression of
Sec62-Dha, suggesting that the extension at the C terminus of Sec62p
might already interfere with the ability of the molecule to interact
with Sec63p. Around 30 colonies were recovered from yeast cells
carrying the empty PGAL1-promoter, and an average of 60 and
40 colonies were recovered upon coexpression of Ste14-Dha and Tpi1-Dha.
The competition of Nug-Sec62p by Sec62p shows that the
split-Ub measured proximity between Sec62p and Sec63p is a consequence
of both proteins being components of one protein complex.
|
The Response in the Split-Ub Assay Correlates with the Distance of the Unlabeled Protein to Sec63p
Every protein displays a characteristic spectrum of local concentrations toward the other proteins inside the cell. Split-Ub allows comparison of the local concentrations that exist between different Nub-labeled proteins and a common Cub-fusion. The proteins of high local concentration will need a Nub with a lower affinity to Cub to achieve Nub-Cub reassembly than the proteins of low local concentration. The RUra3p reporter will translate these differences into the growth rate of the yeasts. Cells harboring a Nub-labeled protein that is close to a CRUp-fusion do not grow or grow slower than cells carrying a Nub-labeled protein that is more distant. We started to map the spectrum of local concentrations of Sec63p by comparing the interactions of Sec63CRUp with 13 different Nub-, Nua-, and Nug fusions. The proteins were chosen to cover a wide range of local concentrations by predominantly selecting membrane proteins, whose distances to Sec63p are adjusted by their distinct distribution in the cell. Sec61p as a member of the heptameric Sec complex should be very close, whereas Tom22p as a membrane protein of the outer mitochondrial membrane should be very distant to Sec63p. The topology of all Nub-modified proteins and the cellular localization of the unmodified proteins are shown in Figure 2. Since the local concentration of two proteins is influenced by their amount and their cellular distribution, we tried to minimize the differences in total amount by expressing all Nub-fusions from the noninduced PCUP1-promotor.
The different growth of the transformed cells on SD-ura allows us to
clearly separate the Nub constructs of the two known Sec63p-interacting proteins, Sec62p and Sec61p, from all the other Nub constructs (Figure 5 and
Table 1). The Nub and
Nua constructs of both proteins completely inhibit the
growth of the Sec63CRUp-bearing cells. The Nug construct
inhibits growth in the case of Sec62p and strongly impairs growth in
the case of Sec61p. Sec63CRUp-containing cells transformed with any
other Nug construct show unimpaired growth on media lacking
uracil. Furthermore, the assay allows us to distinguish between the
Nub constructs of those proteins that do not bind to Sec63p
(Figure 5 and Table 1). According to the growth of the transformed
yeasts, we could arrange the Nub constructs into five
groups of decreasing proximity to Sec63p. The classification
approximately reflects the localization of the unlabeled proteins (see
Figure 1 and Table 1). Groups 1 and 2 comprise the Sec63p-binding
proteins Sec62p and Sec61p.
|
|
Group 3 includes the proteins whose Nub constructs abolish
the growth of Sec63CRUp cells, whose Nua constructs inhibit
their growth to varying degrees but whose Nug constructs
allow full growth on media lacking uracil (Figure 5 and Table 1). Group 3 includes the proteins Ssh1p, Bos1p, Ste14p, Sec22p, and Sed5p (Figure
5 and Table 1). Sec22p, Bos1p, and Ssh1p localize in the ER, whereas
Sed5p resides in the early Golgi, the compartment that is functionally
adjacent to the ER (Shim et al., 1991
; Hardwick and Pelham,
1992
; Banfield et al., 1994
; Finke et al., 1996
;
Ballensiefen et al., 1998
).
In contrast to all the other analyzed proteins, the localization and
topology of Ste14p were unknown when we started its analysis. STE14 encodes an enzyme that methylates the C terminus of
the CAAX box motif-containing proteins such as the small GTPases, Ras1p, Cdc42p, or Rho1p (Sapperstein et al., 1994
; Zhang and
Casey, 1996
). The corresponding activity in mammalian cells was shown to be associated with a microsomal membrane fraction (Stephenson and
Clarke, 1990
). Functionality of Nub-Ste14p was confirmed by complementing the mating defect of a STE14 deletion strain
(Figure 6A). Nub-Ste14p
induces the cleavage of Cubs that are localized in the
cytosol, implying that the N terminus of the protein is in the cytosol
of the cell (Figure 5; Dünnwald et al., 1999
). Since
the interaction between Nub-Ste14p and Sec63CRUp is
comparable to the interactions of the correspondingly labeled Bos1p,
Ssh1p, and Sed5p, Ste14p might be localized in the ER, the Golgi, or in
both compartments. To better resolve the localization of Ste14p, we had
to search for a Nub mutant whose affinity to
Cub falls between the affinities of wild-type
Nub and Nua. This was accomplished by
exchanging isoleucine 3 of Nub against a valine
(Nvi) (Eckert, Raquet, and Johnsson, unpublished
observation). Figure 6B shows the growth of the Sec63CRUp- containing
cells transformed with Nvi-Sec62p, -Ssh1p, -Bos1p, -Ste14p,
-Sed5p, -Sso1p, and -Snc1p. Nvi increases the resolution
among the proteins of group 3. Specifically we can clearly separate
Sed5p from the known membrane proteins of the ER. According to the
growth of the Nvi-transformed Sec63CRUp-containing cells,
Sec63p is closer to Ssh1p and Bos1p than to Sed5p and still closer to
Sed5p than to Sso1p or Snc1p. We conclude that Sed5p is situated
between the ER proteins, Ssh1p and Bos1p, and the proteins of the late
Golgi/plasma membrane, Snc1p and Sso1p (Aalto et al., 1993
;
Protopopov et al., 1993
). Our analysis places Ste14p between
Bos1p and Sed5p.
|
The faint growth of the Nvi-Bos1p-containing cells in the
second dilution of Figure 6B may indicate a slightly closer proximity between Sec63p and Ssh1p than between Sec63p and Bos1p. Ssh1p is a
homologue of Sec61p (Figure 2). Ssh1p was found in a heterotrimeric complex that is very similar to the trimeric Sec61 complex. However, unlike Sec61p, Ssh1p did not copurify with the Sec62/63p complex and
was not coimmunoprecipitated with antibodies to members of the
Sec62/63p complex (Finke et al., 1996
). Does the inability to demonstrate interaction by these techniques reflect the situation in
living cells or an inherent instability of this complex that causes its
disruption during purification? By comparing the growth of the
Sec63CRUp cells expressing Nua-Sec61p and
Nua-Ssh1p, we conclude that Sec63p is closer to Sec61p than
to Ssh1p in vivo (Figure 5 and Table 1). To confirm that the measured
difference is specific and not caused by a general higher cellular
activity of the Nua-Sec61p, we compared the two different
Nub constructs toward a Cub landmark that is
known not to interact with Sec61p or Ssh1p. We constructed a Ste14p
derivative that bears the Cub-RUra3p module at its C
terminus (Figure 2, Ste14CRUp). Ste14CRUp is functional (Figure 6A).
The unimpaired growth of the Ste14CRUp-containing cells on media
lacking uracil demonstrates that the Cub-RUra3p moiety most
likely points into the cytosol of the cell (our unpublished observation). The nearly identical growth characteristics of the cells
bearing Ste14CRUp and the Nubs of Sec62p, Sec61p, and Ssh1p document a comparable activity of the Nub fusion proteins
(Figure 6C), i.e., no growth of Ste14CRUp cells bearing the
Nub, reduced but significant growth of the cells bearing
the Nua, and unimpaired growth of the cells bearing the
Nug constructs. We conclude that the differences in the
interaction between Nua-Sec62p, -Sec61p, -Ssh1p, and
Sec63CRUp are real and reflect the differences in the interaction
between the unlabeled molecules. Therefore, Ssh1p is a membrane protein
of the ER but does not interact with Sec63p in vivo.
Figure 6C also shows that Ste14CRUp is closer to the Nub fusions of the ER than to the Nub fusions of any other compartment. Again, the difference between Nub-Ste14p and Nub-Sed5p is very subtle. However, we can discriminate between Sed5p and Ste14p more clearly by using the corresponding Nvis. Nvi-Ste14p is closer to Ste14CRUp than is Nvi-Sed5p (our unpublished observation). Nub-Sso1p and -Snc1p differ from the known Nub-labeled proteins of the ER and Nub-Sed5p by permitting unimpaired growth of the Ste14CRUp-containing cells (Figure 6C and our unpublished observation).
Characterizing Proteins That Are Very Distant to Sec63p
Group 4 includes the proteins whose Nub constructs
impair, but do not abolish, the growth of the Sec63CRUp-containing
cells. This group is very heterogeneous and thereby documents the
increasing difficulty to assign a correct localization as the distance
between the Cub landmark and the Nub protein
gets larger (Figure 5 and Table 1). Tom22p is localized at the outer
mitochondrial membrane, while Sso1p and Snc1p, a t- and v-SNARE, are
localized at the plasma membrane and the late Golgi, respectively
(Figure 2) (Aalto et al., 1993
; Kiebler et al.,
1993
; Protopopov et al., 1993
). We assumed that the assay
could establish the correct localization of Nub-Tom22p,
Nub-Snc1p, and Nub-Sso1p by selecting the
appropriate Cub landmarks. To localize Tom22p, the
Cub-RUra3p module was attached to the C terminus of Tom20p
(Figure 2, Tom20CRUp). Tom20p and Tom22p are both subunits of the
translocation complex of the outer mitochondrial membrane (Schatz,
1997
). Tom20p has an N-terminal membrane anchor and a C-terminal domain
pointing into the cytosol of the cell (Moczko et al., 1997
).
Nub-Tom22p strongly impairs the growth of
Tom20CRUp-containing cells on medium lacking uracil, whereas all other
Nub constructs have no influence (Figure
7A and our unpublished observation). This
effect depends on a functional N-end rule pathway (Figure 7C). We
conclude that Tom22p colocalizes with Tom20p at the outer mitochondrial
membrane.
|
To address the localization of Sso1p and Snc1p, we constructed Fur4CRUp
(Figure 2). Fur4p belongs to the superfamily of membrane transporters,
is localized in the plasma membrane, and transports uracil or 5-FOA
across the membrane (Jund et al., 1988
; Silve et
al., 1991
). The C terminus of the protein is very probably localized in the cytosol of the cell and is not important for the
activity of the molecule (Jund et al., 1988
). Yeast cells containing Fur4CRUp instead of the native Fur4p are still FOA sensitive, thereby demonstrating the functionality and indirectly the
correct localization of the fusion protein (our unpublished observation). A subset of Nub and Nua
constructs was transformed into the Fur4CRUp-expressing cells, and
their growth on plates lacking uracil was scored. We observe a change
in the order of proximity that was obtained for Sso1p, Snc1p, Sed5p,
and Sec62p toward the Cub landmarks, Sec63p and Ste14p, of
the ER. According to the growth of the Fur4CRUp-containing cells
harboring the corresponding Nub constructs, Fur4p is closer
to Sso1p and Snc1p than to Sed5p and Sec62p (Figure 7B).
Nub-Sec62p inhibits the growth of the Fur4CRUp-containing
cells slightly more than Nub-Sed5p (Figure 7B). Taken
together, the activity of Nub-Sso1p and -Snc1p toward the
landmarks, Fur4-, Sec63-, and Tom20-CRUp, is compatible with their
localization at or close to the plasma membrane.
|
Group 5 includes the proteins Vam3p, Tpi1p, and Guk1p. Even the
Nub constructs of these proteins do not significantly
impair the growth of the Sec63CRUp-bearing cells (Figure 5 and Table 1). The Nub constructs of all three proteins were also
tested against Tom20CRUp (Figure 7A for Vam3p), Fur4CRUp, and Ste14CRUp (our unpublished observation). The proteins of this group display no
significant proximity to any of the three Cub landmarks.
Tpi1p and Guk1p very probably have a homogenous distribution in the cytosol and therefore are equally distant from the tested landmarks. Vam3p, as a protein of the vacuole, is in a compartment that seems to
be the least accessible to all three Cub fusions (Darsow
et al., 1997
; Wada et al., 1997
; Srivastava and
Jones, 1998
).
In this modified form, split-Ub correlates close proximity between two proteins with poor growth of the transformed yeasts. The feature of Ura3p to transform the nontoxic 5-FOA to the toxic 5-fluorouracil makes it possible to reverse this correlation. The cells bearing Sec63CRUp and the Nub constructs that inhibit growth on plates lacking uracil should survive in the presence of the drug. We spotted the cells carrying Sec63CRUp and the different Nua-constructs onto 5-FOA containing plates. A summary of the growth assay is given in Table 1. As expected, the cells that do not grow or grow very poorly on medium lacking uracil display 5-FOA resistance, whereas the cells that survive on SD-ura are 5-FOA sensitive.
| |
DISCUSSION |
|---|
|
|
|---|
In this paper, we describe the molecular environment of a membrane protein in vivo. We attached Cub to the membrane protein Sec63p and measured the reassociation of the Cub moiety with different Nub-fusion proteins. The extent of cleavage at the C terminus of Cub reflects the local concentrations between the tested Nub constructs and the Cub landmark. By attaching RUra3p behind Cub we were able to translate this microscopic parameter into the growth rate of yeast cells bearing different Nub constructs.
Monitoring the Interactions between Members of the Sec Complex In Vivo
By using Nub constructs of proteins that are known not
to interact with Sec63p as a reference, we were able to monitor the residence of Sec63p within the heptameric and the tetrameric Sec complex for the first time in vivo (Figures 3-5 and Table 1).
Nug, the Nub mutant with the weakest affinity
to Cub, revealed a lower reassociation efficiency of
Sec63CRUp with Nug-Sec61p than with Nug-Sec62p.
We propose that this difference reflects the higher stability of the
tetrameric Sec62/63p complex compared with the heptameric Sec complex
in vivo (Deshaies et al., 1991
; Brodsky and Schekman, 1993
;
Panzner et al., 1995
).
Ssh1p is by sequence closely related to Sec61p and shares some of the
biochemical features of Sec61p (Finke et al., 1996
). The
direct comparison between the activities of Nua-Sec61p and Nua-Ssh1p toward Sec63CRUp showed that Ssh1p is a membrane
protein of the ER, but does not bind to Sec63p in vivo (Figure 5 and
Table 1). It is assumed that the presence of the tetrameric Sec62/63p complex enables the heptameric Sec complex to translocate proteins whose signal sequences guide them into the posttranslational pathway of
translocation (Panzner et al., 1995
; Ng et al.,
1996
). If Ssh1p constitutes a translocation pore, it should translocate
a subset of those proteins that cross the membrane independently of
Sec62/63p.
A Gradient of Local Concentrations of v- and t-SNARES Is Visualized by Split-Ub In Vivo
The Nub and the Nvi constructs of
different t- and v-SNARES of the secretion pathway (reviewed by
Rothman, 1994
), revealed a gradient of local concentrations of the
labeled proteins toward Sec63p that is compatible with the localization
of the unlabeled molecules. Ordered by their decreasing local
concentration, Sec22p is followed by Bos1p, Sed5p, Sso1p, and Snc1p,
and finally Vam3p (Figures 5 and 6B and Table 1). Since proximity in
this assay stems from the frequency of the encounters between the
labeled molecules, the differences between Sed5p and Snc1p or Sso1p
toward Sec63p are not trivial. To account for the higher frequency of encounters, Sed5p, Sec63p, or both molecules have to shuttle between the ER and the Golgi. The assay cannot distinguish which of the two
molecules actually move, but a recent study showed that Sed5p indeed
cycles through the ER (Wooding and Pelham, 1998
). We therefore propose
that the short-lived stay of Sed5p during its cycling through the ER
accounts for its increased proximity toward Sec63p.
A Network of Cub Landmarks to Map Membrane Proteins
The relative distance to a Cub landmark can reveal the
localization of a given Nub-fusion protein. The
localization of the membrane protein Ste14p provided a first test.
Ste14p is situated between Bos1p and Sed5p on our Sec63CRUp-derived
linear distance map (Figure 6B). Bos1p and Sed5p are localized in the
ER and the Golgi, respectively. The intermediate localization of Ste14p
might be explained by its dynamic distribution between these two
compartments. However, by additionally showing that Ste14CRUp behaves
like a membrane protein of the ER, we propose that the main residence of the protein is the ER. During our study we became aware of a report
that localized Ste14p in the ER and showed Ste14p to change its
cellular distribution toward the Golgi once the N or the C terminus are
extended artificially by an epitope tag (Romano et al.,
1998
). Our findings of an intermediate position of Ste14p can be
therefore explained by a partial redistribution of Ste14p upon
extending the N terminus with Nub or the C terminus with Cub. The extensions might mask a signal or a binding site
and thereby interfere with the proper sorting of the molecule. However, both Ub modifications leave the protein functional. We conclude from
the efficient reassociation of Nub-Ste14p and
Ste14-Cub with different cytosolic Nub- and
Cub-fusion proteins that both N and C termini of Ste14p are
on the cytosolic side of the membrane. The fact that one of the
modification enzymes of the isoprenylated proteins is localized in the
ER should stimulate a closer look into the trafficking of these proteins.
The limit of using one Cub landmark to localize proteins became evident by our difficulty in distinguishing between Sso1p, Snc1p, and Tom22p on our Sec63p-derived distance map. We had to introduce two further Cub landmarks to resolve the localization of these proteins. Our assay confirmed that Nub-Sso1p and -Snc1p are closer to the plasma membrane protein Fur4CRUp than are the Nub constructs of Sec62p, Sed5p, Tom22p, Tpi1p, and Guk1p or the vacuolar Vam3p (Figure 7B and our unpublished results).
The growth of the cells containing Sec63CRUp and Nub-Sso1p
or Nub-Snc1p on media lacking uracil is impaired (Figure 5
and Table 1). This can be explained by both Nub proteins
being first integrated into the ER membrane before being transported to
their final destination. Why does Nub-Tom22p show any
interaction with Sec63CRUp? We suggest that the measured proximity
between Sec63CRUp and Nub-Tom22p stems from a fraction of
mislocalized Nub-Tom22p. Mislocalization of Tom22p into the
ER might occur since its hydrophobic C-terminal tail is quite similar
to the C-terminal membrane anchors of proteins that reside in the ER or
other compartments of the secretion pathway. A more speculative
interpretation invokes a specific proximity between the outer membrane
of the mitochondrion and the membrane of the ER. The two membranes are
sometimes seen adjacent to each other in electron microscopic pictures
of cells. A functional proximity is postulated by certain models of
lipid transfer between the two organelles (Paltauf et al.,
1992
; Ardail et al., 1993
).
A Genetic Selection for Binding Partners of Cub-RUra3p-Labeled Proteins
A modification of the split-Ub assay based on the release of a
transcription factor was recently introduced to monitor the interaction
between the two proteins of the oligosaccharyl transferase complex,
Wbp1p and Ost1p. The assembly of the Nub- and
Cub-labeled proteins releases a Cub-linked
transcription factor to enter the nucleus and to initiate the
transcription of lacZ (Stagljar et al., 1998
).
The features of RUra3p as the reporter of the split-Ub assay make it
possible to select for binding partners of Sec63CRUp or any other
CRUp-labeled protein. The Nua constructs of Sec63p-binding proteins were identified by enabling cells to grow on medium containing 5-FOA (Table 1). Since the critical parameter in the split-Ub technique
is the local concentration between the two Nub- and Cub-labeled molecules, the assay senses not only a
protein's direct interaction partners but also its near neighbors.
Therefore, this parameter can be the source of false positives and
negatives. False negatives are Nub constructs that show no
specific proximity to any Cub landmark, although the
unlabeled proteins form either a complex or are localized in the same
compartment. Here inaccessibility of the coupled Nub,
instability of the fusion protein, or mislocalization upon
Nub labeling are some of the more obvious possibilities. A
false positive suggests a proximity between a pair of Nub-
and Cub-labeled proteins that does not exist for the
unlabeled molecules. Nub-Sec22p is closer to Sec63p than
any other Nub-labeled membrane protein of the ER that does
not interact with Sec63p (Figure 5 and Table 1). This becomes most
obvious when Nub-Sec22p is directly compared with
Nub-Bos1p. Sec22p and Bos1p are both v-SNAREs involved in
the vesicular transport between the ER and the Golgi (Figure 2). Both
proteins have a very similar topology and were both expressed from the
heterologous PCUP1 promotor yet show a different
interaction with Sec63CRUP (Table 1). To test whether the tighter
interaction of Sec22p is specific for Sec63p, we measured both proteins
against Ste14CRUP. Since Nub-Sec22p displays also a closer
proximity toward Ste14CRUP, we conclude that its proximity toward
Sec63p is due to a higher nonspecific activity of the Sec22p-coupled
Nub (our unpublished observation). The 5-FOA resistance of
the Sec63CRUP cells harboring Nua-Sec22p emphasizes the
need for additional assays to confirm a Nub-labeled protein
as a true binding partner of a Cub-fusion protein. The
established competition assay will serve as a control that still
operates in the frame of the split-Ub technique (Figure 4).
Coprecipitation and similar techniques that are used as independent
tests for the two-hybrid system should also be applied for proteins
that are identified by the split-Ub technique. In addition, as more
independent Cub landmarks become available, it will become
easier to discriminate true interactions from false positives and negatives.
The selection for conditions, compounds, or proteins that disrupt a specific protein interaction is an interesting feature of the RUra3p reporter system. Starting with a pair of Nub- and Cub-labeled proteins that inhibit growth on media lacking uracil, any compound interfering with this interaction can be identified by its capacity to induce colony-forming cells. We confirmed the feasibility of this approach by overexpressing unmodified Sec62p in the presence of Nug-Sec62p and Sec63CRUp.
A related scheme to search for molecules interfering with a given
protein interaction was devised on the basis of the two-hybrid system
(Vidal et al., 1996
; Huang and Schreiber, 1997
). However, this assay is limited to interactions that can be reconstituted in the
nucleus. The split-Ub system makes it possible to extend this approach
to the analysis of membrane proteins or other proteins whose
interactions cannot be reconstituted in the nucleus.
| |
ACKNOWLEDGMENTS |
|---|
We thank David Banfield, Jürgen Dohmen, Walther Mothes, Tom Rapoport, Hans Ronne, and Randy Schekman for the gifts of plasmids, yeast strains, and antisera; Sonja Kind for cloning the TOM22 and TOM20 constructs; Jörg H. Eckert and Xavier Raquet for constructing and testing the Nvi-mutant; and G. Dues, J.H. Eckert, V. Gerke, X. Raquet, and D. Schmitt for critically reading the manuscript. We thank D. Schmitt for providing the plasmids harboring Nub-Sec22p. This work was supported by grant 0311107 to N.J. from the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie. N.L. was supported by a stipend from the Max-Planck-Society.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: johnsson{at}mpiz-koeln.mpg.de.
| |
REFERENCES |
|---|
|
|
|---|