![]() |
|
|
Vol. 10, Issue 8, 2531-2546, August 1999



§ and
*Departments of Genetics,
Pharmacology and Cancer
Biology, and §Medicine, the
Howard Hughes
Medical Institute, Duke University Medical Center, Durham, North
Carolina 27710
| |
ABSTRACT |
|---|
|
|
|---|
In complex with FKBP12, the immunosuppressant rapamycin binds to and inhibits the yeast TOR1 and TOR2 proteins and the mammalian homologue mTOR/FRAP/RAFT1. The TOR proteins promote cell cycle progression in yeast and human cells by regulating translation and polarization of the actin cytoskeleton. A C-terminal domain of the TOR proteins shares identity with protein and lipid kinases, but only one substrate (PHAS-I), and no regulators of the TOR-signaling cascade have been identified. We report here that yeast TOR1 has an intrinsic protein kinase activity capable of phosphorylating PHAS-1, and this activity is abolished by an active site mutation and inhibited by FKBP12-rapamycin or wortmannin. We find that an intact TOR1 kinase domain is essential for TOR1 functions in yeast. Overexpression of a TOR1 kinase-inactive mutant, or of a central region of the TOR proteins distinct from the FRB and kinase domains, was toxic in yeast, and overexpression of wild-type TOR1 suppressed this toxic effect. Expression of the TOR-toxic domain leads to a G1 cell cycle arrest, consistent with an inhibition of TOR function in translation. Overexpression of the PLC1 gene, which encodes the yeast phospholipase C homologue, suppressed growth inhibition by the TOR-toxic domains. In conclusion, our findings identify a toxic effector domain of the TOR proteins that may interact with substrates or regulators of the TOR kinase cascade and that shares sequence identity with other PIK family members, including ATR, Rad3, Mei-41, and ATM.
| |
INTRODUCTION |
|---|
|
|
|---|
The immunosuppressants, cyclosporin A, FK506, and rapamycin, form
complexes with either cyclophilin A or FKBP12 that inhibit components
of signal-transduction pathways conserved from yeast to man (Heitman
et al., 1992
; Schreiber and Crabtree, 1992
; Cardenas et al., 1994b
). Rapamycin has attracted much attention
because of its potent immunosuppressive, antifungal, and antineoplastic activities, and late-phase III clinical trials are in progress.
Rapamycin binds with high affinity to the prolyl isomerase FKBP12,
which is highly conserved from yeast and other microorganisms to man.
The active intracellular toxin is the resulting FKBP12-rapamycin complex, and yeast mutants lacking FKBP12 are viable and rapamycin resistant (Heitman et al., 1991
; Koltin et al.,
1991
). The targets of the FKBP12-rapamycin complex were first
identified in yeast as the TOR1 and TOR2 proteins, which share 67%
overall identity, have a C-terminal domain with similarity to both
protein and lipid (PI-3 and PI-4) kinases, and directly interact
with FKBP12-rapamycin (Heitman et al., 1991
; Cafferkey
et al., 1993
; Kunz et al., 1993
; Helliwell
et al., 1994
; Cardenas and Heitman, 1995
; Zheng et
al., 1995
). Subsequently, the mammalian homologue of the yeast TOR proteins (mTOR, FRAP, RAFT1, SEP, or RAPT1) was identified as an
FKBP12-rapamycin-binding protein and found to share ~50% identity with TOR1 and TOR2 (Brown et al., 1994
; Chiu et
al., 1994
; Sabatini et al., 1994
; Sabers et
al., 1995
).
Gene deletion experiments revealed that the yeast TOR2 protein is
essential for viability, whereas in most genetic backgrounds the yeast
TOR1 protein is not (Cafferkey et al., 1993
; Kunz et al., 1993
; Helliwell et al., 1994
). Yeast cells exposed
to rapamycin or depleted of both TOR proteins arrest as large unbudded
cells in the G1 or G0 phase of the cell cycle,
indicating a specific role for the TOR proteins in cell-cycle
progression and as the targets of rapamycin (Heitman et al.,
1991
; Kunz et al., 1993
). TOR mutants altered in any of
three conserved residues (S1975, W2042, and F2049 in TOR2) fail to bind
FKBP12-rapamycin and, as a consequence, confer dominant rapamycin
resistance (Stan et al., 1994
; Chen et al., 1995
;
Lorenz and Heitman, 1995
).
The yeast and mammalian TOR proteins share sequence similarity with
both protein and lipid kinases. The mammalian TOR protein exhibits an
autophosphorylation activity that is dependent on integrity of the
kinase domain and can be inhibited by FKBP12-rapamycin, suggesting
that the TOR proteins might be unusual protein kinases (Brown et
al., 1995
; Brunn et al., 1996
; Hara et al.,
1997
; Withers et al., 1997
). Consistent with this view,
recent studies reveal that the mammalian TOR protein phosphorylates
PHAS-I (Brunn et al., 1997
; Burnett et
al., 1998
), which had been implicated in earlier studies as a
component functioning downstream of TOR and involved in the regulation
of translational initiation (Lin et al., 1995
; von
Manteuffel et al., 1996
).
Genetic studies reveal that integrity of the TOR protein kinase domains
is also essential for TOR in vivo functions in yeast, further
supporting the hypothesis that activity of the kinase domain is
important for TOR function (Cardenas and Heitman, 1995
; Zheng et
al., 1995
; Schmidt et al., 1996
). The TOR proteins have been implicated in two intracellular functions. First, yeast TOR1 and
TOR2 and their mammalian homologue, mTOR/FRAP/RAFT1, regulate initiation of translation (Graves et al., 1995
; Barbet
et al., 1996
; Di Como and Arndt, 1996
). Rapamycin or TOR
depletion results in an inhibition of translation in yeast, and the
mammalian TOR protein plays an analogous role in regulating
translation, directly or indirectly, via P70 S6 kinase and the PHAS-I
regulator of the CAP-binding protein eIF-4E (for reviews see Brown and
Schreiber[1996] and Lawrence and Abraham [1997]). A second distinct
role has been defined for the yeast TOR2 protein in regulating
polarization of the actin cytoskeleton (Schmidt et al.,
1996
, 1997
).
The TOR proteins have been implicated as components of signal
transduction cascades that regulate cell-cycle progression and proliferation in response to growth factors, such as IL-2, in mammalian
cells and in response to nutrients in yeast cells. For example, the TOR
proteins function in nutrient-sensing pathways that regulate autophagy
and sporulation in Saccharomyces cerevisiae (Zheng and
Schreiber, 1997
; Noda and Ohsumi, 1998
) and during mating and
sporulation in Saccharomyces pombe (Weisman et
al., 1997
). However, the mechanisms by which the TOR proteins are
activated, and the target substrates altered by the TOR proteins to
exert their regulatory influences on translation, cell polarity, and cell cycle progression are largely unknown. In previous studies, we
established that the TOR kinase domain has been functionally conserved
from yeast to man, indicating that TOR is a highly conserved regulator
of cell growth (Alarcon et al., 1996
). Here we have sought
to identify functional domains of the TOR proteins as a starting point
to identify other interacting components of these cascades.
In this report we demonstrate that TOR1 exhibits an intrinsic protein
kinase activity capable of phosphorylating PHAS-I. This activity is
stimulated by Mn2+ ions, abolished by an active site
mutation, and inhibited by FKBP12-rapamycin or wortmannin. We find
that integrity of the yeast TOR1 kinase domain is required for TOR1
function in yeast and for a rapamycin-resistant TOR1 mutant to confer
drug resistance. These findings are in accord with previous reports on
TOR1 and TOR2 kinase-inactive mutants (Cardenas and Heitman, 1995
;
Zheng et al., 1995
; Schmidt et al., 1996
).
Moreover, we also find that overexpression of the TOR1 kinase-inactive
mutant is toxic to the cell, possibly by sequestering substrates or
regulators of TOR1. Interestingly, deletion of the TOR1 FRB
domain, the kinase domain, or both domains, results in TOR1-truncation
derivatives that are toxic to the cell. Overexpression of different
truncated forms of TOR1 and TOR2 identifies a central-toxic-effector
domain of the TOR proteins, distinct from the FRB and kinase domains, which may interact with substrates or regulators of the TOR- signaling cascade. Toxicity of the TOR1 kinase-inactive mutant or the TOR-toxic effector domains was mitigated by overexpression of wild-type TOR1,
indicating a specific inhibition of TOR function. Overexpression of the
yeast phospholipase C homologue PLC1 also suppressed growth inhibition
by the TOR1-toxic domain, suggesting a link between the TOR- and
PI-signaling cascades. The yeast PLC1 gene was recently independently identified as a multicopy suppressor of certain TOR2
conditional mutants (Helliwell et al., 1998
), further
supporting a connection between the TOR- and PI-signaling cascades in
the regulation of cell function.
The TOR-toxic domain is conserved between yeast TOR1 and TOR2 and their
mammalian counterpart, mTOR/RAFT/FRAP. In addition, a BLAST search with
the TOR-toxic domain reveals limited identity over an ~240-amino acid
region with the PIK-related family member ATR from humans, and
other PIK family members, including S. pombe Rad3,
Drosophila mei-41, and the human ATM protein. Notably, ATR is most closely related to ATM, the protein mutated in patients with ataxia-telangiectasia, and both ATR and ATM have been implicated in signaling cascades regulating cell checkpoint responses to DNA
damage and may also play roles in meiotic recombination (Barlow et al., 1996
; Xu et al., 1996
; Xu and Baltimore,
1996
; Morgan et al., 1997
; Cliby et al., 1998
).
That the TOR-toxic domain shares identity with ATR and other PIK family
members suggests that, like the kinase domain, the toxic domain has
been conserved and could have a role in interactions with PIK-effector proteins.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Media and Strains
Yeast media were prepared as previously described (Sherman,
1991
). Minimal galactose medium is identical to SD medium, except that
the carbon source is 2% galactose and 3% glycerol. Where indicated,
medium was supplemented with different concentrations of rapamycin.
Yeast transformations were performed using the lithium acetate method
(Schiestl et al., 1993
).
Yeast strain CAY7 was derived from strain CAY1 (MATa
tor1::leu2::hisG
srk1::G418
TRP+) (Alarcon et al., 1996
) by one-step
gene disruption with the trp1::hisG-URA3-hisG::trp1-integrating
plasmid pNKY1009 and rendered ura3- by selection
on 5-FOA, as previously described (Alani et al., 1987
). Strain CAY6 was derived from strain BJ5459 (MATa
ura3-52 trp1 lys2-801 leu2
1 his3
200 can1
pep4::HIS3 prb1
1.6R) by one-step gene disruption with
a PCR product bearing
tor1::G418 obtained with
primers 676 (5'-TTGGAGAAAATTTTCCGCGAATTAACCAGTGATTACAAGGCAG -CTGAAGCTTCGTACGC-3') and 677 (5'-TTGCGCCCTTTCTTAATAATTCACTAGGATTAATCAACGGGCATAGGCCACTAGT -TGGATCTG-3') and template plasmid pFA6-kanMX2 (Wach et al.,
1994
).
TOR1 Mutant and Truncation Plasmid Constructions
The wild-type TOR1 and TOR2 proteins and their mutant or
truncated derivatives were expressed from the regulatable GAL1 promoter with an amino-terminal hemagglutinin (HA) epitope tag. The
HA-tagged wild-type TOR1 (GAL1 2µ TRP1) plasmid
was provided by David Fiorentino (plasmid pYDF72). The TOR1
kinase-inactive mutation D2275A was introduced by PCR overlap
mutagenesis (Ho et al., 1989
) using primers 522 (5'-CTGGGACTAGGTGCTCGCCATCCAAGC-3') and 523 (5'-GCTTGGATGGCGAGCACCTAGTCCCAG-3') (mutations in bold) and
flanking primers 734 (5'-GATATCCAACAATACCCGGCTATTCCAT-3') (upstream of
the unique KpnI site in TOR1 gene) and 558 (5'-CCGCGTCGACATACCTATTGTGAAAAGTACCGATG-3') (SalI
site shown in bold). The PCR product was digested with KpnI and SalI and subcloned into plasmid pYDF72 (HA-tagged TOR1
construct) that had been cleaved with KpnI and
SalI.
The TOR1 rapamycin-resistance mutations, S1972I and S1972R, were constructed by gap repair of genomic TOR1 mutations. The HA-tagged wild-type TOR1 plasmid was cleaved with KpnI and NcoI, and 1 µg of this gapped plasmid DNA was transformed into either strain RR1 or R20, which are isogenic derivatives of strain Y190OY JK9-3d isolated as spontaneous rapamycin-resistant mutants. By DNA sequence analysis, RR1 is a TOR1 S1972I mutation, and R20 is a TOR1 S1972R mutation. Transformants were selected on SD-TRP medium, and the gap-repaired plasmid was isolated. The complete NcoI-KpnI region was sequenced, revealing that the expected S1972I or S1972R mutations, and no other extraneous mutations, were now present. These mutant NcoI-KpnI fragments were subcloned into the HA-tagged TOR1 and kinase-inactive TOR1 plasmids between the NcoI and KpnI sites.
Carboxy-terminal TOR1 deletion mutants were generated by restriction endonuclease digestion. The HA-tagged TOR1 plasmid was digested with either KpnI-SalI or NcoI-SalI, blunted, and ligated. Deletion 290-1682 was generated by digesting and ligating pCNTOR1(wild-type TOR1 in pRS316 CEN, URA3) or pT1DA (kinase-inactive TOR1 in pRS316 CEN, URA3) with BamHI. This TOR1-truncated plasmid was used as template for a PCR reaction using primers 430 (5'-GGCCAGTATTTCATTATTTG-3') and 536 (5'-CTTTTCTCTTAAGATGGCAGC-3').
All other internal deletions were generated by PCR overlap mutagenesis
using the TaKaRa long-range PCR system from Intergen (Purchase, NY).
Deletion 1962-2051 was generated with overlapping primers 752 (5'-GCCGTTCTATGGCACATACCACAGTTACAAACCTTAGACTTACAG-3') and
751 (5'-GTGCCATAGAAC-GGCTACTCTGAT-3') (overlap
in bold) and flanking primers 536 and 519 (5'-GAATCAAACGGATGCTGCAATTGG-3'). Deletion 1775-2157 was generated
with overlapping primers
734 (5'-AAGCTCAACGGAGATATCCAACAATACCCGC-TATTCCA-3') and
733 (5'-TCCGTTGAGCTTAGTCTCTTCCTG-3') and flanking primers
536 and 519. Deletion 731-1682 was generated with overlapping primers 707 (5'-AAGGAAGAAACTAATAATATGATCG-CGCAAAGTGTCAAACTC-3') and 706 (5'-AGTTTCTTCCTTTTCTCGAGA-3') and flanking primers 536 and 430. Deletion 1207-1682 was generated with overlapping primers
791 (5'GCAGCAGATGCTAATAATATGATCGCGCAAAGTGTCAAAC-TC-3') and 790 (5'-AGCATCTGCTGCCTCCATTTG-3') and flanking primers 536 and 430. Deletion 1483-1682 was generated with overlapping primers
801 (5'-GAATATATCAGCAATAATATGAT-CGCGCAAAGTGTCAAACTC-3') and
800 (5'-GCTGATATATTCGTCAAGCAT-3') and flanking primers 536 and 430. The two PCR fragments generated were isolated and used as
templates for a second PCR reaction using the flanking primers. The
HA-tagged TOR1 and the HA-tagged kinase-inactive TOR1 constructs were
digested with NcoI and KpnI and the 12-kilobase (kb) fragment was isolated using gene-clean (BIO 101, Vista, CA). Gapped plasmid DNA (1 µg) was cotransformed with the PCR products described above into yeast strain CAY6, and transformants were selected
on SD-TRP medium. Homologous recombination between TOR1 DNA
sequences at each end of the PCR fragment and the TOR1 gene on the plasmid results in targeted integration into the plasmid (Orr-Weaver et al., 1981
). The truncated forms of
TOR1 were identified by PCR, using primers 536 and 430.
To clone TOR1 and TOR2 fragments into the same plasmid background, a URA3 cassette was generated containing the HA epitope and NotI sites with the following primers: 5'-CGATAC-CCATACGACGTCCCAGACTACGCTAGCTC-GACGGTATCGG-CGGCCGCCTTATTCTTTTTTTTGATTTCGG-3' (no. 628) (the HA epitope is underlined and the NotI site in bold) and 5'-GTCGACGG-TATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGCGGC-CGCGCTTTTTCTTTCCAATTTTTTTTTTTTCG-TC-3'(no. 629) (NotI site in bold). This PCR product was cotransformed with the gapped HA-tagged TOR1 plasmid into yeast strain CAY6, and transformants were selected on SD-URA medium. Homologous recombination between the vector sequences at each end of the PCR product and the plasmid replaced the TOR1 sequence. This plasmid was digested with NotI to remove the URA3 sequence, and TOR1 and TOR2 fragments were cloned as NotI cassettes. A TOR1 fragment containing residues 1207-1774 was PCR amplified with primers 911 (5'-CCGCTC-GAGGCGGCCGCCGGGGTCGCAAAATTACCTATAAACCAATC-A-3') and 886 (5'-CGCGGATCCGCGGCCGCCTCCGTTGAGCT-TAGTCTCTTCCTGAACCAT-3') (NotI sites in bold). A TOR1 fragment containing residues 1207-1961 was PCR amplified with primers 911 and 912 (5'-AAACTGCAGGCGGCCGCCGTGCCATAGAACGGCTACTCTGATCAACTC-3'). A TOR1 fragment containing residues 1207-2340 was PCR amplified with primers 911 and 913 (5'-AAACTGCAGGCGGCCGCCGACATTTTCACAAGTAATTCG-GAAACTGCC-3'), and the template was either the wild-type TOR1 gene, the kinase-inactive TOR1 gene, or the double-mutant TOR1 gene. A TOR2 fragment containing residues 1216-1782 was PCR amplified with primers 1094 (5'-AAGGAAAAAGCGGCCGCCGTAACGAAATTACCGGTAAACCAAAATATC-3') and 1095 (5'-AAGCTGCAGGCGGCCGCCCTGTTTCTTTTTAGAGACAGATGTTAGCAT-3'). A TOR2 fragment containing residues 1216-1964 was PCR amplified with primers 1094 and 1096 (5'-AAGCTGCAGGCGGCCGCCATGCCAAAGCACCGCCATACGTATCAATTC-3'). A TOR2 fragment containing residues 1216-2345 was PCR amplified with primers 1094 and 1097 (5'-AAGCTGCAGGCGGCCGCCAACATTCTCACAAGTAATACGGAAGCTACC-3'). All constructs were transformed into yeast strain CAY6. Several independent constructs and from 5 to 10 transformants for each construct were tested for their ability to grow on galactose medium. In addition, the integrity of these PCR-generated constructs was verified in the majority of cases by DNA sequence analysis with synthetic primers corresponding to the known sequences of the yeast TOR1 and TOR2 genes.
PLC1, STT4, and MSS4 Overexpression Plasmids
To create pGMSS4, the MSS4 gene was amplified with
primers 1227 (5'-CGGGATCCATGTCAGTCTTGCGATCAC-3') and 1228 (5'-GCGGATCCTCAGTCTTTATAATTTTTCTGC-3') using pMSS4 (Yoshida et
al., 1994b
) as template. This PCR product was digested with
BamHI and cloned in pYeF1 at the BamHI site to
place expression of the MSS4 gene under the control of the GAL10-CYC1 promoter. The his-c-myc epitope-tagged PLC1
overexpression plasmid pJF137 has been described previously (Flick and
Thorner, 1993
). The plasmid pGALHA-STT4 employed to overexpress the
HA-tagged STT4 protein was as previously described (Cutler et
al., 1997
).
Protein Extracts for Immunoprecipitates and Protein Kinase Assays
Yeast cells CAY6 transformed with the 2µ, GAL1 plasmid pYDF72
(encoding the H6 tagged full-length TOR1 gene or different
mutant forms under control of the GAL1 promoter) induced
with galactose as indicated above were spheroplasted in 1.2 M sorbitol,
100 mM KH2PO4, pH 7.5, and 3500 U/ml lyticase
for 20 min at 30°C. The spheroplasts were washed twice in the same
buffer without lyticase and lysed by resuspending in lysis buffer (50 mM HEPES, pH 7.4, 100 mM KCl, 0.1 mM EDTA, 1 mM dithiothreitol, 0.2%
Tween 20, 25 mM
-glycerophosphate, 25 mM NaF, 100 µM
Na3VO4, 0.5 mM PMSF, 1 µg/ml pepstatin, 100 µM leupeptin, 1 mM benzamidine, and 1% trasylol), for 30 min at
4°C. Cell lysates were centrifuged at 15,000 rpm for 15 min at 4°C.
HA-TOR1 polypeptides were precipitated from these supernatants with 30 µl/ml HA.11 monoclonal antibody immobilized on sepharose beads
(Babco). After incubation for 1 h at 4°C, the beads were
recovered by brief centrifugation, and immunoprecipitates were washed
three times with lysis buffer containing 400 mM NaCl and twice with
kinase buffer consisting of 10 mM HEPES, pH 7.4, 50 mM NaCl, 10 mM
MnCl2, 1 mM DTT. For inhibition studies, immunobeads were
preincubated for 15 min at 4°C in 15 µl of kinase buffer alone or
containing FKBP12-FK506 or FKBP12-rapamycin complexes or wortmannin
at the concentration indicated in the legend to Figure
1. Kinase reactions were started by
addition of 15 µl of reaction mix consisting of kinase buffer
containing 20 µM ATP, 10 µCi
32P-ATP, and 1 µg
recombinant PHAS-I (Stratagene, La Jolla, CA) and incubated at 30°C
for 40 min. FKBP12-FK506 or FKBP12-rapamycin complexes were formed by
mixing 1 µg of recombinant yeast H6-FKBP12 with 1 µM FK506 or 1 µM rapamycin (added from 1 mM stocks in methanol) in kinase buffer
followed by incubation for 1 h at 4°C.
|
Yeast Cell Extracts for Western Blot Analysis
Yeast cells CAY6 transformed with the 2µ, GAL1 plasmid pYDF72
(encoding the full-length TOR1 gene or different mutant
forms under control of the GAL1 promoter) were grown in
minimal medium, with 2% raffinose as the carbon source. When cultures
reached an OD600 ~1, 2% galactose was added for 2 h
to induce TOR1 expression from the GAL promoter. Cells were harvested
by centrifugation, and protein extracts and Western blot analysis were
performed as previously described (Cardenas et al., 1994a
).
| |
RESULTS |
|---|
|
|
|---|
TOR1 Has an Intrinsic Protein Kinase Activity In Vitro
The yeast targets of rapamycin, the TOR1 and TOR2 proteins, have a carboxy-terminal domain with similarity to both lipid and protein kinases. Despite this sequence similarity, no intrinsic kinase activity has yet been detected for either yeast TOR protein. We have therefore taken biochemical and genetic approaches to determine the enzymatic activity and to define residues and domains important for TOR in vivo functions.
The mammalian TOR homologue protein (mTOR) has an intrinsic protein
kinase activity capable of phosphorylating the eIF-4E-binding protein
PHAS-I (Brunn et al., 1997
; Burnett et al.,
1998
). We therefore tested whether yeast TOR1 can phosphorylate PHAS-I. For these experiments, the TOR1 protein was overexpressed from the GAL
promoter as an N-terminally HA epitope-tagged protein. Immunoprecipitated HA-TOR1 readily phosphorylated PHAS-I in vitro (Figure 1A). As previously observed with the mammalian TOR enzyme, phosphorylation of PHAS-I by yeast TOR1 was stimulated by including MnCl2 instead of MgCl2 in the reaction mix
(Figure 1A). Phosphorylation of PHAS-I by the yeast TOR1 enzyme was
fully inhibited by wortmannin and partially inhibited by
FKBP12-rapamycin (~50%), but not by FKBP12-FK506 (Figure 1A).
TOR mutants altered in a conserved serine residue (S1972 in TOR1, S1975
in TOR2, and S2035 in mTOR) fail to interact with the FKBP12-rapamycin
complex and thus confer resistance to rapamycin (Helliwell et
al., 1994
; Stan et al., 1994
; Brown et al.,
1995
; Lorenz and Heitman, 1995
; Zheng et al., 1995
).
Furthermore, conserved active site residues of protein kinases required
for ATP binding and phosphate transfer have been previously identified
(Taylor et al., 1993
). These active site residues are also
conserved in lipid kinases, including the yeast PI-3 kinase VPS34 and
the mammalian PI-3 kinase, and are required for in vitro activity and
in vivo functions of these kinases (Schu et al., 1993
; Dhand
et al., 1994
). We therefore introduced both a
rapamycin-resistant mutation (S1972I) and a kinase-inactivating
substitution at a conserved residue in the presumptive TOR1-active
site, aspartic acid 2275 to alanine (D2275A).
To determine whether the kinase activity detected with the immunoprecipitated TOR1 is intrinsic to the TOR1 protein, HA epitope-tagged forms of wild-type TOR1, the rapamycin-resistant TOR1 (S1972I), and the putative kinase-inactive TOR1 (D2275A) mutant proteins were overexpressed, immunoprecipitated, and tested for their ability to phosphorylate PHAS-I. Both the wild-type TOR1 and the rapamycin-resistant (S1972I) mutant enzyme robustly phosphorylated PHAS-I (Figure 1B). Wild-type TOR1 was sensitive to inhibition by the FKBP12-rapamycin complex, whereas the S1972I TOR1 mutant enzyme was completely resistant to FKBP12-rapamycin (Figure 1B). Both wild-type TOR1 and the S1972I mutant enzyme were sensitive to inhibition by wortmannin (Figure 1B). As expected, the D2775A-active site mutation abolished phosphorylation of PHAS-I by TOR1 (Figure 1B). Taken together, these results establish that the yeast TOR1 protein possesses an intrinsic protein kinase activity.
TOR1 Kinase Domain Is Essential for TOR1 Function
We next assessed the contribution of the kinase domain for TOR1
cellular functions in vivo by two assays. First, we tested the ability
of the wild-type, and the S1972I, D2275A, and S1972I/D2275A mutant
TOR1 genes to complement a previously described conditional synthetic lethal interaction between mutations in the TOR1
and SRK1/SSD1 genes (Alarcon et al., 1996
). As
shown in Figure 2A, both wild-type
TOR1 and the rapamycin-resistant S1972I TOR1
mutant complemented the tor1 mutation and restored growth of
a tor1 srk1 mutant strain at 39°C. In contrast, neither
the kinase-inactive D2275A TOR1 mutant nor the
S1972I/D2275A TOR1 double mutant complemented the
tor1 mutation, indicating that integrity of the TOR1 kinase domain is essential for TOR1 in vivo function.
|
As a second measure of TOR1 function, we tested the ability of the
wild-type and mutant TOR1 genes to confer rapamycin
resistance. Previous studies established that the TOR1 S1972I mutation
confers dominant rapamycin resistance by preventing FKBP12-rapamycin
binding to and inhibition of TOR1 function (Lorenz and Heitman, 1995
; Zheng et al., 1995
). As expected, the S1972I TOR1 mutant
protein conferred rapamycin resistance (Figure 2B). In contrast,
introduction of the kinase-inactive mutation D2275A into the S1972I
TOR1 mutant gene, to result in the S1972I/D2275A
double-mutant TOR1 protein, abolished the ability of the S1972I
mutation to confer rapamycin resistance (Figure 2B), in accord with an
earlier report (Zheng et al., 1995
). Thus, activity of the
TOR kinase domain is required both for TOR1 in vivo function and for
the S1972I TOR1 mutant protein to confer rapamycin resistance.
Overexpressed TOR1 Kinase-inactive Mutant Inhibits Cell Growth
Catalytically inactive kinases often exhibit dominant negative
effects on cell growth or function by titrating factors or substrates
that normally associate with the wild-type kinase. We engineered genes
encoding wild-type TOR1, a kinase-inactive TOR1 mutant (D2275A), a
rapamycin-resistant TOR1 mutant (S1972I or S1972R), and a double-mutant
TOR1 (D2275A/S1972I) under the control of the inducible GAL1
promoter. The effects of these TOR1 proteins were assessed in cells
grown on galactose medium (SG-trp) to induce expression. As shown in
Figure 2C, overexpression of wild-type TOR1, or of the
rapamycin-resistant TOR1 mutant (S1972I or S1972R), had no effect on
growth. In contrast, overexpression of the kinase-inactive TOR1 mutant
(D2275A), or of the TOR1 double-mutant TOR1 (D2275A/S1972I), inhibited
growth. This growth- inhibitory effect was observed on solid medium but
not in liquid culture. These results are in accord with a previous
study in which overexpression of other kinase-inactive TOR1 mutants
(R2276P, D2294E) inhibited yeast cell growth on solid, but not in
liquid, medium (Zheng et al., 1995
). However, our findings
disagree with the observation in the same report that overexpression of
the rapamycin-resistant TOR1 mutant (S1972I) results in a dominant
growth-inhibitory effect, and that introduction of the kinase-inactive
mutations (R2276P or D2294E) into the TOR1 S1972I mutant suppressed
this effect (Zheng et al., 1995
).
|
Our results clearly demonstrate that overexpression of the kinase-inactive mutant (D2275) dominantly inhibits yeast cell growth. The kinase-inactive mutant was toxic in the context of both wild-type TOR1 and the S1972I rapamycin-resistant TOR1 mutant protein. The growth-inhibitory phenotype conferred by overexpression of the kinase-inactive D2275A TOR1 mutant protein was suppressed by overproduction of wild-type TOR1 (our unpublished results), indicating that the toxicity of the kinase-inactive protein is a specific effect attributable to interference with TOR function.
The FKBP12-rapamycin complex binds to and inhibits the yeast TOR1 and TOR2 proteins. We tested whether growth inhibition by the overexpressed TOR1 kinase-inactive mutant could be overcome by inhibiting TOR1 with FKBP12-rapamycin. To this end, a plasmid expressing the TOR2-1 mutant protein (S1975I) was introduced to render cells resistant to rapamycin, and cells were exposed to rapamycin. Treatment with 0.1 or 1 µg/ml rapamycin did not block the toxic effect of the kinase-inactive TOR1, indicating that the TOR1 FRB domain is not required for this effect (our unpublished results). This conclusion is also supported by deletion analysis of the TOR1 FRB domain, as described below.
Mapping the Domain Required for TOR1 Toxicity
To identify regions of TOR1 responsible for the toxic effect of
the kinase-inactive mutant, deletions or truncation variants of the
TOR1 protein were fused to the HA epitope tag and expressed from the
inducible GAL1 promoter (Figure
3A). A 45-kDa region of TOR1 (amino acids
1775-2157) is sufficient to bind the FKBP12-rapamycin complex (Zheng
et al., 1995
). To determine whether this
FKBP12-rapamycin-binding domain was required for toxicity of the
kinase-inactive TOR1 mutant, we deleted the region from amino acid 1775 to 2157 in wild-type TOR1 and in the TOR1 kinase-inactive mutant.
Western blot analysis with an anti-HA antibody confirmed that proteins
of the expected molecular weights were expressed in all cases (Figure
3C). The ability of these TOR1 deletion mutants to inhibit growth on
galactose medium was then tested.
As shown in Figure 3B, overexpression of the TOR1 FRB-deletion mutant conferred a growth-inhibitory effect, indicating that the FRB domain is not required for toxicity of the TOR1 kinase-inactive mutant. To our surprise, the TOR1 FRB deletion mutant with a wild-type kinase domain was also toxic (Figure 3B), indicating not only that the FRB is not required for the toxic effect, but that deleting the FRB domain from wild-type TOR1 is in itself toxic. This finding suggests that the kinase domain itself may not be directly responsible for toxicity of the kinase-inactive TOR1. Instead, one possible model is that effector molecule(s) bind to other regions of the TOR1 protein, the kinase domain transiently interacts with these molecules in an enzyme-substrate interaction, and this fails to occur with the kinase-inactive mutant, leading to a dominant loss of TOR function. In support of this interpretation, truncation mutants lacking the kinase domain (from amino acids 2178 to 2470), or lacking both the FRB and the kinase domains (from amino acids 1766 to 2470), inhibited growth when overexpressed on galactose medium (Figure 3B). These findings indicate that a region of the protein responsible for the toxic effect lies in the amino-terminal or central region of the protein (amino acids 1-1766) distinct from the C-terminal FRB and kinase domains.
To identify the domain of the TOR1 protein required for growth
inhibition when overexpressed, a series of TOR1 and TOR1
kinase-inactive deletion mutants, which are represented schematically
in Figure 4A, were tested for
growth-inhibitory effects on galactose medium (Figure 4B). These
mutants were constructed by sequentially adding sequences back to a
large internal deletion mutant that had no effect on growth when
overexpressed (amino acids 290-1682). By this approach we identified a
region, from amino acids 1208 to 1482, that, when reintroduced into the
TOR1 deletion mutant
1207-1682, restored the growth-inhibitory
effect. Importantly, toxicity of this TOR1 mutant protein was observed
with either a wild-type or an inactive kinase domain (Figure 4B).
Western blot analysis with an HA monoclonal antibody again confirmed
that TOR1 derivatives of the expected molecular weights were stably
expressed in all cases (Figure 4C).
|
Identification of a Central Toxic Effector Domain of the TOR Proteins
Isolated HA-tagged fragments of TOR1 were expressed under the
control of the GAL1 promotor to determine which region of
TOR1 was sufficient to promote a dominant negative effect on growth when overexpressed (Figure 5A).
Overexpression of a central domain of ~570 amino acids of TOR1
containing residues 1207-1774, but not overexpression of the
C-terminal region encompassing the FRB and kinase domains (residues
1766-2340), conferred a growth-inhibitory effect when cells were grown
on galactose medium (Figure 5B). Extension of this domain by an
additional ~215 C-terminal residues resulted in an ~785-amino acid
central domain that was even more toxic to cells when overexpressed. A
schematic of the regions tested and a Western blot confirming that
proteins of the expected molecular weights are expressed are shown in
Figure 5, A and C, respectively. Overexpression of the equivalent
region of TOR2 (residues 1216-1782) also exhibited a growth-inhibitory
effect (Figure 6). Overproduction of
wild-type TOR1 suppressed the growth-inhibitory effect of
overexpressing the TOR1 or TOR2 central domains (Figure 6). These
findings indicate that overexpression of the toxic central fragment
interferes with the TOR function common to both TOR1 and TOR2
(translation). In contrast, overexpression of TOR1 did not suppress the
growth-inhibitory effect of the larger TOR2 toxic domain (Figure 6, AA
1216-1964), suggesting that this toxic TOR2 domain may also inhibit
the unique function of TOR2 in cytoskeletal polarization that TOR1
cannot provide.
|
|
All TOR1 deletion mutants and TOR1-isolated fragments constructed for
this study were tested for their ability to provide TOR1 function and
complement the conditional synthetic lethal phenotype of a tor1
srk1 deletion strain at 39°C. As summarized in Figure
7, only full-length TOR1 and the
rapamycin-resistant TOR1 mutants (S1972I or S1972R) complemented the
tor1 mutation and restored growth at 39°C. Thus, removal
of any portion of TOR1, or inactivation of the kinase domain by
mutation, results in a loss of TOR1 in vivo function. In agreement with
these results, no protein kinase activity was detected with these TOR1
mutant polypeptides and PHAS-I as a substrate in vitro (Figure 7).
|
In summary, this deletion analysis supports a model in which a region of the TOR proteins distinct from the FRB or kinase domains is involved in binding effector molecules. As a consequence, overexpression of this region has a growth-inhibitory effect by sequestering these effector molecules and preventing their productive interactions with TOR1 and TOR2. We term this central region of the TOR proteins the toxic effector domain (Figure 7).
The TOR1 Toxic Effector Domain Arrests Cells in G1
Inhibition of the yeast TOR proteins with FKBP12-rapamycin, or
depletion of both TOR1 and TOR2 proteins, results in a G1
or G0 cell cycle arrest as large unbudded cells with
dramatically enlarged vacuoles (Heitman et al., 1991
; Kunz
et al., 1993
; Cardenas and Heitman, 1995
). This specific
cell cycle-arrest point is attributable to the shared function of the
TOR1 and TOR2 proteins in regulating translation (Barbet et
al., 1996
). To ascertain whether the TOR-toxic domains might
inhibit cell growth by interfering with the role of the TOR proteins in
translation, we examined whether the toxic TOR domain imposes a similar
cell cycle arrest. Inhibition of growth by the TOR-toxic domain was
more pronounced in cells grown on solid medium compared with
liquid cultures, and we thus examined the fate of cells grown on solid medium.
Overexpression of the three different TOR1-toxic domain constructs
produced a high percentage, ~60- 80%, of unbudded cells characteristic of a G1 arrest (Table
1). Moreover, overexpression of the
larger TOR1-toxic domain, from amino acids 1207 to 1961, resulted in a
high proportion (62%) of large unbudded cells containing enlarged
vacuoles, an arrest point that is essentially indistinguishable from
the arrest point of rapamycin-treated cells or cells depleted for TOR1
and TOR2 (Table 1). In comparison, overexpression of the smaller
TOR1-toxic domains containing amino acids 1207-1774 or from amino
acids 1483 to 1682 yielded 12 and 13%, respectively, large unbudded
cells and 80% small unbudded cells (Table 1). Taken together, these
observations suggest that the TOR-toxic domain inhibits the TOR
function in translation.
|
Overexpression of Phospholipase C Suppresses Toxicity of the TOR1-Toxic Domain
The yeast TOR1 and TOR2 proteins and their mammalian counterpart
mTOR all contain a carboxy-terminal domain that shares identity with
both protein and lipid kinases. We therefore examined whether the
TOR-toxic domains might impinge on the yeast
phosphatidylinositol metabolic pathway. The yeast
tor1 mutant strain CAY6 was cotransformed with plasmids
expressing the TOR1-toxic domains from amino acids 1207 to 1961, or
from amino acids 1207 to 2340, together with plasmids overexpressing
enzymes that function in the phosphatidylinositol metabolic
pathway, including the PI-4 kinase STT4 (Yoshida et al.,
1994a
; Cutler et al., 1997
), the PI-4 phosphate 5 kinase homologue MSS4 (Yoshida et al., 1994b
), and the
phospholipase C homologue PLC1 (Flick and Thorner, 1993
; Flick, 1998
).
Interestingly, overexpression of the yeast phospholipase C homologue
PLC1 suppressed the toxic effects of the TOR1-toxic domains (Figure
8). In contrast, overexpression of STT4
or MSS4 did not suppress toxicity of the TOR1-toxic domain (Figure 8);
overexpression of either STT4 or MSS4 alone was not toxic under these
conditions (our unpublished results). Although overexpression of yeast
PLC1 suppressed the TOR1-toxic domain effects, PLC1 did not restore
viability to cells overexpressing either the full-length TOR1 kinase
dead mutant (TOR1 D2275A) or the TOR2-toxic domains (our unpublished
results). With the caveat of indirect effects due to overexpression,
these results indicate that these toxic TOR variants may inhibit cell growth by more than one pathway, only one of which is PLC1 dependent.
|
| |
DISCUSSION |
|---|
|
|
|---|
The yeast TOR1 and TOR2 proteins were first identified as the
targets of the immunosuppressive natural product rapamycin bound to the
cellular protein FKBP12. Subsequently, a mammalian
FKBP12-rapamycin-binding protein was identified that shares ~50%
sequence identity with the yeast TOR proteins. Two C-terminal domains
that are highly conserved between yeast and mammalian TOR have been
identified. The first, the FKBP12-rapamycin-binding or FRB domain, was
identified as the target for rapamycin binding to both yeast and
mammalian TOR, based on both biochemical and genetic approaches (Chen
et al., 1995
; Lorenz and Heitman, 1995
), and the x-ray
crystal structure of the FKBP12-rapamycin-FRB domain ternary complex
has been solved (Choi et al., 1996
). The second domain is
the C-terminal kinase domain that also shares identity with other
members of the PI kinase-related kinase superfamily, including
PI-3 and PI-4 kinases from yeast and man, DNA-dependent protein kinase,
and the yeast and human checkpoint control proteins MEC1, TEL1, ATM,
and ATR.
We have taken biochemical and genetic approaches to determine
the catalytic activity and to define functional domains in the yeast
TOR proteins. Our studies show that TOR1 possess a robust protein
kinase activity capable of phosphorylating PHAS-I, the only known
substrate of the mammalian TOR kinase homologue. Although we do not
detect autophosphorylation activity, the TOR1 kinase activity shares
several other hallmarks exhibited by the mammalian TOR kinase in that
the TOR1 kinase activity is enhanced by the presence of
MnCl2 ions and is inhibited by FKBP12-rapamycin and wortmannin (Brunn et al., 1996
, 1997
). TOR1 kinase activity
was also abolished by the D2275A-active site mutation and rendered resistant to rapamycin by a mutation in the FRB domain (S1972I) that
interferes with FKBP12-rapamycin binding. In contrast to the yeast
TOR2 and mammalian TOR homologues, FRAP and RAFT1, we found no PI-4
kinase activity associated with the yeast TOR1 enzyme. Taken together,
our findings reveal that yeast TOR1, like the mammalian mTOR homologue,
has protein kinase activity.
We find that the integrity of the TOR1 kinase domain is required for
TOR1 functions in yeast, and for a dominant rapamycin-resistant TOR1
mutant to confer rapamycin resistance. In addition, we find that
overexpression of a kinase-inactive TOR1 mutant is toxic to yeast
cells. These findings are in accord with observations previously
reported by Zheng et al. (1995)
. The toxicity of the overexpressed kinase-inactive TOR1 mutant could be overcome by overexpressing wild-type TOR1, illustrating that this is a specific toxic effect resulting from interference with TOR function in vivo.
Toxicity of the TOR1 kinase-inactive mutant was not inhibited by
FKBP12-rapamycin, indicating that the FRB domain is not responsible for this toxic effect. Finally, in contrast to the previous report of
Zheng et al. (1995)
, we did not observe any toxic effect
upon overexpression of two different TOR1 rapamycin-resistant mutants bearing single amino substitutions in the FRB domain. Our sequence analysis of the region rescued by gap repair in the S1972I or S1972R
mutants revealed no extraneous mutations. Thus, either subtle
differences in experimental conditions or additional mutations in the
studies of Zheng et al. must explain this discrepancy.
We proceeded to map regions of the TOR1 protein that are required for the toxic effect of the TOR1 kinase-inactive mutant. To our surprise, simply deleting the entire kinase domain, the FRB domain, or both the kinase domain and the FRB domain, resulted in C-terminally or internally truncated forms of the TOR1 protein that were also toxic when overexpressed. Thus, inactivation of the kinase activity of TOR1 by either a point mutation or a large deletion resulted in a toxic TOR1 protein, suggesting that regions of the protein other than the kinase domain itself are responsible for the toxicity of the TOR1 kinase-inactive mutant.
To map regions of the TOR1 protein responsible for this toxic effect, we took two approaches. First, a large central region of TOR1 was deleted, after which progressively larger and larger portions of the missing section were replaced. This analysis revealed that readdition of residues 290-1207 was not sufficient to render that attached kinase-inactive domain toxic, but that readdition of residues 290-1682 was sufficient to restore toxicity, implicating residues 1207-1682 in the toxic effect. In the second approach, short defined central regions of the TOR1 protein were overexpressed and tested for toxic effects. By this approach, a 567-amino acid segment of TOR1 from residue 1207 to 1774 was found to be partially toxic, and addition of another 200 C-terminal residues rendered this domain fully toxic (754 amino acids, 1207-1961). These studies therefore defined a central domain of TOR1 that, when overexpressed on its own, was toxic to the cell. Importantly, this domain is amino-terminal to, and completely distinct from, the FRB and kinase domains that have been previously defined. The same domain derived from TOR2 was also toxic when overexpressed in yeast. We term this novel TOR domain, common to the yeast TOR1 and TOR2 proteins, the toxic central effector domain.
What might be the function of this TOR effector domain? One plausible explanation for the dominant negative toxic effect observed upon overexpression of the TOR effector domain is that this domain is involved in mediating dimerization between TOR1 and itself, or between TOR1 and TOR2. However, we have been unable to find any evidence of coprecipitation between the overexpressed toxic TOR1 domain (detected with the fused HA epitope) and endogenous yeast TOR1 or TOR2 (detected with polyclonal sera against TOR1 or TOR2) (our unpublished results). We therefore propose that the TOR effector domain interacts with substrates or regulators of the TOR-dependent, rapamycin-sensitive signaling cascade. For example, the effector domain might dock substrates onto TOR for subsequent phosphorylation by the adjacent kinase domain. In this model, the TOR proteins could serve a function as a scaffold upon which to assemble other interacting proteins for appropriate interaction with the TOR kinase domain. An alternative possibility is that this domain mediates localization to membranes and competes with the endogenous TOR1 for localization.
What role does the toxic effector domain play in known TOR functions in
yeast? The TOR proteins have two defined functions in yeast. One TOR
function is essential and unique to TOR2 and involves polarization of
the yeast actin cytoskeleton though an effect of TOR2 on the
Rho-like GTPases, RHO1 and RHO2, via the exchange factor ROM2
(Schmidt et al., 1996
, 1997
). The second TOR function is
also essential but shared by both TOR1 and TOR2 and involves regulation
of translational initiation (Barbet et al., 1996
). Thus far,
no direct target of the TOR1 or TOR2 protein involved in either
function in yeast has been identified, and the only protein implicated
as a direct target of the mammalian TOR protein is PHAS-I, but the
domains with which PHAS-I interacts have not yet been identified.
Because we find that the toxic effector domain is common to both TOR1
and TOR2, and toxicity of this domain is overcome by TOR1
overexpression (which does not provide the TOR2 unique function), these
findings implicate the toxic effector domain in the translational
regulatory function common to both TOR1 and TOR2. Consistent with this
interpretation, overexpression of the most potent TOR1-toxic domain
yields a G1 cell cycle arrest that is indistinguishable
from rapamycin inhibition of TOR function or genetic depletion of yeast
TOR1 and TOR2 (Table 1). Shorter, less potent forms of the TOR-toxic
domain yield a G1 arrest, but the cells are smaller than
those observed with rapamycin, TOR depletion, or the larger TOR-toxic
domain (Table 1). One plausible hypothesis is that these forms of the
toxic domain yield a more transient cell cycle arrest from which cells
escape, reenter the cell cycle, and hence do not form the large
G1 arrested cells observed with rapamycin exposure. Taken
together, our observations support the hypothesis that overexpression
of the TOR-toxic domain interferes with the shared TOR function in the
regulation of translation.
The direct physical targets of the TOR-toxic domain remain to be
identified. We have thus far been unable to identify overexpression suppressors of the TOR1-toxic domain from screens of either 2µ genomic libraries or a GAL-regulated cDNA library. In addition, we have
not isolated any proteins interacting with the yeast TOR1-toxic domain
using the two-hybrid system. Thus, the target of the toxic domain may
have multiple subunits or may not be a protein and could be an RNA or
small molecule. The yeast phospholipase C gene PLC1 was
identified as a multicopy suppressor of growth inhibition by the
TOR-toxic domain. Interestingly, the yeast PLC1 gene was also recently identified as a multicopy suppressor of conditional lethal TOR2 mutations in yeast (Helliwell et al.,
1998
). The effects of PLC1 may be indirect, as we have failed to
observe a direct physical interaction between the TOR-toxic domain and
PLC1 in both the two-hybrid system or by coimmunoprecipation (our
unpublished results). The yeast PLC1 enzyme, like its mammalian
counterpart, is involved in phosphatidylinositol metabolic
cascades and cleaves PI-4P and PI-4,5P2 to yield the
soluble second messengers inositol diphosphate and
inositol triphosphate. Although the functions and
targets of these cascades remain to be fully elucidated, yeast plc1 mutants are viable but exhibit a number of phenotypes,
including poor growth, temperature-sensitive growth in some strain
backgrounds, sensitivity to osmotic stress, and an inability to utilize
many carbon sources (Flick and Thorner, 1993
). Given the homology of the TOR kinase domains with lipid kinases, previous studies that the
TOR proteins are associated with a lipid kinase in yeast and mammalian
cells (Brown et al., 1995
; Cardenas and Heitman, 1995
; Sabatini et al., 1995
), the fact that one downstream element
of the TOR-regulated cascade contains an essential pleckstrin homology domain (the Rho1 GTP exchange factor Rom1, which could be a target of
PI-4,5 P2) (Schmidt et al., 1997
), and recent
studies that reveal the growth factor-activated PI-3 lipid kinase may
function upstream of mTOR in mammalian cells (Gingras et
al., 1998
), our findings provide evidence for another interesting
link between TOR function and PI metabolic cascades in the regulation
of cell function. Further studies will be required to determine whether the yeast TOR proteins and PLC1 function in the same or related signaling cascades.
Similar structure-function approaches have been recently applied to
the mammalian ATM and ATR proteins, which share identity with the
C-terminal TOR kinase domain. Overexpression of fragments of the ATM
protein containing a leucine zipper motif have a dominant negative
activity in cultured mammalian cells (Morgan et al., 1997
).
This region of ATM may either inhibit endogenous ATM function or bind
to and inhibit other members of the ATM signaling pathway. Interestingly, overexpression of the ATM kinase domain alone was sufficient to complement many of the defects in atm mutant
fibroblasts, including radiosensitivity and S phase checkpoint
function, indicating that the kinase domain is responsible for much of
the activity of ATM (Morgan et al., 1997
). In related
studies, Cliby et al. (1998)
demonstrated that
overexpression of a kinase-inactive mutant of the mammalian ATR protein
caused sensitivity to ionizing radiation, methyl methanesulfonate, and
cis-platinum and also abolished the G2/M checkpoint after
DNA damage with ionizing radiation. Taken together, these studies
implicate the kinase domains of ATM and ATR in mediating cellular
responses to DNA damage and cell cycle progression.
The TOR-toxic domain is conserved between the yeast and mammalian TOR
proteins and, in BLAST searches, shares more limited identity over an
~240- amino acid region with the PIK family members ATR, RAD3,
mei-41, and ATM (Figure 9). Yeast TOR1
and mammalian ATR share 26% overall identity, and 48% similarity, in
this region. This finding suggests that the TOR-toxic domain, like the
more C-terminal kinase domain, has been conserved between different PIK
family members and might play a role in the signaling functions of
these different proteins. In general, members of the PIK-related family
have been implicated in signaling cascades that regulate responses of
the cell to exogenous signals (TOR, mTOR, PI-3 kinase) or endogenous
signals (ATR, ATM, Rad3, Mec1, Tel1). This conserved region may
interact with effectors or regulators of the TOR- and ATR-signaling
pathways. Further studies will be required to address the functions of
this domain in other PIK family members.
|
| |
ACKNOWLEDGMENTS |
|---|
We thank Shane Cutler for comments on the manuscript and assistance with protein sequence alignments; David Fiorentino, Gerry Crabtree, Jeff Flick, Yoshi Ohya, and Mike Hall for strains and plasmids; and Kevin Peters for suggestions. This work was supported by KO1 award CA-77075 from the National Cancer Institute (to M.E.C.) and RO1 award AI-41937 from NIAID (to J.H. and M.E.C.). Joseph Heitman is an associate investigator of the Howard Hughes Medical Institute.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
carde004{at}mc.duke.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Sato, A. Nakashima, L. Guo, and F. Tamanoi Specific Activation of mTORC1 by Rheb G-protein in Vitro Involves Enhanced Recruitment of Its Substrate Protein J. Biol. Chem., May 8, 2009; 284(19): 12783 - 12791. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Devasahayam, D. J. Burke, and T. W. Sturgill Golgi Manganese Transport Is Required for Rapamycin Signaling in Saccharomyces cerevisiae Genetics, September 1, 2007; 177(1): 231 - 238. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Zurita-Martinez, R. Puria, X. Pan, J. D. Boeke, and M. E. Cardenas Efficient Tor Signaling Requires a Functional Class C Vps Protein Complex in Saccharomyces cerevisiae Genetics, August 1, 2007; 176(4): 2139 - 2150. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Cameroni, C. De Virgilio, and O. Deloche Phosphatidylinositol 4-Phosphate Is Required for Translation Initiation in Saccharomyces cerevisiae J. Biol. Chem., December 15, 2006; 281(50): 38139 - 38149. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Uritani, H. Hidaka, Y. Hotta, M. Ueno, T. Ushimaru, and T. Toda Fission yeast Tor2 links nitrogen signals to cell proliferation and acts downstream of the Rheb GTPase Genes Cells, December 1, 2006; 11(12): 1367 - 1379. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Reinke, J. C.-Y. Chen, S. Aronova, and T. Powers Caffeine Targets TOR Complex I and Provides Evidence for a Regulatory Link between the FRB and Kinase Domains of Tor1p J. Biol. Chem., October 20, 2006; 281(42): 31616 - 31626. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, C. J. Billington Jr., D. Pan, and T. P. Neufeld Drosophila Target of Rapamycin Kinase Functions as a Multimer Genetics, January 1, 2006; 172(1): 355 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wullschleger, R. Loewith, W. Oppliger, and M. N. Hall Molecular Organization of Target of Rapamycin Complex 2 J. Biol. Chem., September 2, 2005; 280(35): 30697 - 30704. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Levin Cell Wall Integrity Signaling in Saccharomyces cerevisiae Microbiol. Mol. Biol. Rev., June 1, 2005; 69(2): 262 - 291. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Saiardi, A. C. Resnick, A. M. Snowman, B. Wendland, and S. H. Snyder From the Cover: Inositol pyrophosphates regulate cell death and telomere length through phosphoinositide 3-kinase-related protein kinases PNAS, February 8, 2005; 102(6): 1911 - 1914. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hui, N. Khoury, X. Zhao, L. Balkir, E. D'Amico, A. Bullotta, E. D. Nguyen, A. Gambotto, and R. Perfetti Adenovirus-Mediated XIAP Gene Transfer Reverses the Negative Effects of Immunosuppressive Drugs on Insulin Secretion and Cell Viability of Isolated Human Islets Diabetes, February 1, 2005; 54(2): 424 - 433. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Reinke, S. Anderson, J. M. McCaffery, J. Yates III, S. Aronova, S. Chu, S. Fairclough, C. Iverson, K. P. Wedaman, and T. Powers TOR Complex 1 Includes a Novel Component, Tco89p (YPL180w), and Cooperates with Ssd1p to Maintain Cellular Integrity in Saccharomyces cerevisiae J. Biol. Chem., April 9, 2004; 279(15): 14752 - 14762. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Harris and J. C. Lawrence Jr. TOR Signaling Sci. Signal., December 9, 2003; 2003(212): re15 - re15. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K.A. deHart, J. D. Schnell, D. A. Allen, J.-Y. Tsai, and L. Hicke Receptor Internalization in Yeast Requires the Tor2-Rho1 Signaling Pathway Mol. Biol. Cell, November 1, 2003; 14(11): 4676 - 4684. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Crespo and M. N. Hall Elucidating TOR Signaling and Rapamycin Action: Lessons from Saccharomyces cerevisiae Microbiol. Mol. Biol. Rev., December 1, 2002; 66(4): 579 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Torres, C. J. Di Como, E. Herrero, and M. A. de la Torre-Ruiz Regulation of the Cell Integrity Pathway by Rapamycin-sensitive TOR Function in Budding Yeast J. Biol. Chem., November 1, 2002; 277(45): 43495 - 43504. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Cruz, A. L. Goldstein, J. Blankenship, M. Del Poeta, J. R. Perfect, J. H. McCusker, Y. L. Bennani, M. E. Cardenas, and J. Heitman Rapamycin and Less Immunosuppressive Analogs Are Toxic to Candida albicans and Cryptococcus neoformans via FKBP12-Dependent Inhibition of TOR Antimicrob. Agents Chemother., November 1, 2001; 45(11): 3162 - 3170. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Albig and C. J. Decker The Target of Rapamycin Signaling Pathway Regulates mRNA Turnover in the Yeast Saccharomyces cerevisiae Mol. Biol. Cell, November 1, 2001; 12(11): 3428 - 3438. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-C. Gingras, B. Raught, and N. Sonenberg Regulation of translation initiation by FRAP/mTOR Genes & Dev., April 1, 2001; 15(7): 807 - 826. [Full Text] |
||||
![]() |
J. C. Mallory and T. D. Petes Protein kinase activity of Tel1p and Mec1p, two Saccharomyces cerevisiae proteins related to the human ATM protein kinase PNAS, November 22, 2000; (2000) 250475697. [Abstract] [Full Text] |
||||
![]() |
R. J. Kokoska, L. Stefanovic, J. DeMai, and T. D. Petes Increased Rates of Genomic Deletions Generated by Mutations in the Yeast Gene Encoding DNA Polymerase delta or by Decreases in the Cellular Levels of DNA Polymerase delta Mol. Cell. Biol., October 15, 2000; 20(20): 7490 - 7504. [Abstract] [Full Text] |
||||
![]() |
G. P. Cosentino, T. Schmelzle, A. Haghighat, S. B. Helliwell, M. N. Hall, and N. Sonenberg Eap1p, a Novel Eukaryotic Translation Initiation Factor 4E-Associated Protein in Saccharomyces cerevisiae Mol. Cell. Biol., July 1, 2000; 20(13): 4604 - 4613. [Abstract] [Full Text] |
||||
![]() |
M. E. Cardenas, N. S. Cutler, M. C. Lorenz, C. J. Di Como, and J. Heitman The TOR signaling cascade regulates gene expression in response to nutrients Genes & Dev., December 15, 1999; 13(24): 3271 - 3279. [Abstract] [Full Text] |
||||
![]() |
M. E. Cardenas, M. C. Cruz, M. Del Poeta, N. Chung, J. R. Perfect, and J. Heitman Antifungal Activities of Antineoplastic Agents: Saccharomyces cerevisiae as a Model System To Study Drug Action Clin. Microbiol. Rev., October 1, 1999; 12(4): 583 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Bertram, J. H. Choi, J. Carvalho, W. Ai, C. Zeng, T.-F. Chan, and X. F. S. Zheng Tripartite Regulation of Gln3p by TOR, Ure2p, and Phosphatases J. Biol. Chem., November 10, 2000; 275(46): 35727 - 35733. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kunz, U. Schneider, I. Howald, A. Schmidt, and M. N. Hall HEAT Repeats Mediate Plasma Membrane Localization of Tor2p in Yeast J. Biol. Chem., November 17, 2000; 275(47): 37011 - 37020. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-F. Chan, P. G. Bertram, W. Ai, and X. F. S. Zheng Regulation of APG14 Expression by the GATA-type Transcription Factor Gln3p J. Biol. Chem., February 23, 2001; 276(9): 6463 - 6467. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Carvalho, P. G. Bertram, S. R. Wente, and X. F. S. Zheng Phosphorylation Regulates the Interaction between Gln3p and the Nuclear Import Factor Srp1p J. Biol. Chem., June 29, 2001; 276(27): 25359 - 25365. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rohde, J. Heitman, and M. E. Cardenas The TOR Kinases Link Nutrient Sensing to Cell Growth J. Biol. Chem., March 23, 2001; 276(13): 9583 - 9586. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Mallory and T. D. Petes Protein kinase activity of Tel1p and Mec1p, two Saccharomyces cerevisiae proteins related to the human ATM protein kinase PNAS, December 5, 2000; 97(25): 13749 - 13754. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||