![]() |
|
|
Vol. 10, Issue 9, 3045-3059, September 1999



*Department of Molecular, Cellular, and Developmental Biology,
Porter Biosciences, University of Colorado, Boulder, Colorado
80309-0347;
Department of Molecular Biology and
Pharmacology, Washington University School of Medicine, St. Louis,
Missouri 63110; and §Department of Molecular Biology and
Genetics, Johns Hopkins School of Medicine, Baltimore, Maryland 21205
| |
ABSTRACT |
|---|
|
|
|---|
Silencing is a universal form of transcriptional regulation in which regions of the genome are reversibly inactivated by changes in chromatin structure. Sir2 (Silent Information Regulator) protein is unique among the silencing factors in Saccharomyces cerevisiae because it silences the rDNA as well as the silent mating-type loci and telomeres. Discovery of a gene family of Homologues of Sir Two (HSTs) in organisms from bacteria to humans suggests that SIR2's silencing mechanism might be conserved. The Sir2 and Hst proteins share a core domain, which includes two diagnostic sequence motifs of unknown function as well as four cysteines of a putative zinc finger. We demonstrate by mutational analyses that the conserved core and each of its motifs are essential for Sir2p silencing. Chimeras between Sir2p and a human Sir2 homologue (hSir2Ap) indicate that this human protein's core can substitute for that of Sir2p, implicating the core as a silencing domain. Immunofluorescence studies reveal partially disrupted localization, accounting for the yeast-human chimeras' ability to function at only a subset of Sir2p's target loci. Together, these results support a model for the involvement of distinct Sir2p-containing complexes in HM/telomeric and rDNA silencing and that HST family members, including the widely expressed hSir2A, may perform evolutionarily conserved functions.
| |
INTRODUCTION |
|---|
|
|
|---|
Epigenetic forms of transcriptional control regulate biological
processes as diverse as growth and differentiation, dosage compensation, sex determination, and host defense (reviewed by Russo
et al., 1996
; Henikoff and Matzke, 1997
, and references therein). Some epigenetic changes are effected by nonnuclear means, for
example, plant cosuppression and prions. More common are nuclear mechanisms, such as mammalian imprinting, Drosophila
position effect variegation, and plant paramutation. Nuclear gene
silencing involves heritable but reversible changes in gene expression
associated with structural alterations in chromatin. Gene silencing is
thus a global mechanism of transcriptional control in which large
regions of the genome are regulated in a position-dependent yet
gene-independent manner.
Sir2p is one of several factors critical for silencing at least three
loci in yeast (reviewed by Loo and Rine, 1995
; Sherman and Pillus,
1997
). Among the four SIR (Silent Information
Regulator) genes, SIR2 is unique because it is required
for silencing and suppression of recombination within the rDNA, as well
as silent mating-type (HM) and telomeric silencing (Shore
et al., 1984
; Ivy et al., 1986
; Rine and
Herskowitz, 1987
; Gottlieb and Esposito, 1989
; Aparicio et
al., 1991
; Bryk et al., 1997
; Fritze and Esposito, 1997
; Smith and Boeke, 1997
; Smith et al., 1998
). A
sir2
mutant strain exhibits complete derepression at
these loci. Derepression has been correlated with increased
accessibility to DNA-modifying enzymes and psoralen, indicating that
these loci have a more relaxed chromatin structure in the absence of
Sir2p (Nasmyth, 1982
; Gottschling, 1992
; Singh and Klar, 1992
; Loo and
Rine, 1994
; Fritze and Esposito, 1997
; Smith and Boeke, 1997
; Smith
et al., 1998
).
Consistent with the direct involvement of Sir2p in maintaining
silencing-competent chromatin structure, Sir2p localizes to the
HM loci, to telomeres and to the rDNA within the nucleolus (Hecht et al., 1996
; Gotta et al., 1997
;
Strahl-Bolsinger et al., 1997
). Sir2p interacts with
itself as well as with Sir3p and Sir4p (Moazed and Johnson, 1996
;
Holmes et al., 1997
; Moazed et al., 1997
;
Strahl-Bolsinger et al., 1997
), which in turn interact
with the histones H3 and H4 at the HM loci and telomeres
(Hecht et al., 1995
, 1996
). In addition, Sir2p also
interacts with ubiquitination factors and/or complexes (Moazed and
Johnson, 1996
), and mutants in SIR2 and UBC2
(Ubiquitin-Conjugating factor 2) have similar rDNA silencing
phenotypes (Bryk et al., 1997
). A potential mechanism for
the function of Sir2p in silencing has been suggested by the observation that SIR2 overexpression is correlated with
hypoacetylation of a subset of histones (Braunstein et al.,
1993
). Hypoacetylated histones are often found at silenced or inactive
loci in yeast and other organisms (Lin et al., 1989
; Turner
et al., 1992
; Braunstein et al., 1993
, 1996
;
Jeppesen and Turner, 1993
; O'Neill and Turner, 1995
). However,
SIR2's potential role in modulating histone deacetylation may be indirect as histone deacetylase activity has not been detected for Sir2p in vitro (Braunstein et al., 1993
). These
interactions thus define a role for SIR2 in silencing
complexes that may be subject to and/or participate in multiple forms
of regulation.
We and others discovered and characterized an evolutionarily conserved
family of Homologue of Sir Two (HST) genes (Chen
and Clark-Walker, 1994
; Brachmann et al., 1995
;
Derbyshire et al., 1996
; Yahiaoui et al.,
1996
; Tsang and Escalante-Semerena, 1998
). The proteins encoded by
the HSTs (Hst proteins) are ~30-65% identical to Sir2p
overall (Figure 1A). The Hst family is
characterized by a conserved core domain, which is up to 84% identical
to Sir2p and contains three motifs (Figure 1B). Two sequence motifs of unknown function are termed here the GAG and NID motifs to mark the
beginning and end, respectively, of more extended sequences described in Figure 1. The third motif consists of four absolutely conserved cysteines that form a putative zinc finger, which may specify
either protein- protein or protein-nucleic acid interactions. Alternatively, the cysteines may participate in disulfide bond formation and thus protein folding or catalysis.
|
Sir2p and its homologues can be divided into three subfamilies based on
the length and sequence of their N and C termini (Figure 1A) (Brachmann
et al., 1995
). Sir2p is grouped with its closest relative,
Hst1p from Saccharomyces cerevisiae, as well as with homologues from another budding yeast Kluyveromyces lactis
(Chen and Clark-Walker, 1994
) and from the pathogenic filamentous yeast Candida albicans (Perez-Martin et al., 1999
). In
the second subfamily, there are two members from S. cerevisiae, Hst3p and Hst4p. The third subfamily is the largest
and includes many of the Hst proteins from other organisms, along with
a single S. cerevisiae protein, Hst2p. Homologues of
SIR2 have been identified in bacteria, including Archaebacteria, protozoa, nematodes, plants, and mammals. Evolutionary conservation of the Hst and Sir2 proteins between all of the biological kingdoms suggests that they share an important function, possibly in
chromatin organization. Like SIR2, members from two of three HST subfamilies have been implicated in silencing in
S. cerevisiae. Overexpression of HST1 partially
suppresses sir2
mating and HM silencing
defects, but not those in telomeric silencing, rDNA silencing, or rDNA
recombination (Brachmann et al., 1995
; Derbyshire et
al., 1996
; Sherman, unpublished results). This indicates that HST1 encodes a protein capable of silencing, but which may
function primarily at a different locus. An hst3
hst4
double mutant exhibits telomeric silencing defects, as well as
temperature-sensitive growth, cell cycle arrest, and chromosomal
instability (Brachmann et al., 1995
). The involvement of
several of the HSTs in silencing has led to the hypothesis
that they silence as yet unidentified loci in yeast and other organisms
(Brachmann et al., 1995
; Sherman and Pillus, 1997
).
To determine whether the conserved core is a silencing domain and whether the Hst proteins from other organisms are likely to be silencing factors, we performed a structure-function analysis of Sir2p and expression studies with a human Hst protein in yeast. We demonstrate by deletion and point mutational analyses that the conserved core domain and its motifs are essential for Sir2p silencing. This is in contrast to the nonconserved N-terminal 79 amino acids of Sir2p, which we observe are dispensable for function. Complementation and dominance studies of chimeras between SIR2 and a human homologue of SIR2 (hSIR2A) suggest that the core is an evolutionarily conserved silencing domain and that SIR-like silencing mechanisms may function in human gene regulation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Strains, Media, and Transformations
Genotypes of yeast strains are listed in Table
1 and are derived from the W303 (Thomas
and Rothstein, 1989
), YPH499 to 501 (Sikorski and Hieter, 1989
), and
FY2 (Winston et al., 1995
) backgrounds. The
sir2/sir2 homozygous diploid strain LPY3380 was
constructed to facilitate immunofluorescence experiments, because the
diploid nucleus is larger than the haploid nucleus. This strain
maintains a haploid-specific program of gene expression, because it is
also homozygous for MATa and
hml
::TRP1, to avoid any potential changes in Sir2p localization from haploids to diploids. The
sir2
::HIS3 deletion (kindly provided
by J. Rine, University of California, Berkeley, CA) was made by
PCR-directed mutagenesis. Yeast were grown at 30°C under standard
conditions (Rose et al., 1989
).
|
Plasmids and SIR2/HST Mutagenesis
The sequences of the oligonucleotide primers (5'-3') used
in these studies are listed. Small letters indicate that the nucleotide is different from that of wild-type, and three slashes (///) denote deleted sequence or the junction between yeast and human sequence. Restriction sites used for cloning and/or introduced by the
primer are underlined: SIR2-ATG(Jxn), ATCGCTTCGGTAGACAC; SIR2-StuI(Jxn), TGATAT-CTGGTTTGAGAACG;
SIR2-ATG, CATCCAGCTTTAATGTGCCG; sir2
BN-NcoI,
GACTTCAGATCT///CATGGCTCTTTTGCTACTGCC; sir2-CA5', GCTACTGCCACCgcCGTTACCgcCCATTGGAACCTAC-CCGGgGAGAGGATATTTAAT;
sir2-CA3', CTCTTCTTTTTTTGTAAgcGTACGGGgcTAGTGGAAGcTCGAGGTTTCTA;
sir2-HIII-SEI, G-AAGGAACCAaGcTTACGATTTC;
sir2-NotI,
GCGTATTTCATATGgc-GGccGcTCATCCAGCT; hsir2A-BglII,
AGGAATTCCCGACTTTaGaT-CTCCATCCAC;
hsir2A-NcoI,
GTAGAAGGTGCCaTGgGCCTCCAC-CA; hsir2A-NotI,
GGAGAAGCAGACATGGACTgCggcCGcAACT-TATTCTC; and
hsir2A-NruI, GATATCTTCGCGAA///TACAGGAGA-AGAAACG.
Plasmids were constructed using standard techniques (Sambrook et
al., 1989
) and sequenced as appropriate. A number of
SIR2+-containing plasmids were constructed
by blunting a 2.7-kb BstNI fragment containing wild-type
SIR2 and subcloning it into the SmaI site of
YEp351 and YEp352 (Hill et al., 1986
) (pLP349-350 and
pLP318, respectively) and pKS+ (Stratagene, La
Jolla, CA) (pLP319). To construct the
sir2-
CORE clone (pLP387) in which aa 245-427
are deleted
(FFTI244P428PYIL), pLP349
DNA was digested with BclI and StuI, blunted, and
recircularized. The sir2-
GAG clone in which aa
245-273 are deleted and an F274D mutation is introduced
(FFTI244D274RSSE) and the
sir2-
CYS clone in which aa 364-427 are
deleted (LVQC363P428PYIL)
were similarly constructed. pLP349 DNA was digested with either
BclI and BglII or NcoI and
StuI, blunted, and religated to produce pLP385
(sir2-
GAG) and pLP386
(sir2-
CYS), respectively. Construction of the
sir2-
NID and cysteine point mutant clones
required PCR mutagenesis using either pLP349 or pLP319. To delete aa
277-363 (DFRS276H364FAT) and construct pLP656, primer sir2
BN-NcoI was
used in combination with the sir2-HIII-SEI primer to amplify
an ~390-bp PCR fragment. This fragment was digested with
BglII and StuI, and the resulting ~200-bp
fragment was cloned into pLP349 from which the wild-type ~460-bp
BglII-StuI fragment had been deleted. The
cysteine to alanine point mutant clones
sir2-A372A374 . . C396C398
(pLP531), sir2-C372C374 . . A396A398
(pLP555), and
sir2-A372A374 . . A396A398 (pLP570) were made by multiple rounds of a three-step PCR method. In
PCR I, the SIR2-ATG(Jxn) primer was used with the
sir2-CA3' primer, which mutates the second pair of
cysteines, to amplify an ~1.3-kb fragment of SIR2. In PCR
II, the M13 (reverse) primer was used with sir2-CA5', which
mutates the first pair of cysteines. In PCR III, the products of PCRs I
and II were used as templates for amplification with the
SIR2-ATG(Jxn) primer and the internal SIR2-StuI(Jxn). The ~1.4-kb product was
digested with NcoI and StuI, and the resulting
~190-bp fragment was cloned into pLP349 from which this piece of DNA
had been removed to make pLP531 and pLP555. These clones were then used
as templates for repetitions of PCRs I and II, respectively, followed
by an additional PCR III step with the PCR I and II products as
templates. Once again, the NcoI-StuI PCR
mutagenized fragment replaced the wild-type SIR2 sequence in
pLP349 to make the quadruple mutant clone
sir2-A372A374 . . A396A398
(pLP570). To make the SIR2-hSIR2A(NID) chimera,
the hSIR2A expressed sequence tag T66100 (pCAR258)
was PCR mutagenized using the hsir2A-BglII and
hsir2A-NcoI primers. The BglII and NcoI sites created were used to clone the ~270-bp
core-containing hSIR2A fragment into the SIR2
backbone. The sequence of the resulting chimera on YEp351 (pLP999) was
Sir2p - - PDFR275(S61PST - - - LVEA149)H364GSF - - Sir2p.
Construction of the SIR2-HST3(NID) chimera
(pLP745)
[Sir2p - - PDFR275(S74SDG - - - VVQL186)H364GSF - - Sir2p
in which an F186L change was also made] was similar (our unpublished
results). Likewise, PCR mutagenesis of the hSIR2A gene on
pCAR258 with the hsir2A-BglII and
hsir2A-NruI primers was used to make the
necessary restriction enzyme sites to create the
SIR2-hSIR2A(NID + CYS) chimera
(Sir2p - - PDFR275(S61PST - - - FFSC209)I457RED - - Sir2p)
on YEp351 (pLP905). An ~350-bp BglII fragment and an
~110-bp BglII-NruI fragment were cloned into
the BglII-NruI SIR2 backbone. The
CEN-SIR2-hSIR2A(NID) and CEN-SIR2-hSIR2A(NID+CYS) clones were made by
digesting pLP999 and pLP905 with EcoRI and SalI,
blunting, and cloning this ~2.7-kb fragment into the SmaI
site of pRS315 (Sikorski and Hieter, 1989
) to create pLP1022 and
pLP888, respectively. The CEN-SIR2+ clone
was constructed starting with a CEN-sir2-
CORE
construct (pLP416). pLP416 was made by isolating the PvuII
fragment (~2.5-kb) containing sir2-
CORE as
well as the polylinker sites from pLP387 (described above) and
subcloning it into the PvuII sites of pRS315. The ~740-bp
NdeI fragment from pLP416 was then replaced with the ~1.3-kb SIR2+ NdeI fragment to
create pLP907. To create sir2-
N (pLP411) in which aa 2-79 are deleted
(M1E80LK), the fragment of
SIR2 from the promoter through the ATG was generated by PCR
amplifying an ~270-bp fragment of SIR2 from pLP319 using
the T7 and SIR2-ATG primers. The PCR product was digested
with EcoRI to leave an EcoRI site at the 5' end
and a blunt ATG at the 3' end of the coding strand. The fragment
encoding aa 80-458 of Sir2p was obtained by isolating an ~1.1-kb
ClaI-NruI fragment of SIR2 and
blunting the ClaI site. The EcoRI-ATG PCR product
and blunt-ended ClaI-NruI fragment were then
cloned into the polylinker EcoRI site and SIR2 NruI site in pLP318 replacing the ~1.6-kb wild-type fragment to create pLP383. The ~2.7-kb PvuII fragment from pLP383 was
subsequently subcloned onto the high-copy LEU2 vector YEp351 to make
pLP411. To construct hSIR2A cloned behind the
SIR2 promoter, SIR2 was first modified to create
a NotI site just downstream of the initiator ATG by a
three-step PCR mutagenesis protocol. SIR2 was amplified from
pLP319 using the T7 and sir2-NotI (PCR I) and T3
and SIR2-ATG(Jxn) primers (PCR II). The products of PCRs I
and II (~0.2 and 2.5 kb, respectively) were used as templates for
amplification with the T7 and T3 primers in PCR III. The ~2.7-kb
product of PCR III was subsequently digested with PstI and
BglII, and the resulting ~1.1-kb fragment was cloned into
these sites in pLP349 to create the SIR2-NotI
clone, pLP1015. Creation of the NotI site in SIR2 led to a change in the N-terminal sequence of Sir2p from
M1TIPH to M1SGAH. Genes,
like hSIR2A, inserted in frame via the NotI site
behind the SIR2 promoter contain the
M1S2 sequence from modified Sir2p. An additional step was required before cloning hSIR2A
behind the SIR2 promoter using the NotI site. A
NotI site at the 3' end of the hSIR2A gene had to
be eliminated by isolating an ~1.8-kb HindIII-NotI fragment containing
hSIR2A from pCAR258, blunting, and cloning it into the
SmaI site of YEp351. Both orientations of this clone were
obtained (pLP659 and pLP660). The ~630-bp
PstI-BglII fragment from pLP660 (in which the 5'
end of the gene is on the side of the HindIII site) was
replaced with the ~1.1-kb PstI-BglII fragment
from pLP1015 containing the SIR2 promoter and
NotI site as well as additional SIR2 sequence
(pLP997). pLP659 was used as the template for PCR mutagenesis with the
hsir2A-NotI and M13 (forward) primers to create
an ~1.7-kb product with a NotI site in the N-terminal
coding region of hSIR2A. The creation of this NotI site changed the sequence of the N terminus of the
hSir2Ap from M1DFLR to
M1DCGR. The PCR product was digested with
NotI and BglII, and this ~510-bp fragment was
used to replace the ~810-bp of SIR2 sequence in pLP997 to
construct the SIR2
(promoter)-NotI-hSIR2A clone (pLP1024). The
resulting N-terminal sequence of the hSir2A protein expressed from the
SIR2 promoter is M1SGR instead of
M1DFLR. To monitor expression of hSir2Ap, triple
hemagglutinin (HA) and protein A tags were inserted in frame as
NotI fragments. To test the effects of hSIR2A
overexpression, a GAL-hSIR2A construct was made.
An ~700-bp BamHI-EagI fragment containing the
GAL10 promoter followed by codons for an initiator
methionine and an asparagine at position 2 and then a NotI
site was subcloned from pLP748 (Freeman-Cook et al.,
1999
) into pRS315 to make pLP1036. The ~1.8-kb EagI
fragment containing the modified hSIR2A gene from pLP1024
was subsequently cloned into the EagI site in pLP1036 to
create the GAL-hSIR2A construct pLP1062. The N
terminus of the hSir2A protein in this case is
M1NGR. Expression of the subcloned genes was
confirmed by immunoblot analysis of cell extracts prepared
from transformants of sir2
strains and probed with
appropriate antisera (see below).
Silencing Assays
For mating and HM silencing assays, cultures of
LPY1953, 1403, 3923, and 253 transformants were grown overnight in
selective medium, diluted to a starting
A600 of 1.0 (~107 cells) for spotting assays (see Figure 3)
and 3.0 (see Figures 2B and 4, B and C)
or 4.0 (see Figure 6A) for dilution assays. It should be noted that a
fundamental difference between the mating and HM silencing
assays is that mating complementation requires repression be maintained
only long enough for a single mating event to occur, whereas repression
of the reporters must be continuous to restore a
Trp
phenotype. For telomeric and rDNA silencing
assays, the protocol was derived from that of Gottschling et
al. (1990)
. Transformants were grown for 3-4 d and diluted to a
starting A600 of 1.0 for spotting
assays (Figure 3) and 2.5 (see Figures 2C and 4D), 4.0 (see Figure 6B),
or 5.0 (see Figures 2D, 4E, and 6C) for dilution assays. Different
starting densities were used to enhance detection of differences in the
individual assays. In the dilution assays, the cultures were then
serially diluted four- or fivefold depending on the dynamic range
required for the experiment, and the dilutions were stamped using a pin
replicator onto the appropriate tester plates (see figure legends). For
analysis of hSIR2A cloned under control of the
SIR2 and GAL10 promoters, overnight cultures were grown first in glucose leu
and then in
raffinose leu
and finally diluted into
galactose leu
for either an overnight (mating
and HM silencing) or 3- to 4-d growth period (telomeric and
rDNA silencing) as described above.
|
Immunoblot Analysis
Protein extracts were prepared from yeast cells using glass bead
disruption according to the protocol of Rose et al. (1989)
. The equivalent of 1 A600 unit of each
protein extract was boiled and separated on a 7.5-10%
SDS-polyacrylamide gel. The proteins were then transferred in Towbin
buffer containing 15% methanol to 0.2 µm nitrocellulose and
processed using standard procedures (Harlow and Lane, 1988
). The
primary antibodies included a 1:5000 dilution of an antiserum directed
against a C-terminal peptide of Sir2p (Figure 2E and our unpublished
results) (Smith et al., 1998
), a 1:5000 dilution of an
anti-HA12CA5-E antiserum (Babco, Richmond, CA), and a
1:104 dilution of rabbit immunoglobulin G (Sigma,
St. Louis, MO).
Viability Assays
Overnight cultures of LPY1683 transformed with vector alone
(YEp351) or containing SIR2+ (pLP349) or
with the GAL-hSIR2A construct (pLP1062) were
grown in glucose leu
medium, then raffinose
leu
, and finally galactose
leu- medium before diluting them into galactose
leu
. Growth rate was monitored by measuring
A600. The expected cell number (based
on the A600 reading) was compared with
the actual cell number analyzed by hemocytometer counting, as well as
to colony-forming units. Glucose leu
plates
were chosen to increase growth rate and colony size. The colony-forming
units reported thus represent a theoretical maximum for the
GAL-hSIR2A transformants, because using glucose
as a carbon source represses further hSIR2A expression.
Northern Analysis
Multiple-tissue Northern blot membranes were obtained from Clontech Laboratories (Palo Alto, CA) and hybridized at 68°C following the ExpressHyb hybridization protocol provided. The entire insert from expressed sequence tag T66100 (pCAR258) was used as a probe. An actin probe was used to confirm that the same relative amounts of mRNA were loaded in each lane.
Immunofluorescence Microscopy
Immunofluorescence experiments were performed as described
(Gotta et al., 1997
), with modifications (Ersfeld and Stone,
1999
). Low-copy plasmids containing wild-type SIR2 (pLP907)
or SIR2-hSIR2A(NID + CYS) (pLP888) were used to
avoid the mislocalization previously observed when Sir proteins are
overexpressed (for example, see Maillet et al., 1996
) in
which Sir3p and Sir4p overexpression is observed to result in dispersed
nuclear staining of the Sir proteins). The phenotype of the
Sir2-hSir2A(NID + CYS) chimera expressed from low-copy plasmid is
similar to that observed for high-copy plasmid (our unpublished
results). The SIR2+ and
SIR2-hSIR2A(NID + CYS) plasmids were introduced
into the sir2/sir2 homozygous diploid strain
LPY3380, and localization was examined. Antisera directed against Sir2p
(Smith et al., 1998
) and Nop1p (kindly provided by J. Aris,
University of Florida, Gainesville, FL; Aris and Blobel, 1988
) have
been described. Secondary antibodies used were fluorescein-conjugated
goat anti-rabbit and Texas Red goat anti-mouse immunoglobulin G
(Jackson ImmunoResearch, West Grove, PA). DNA was stained with DAPI at
1 µg/ml. Microscopy was performed with a Leica (Nussloch, Germany)
DMRXA microscope with a Cooke SensiCam charge-coupled device camera,
and images were captured and manipulated using the SlideBook software
package (Intelligent Imaging Innovations, Denver, CO).
| |
RESULTS |
|---|
|
|
|---|
The Core of Sir2p Is Essential for Silencing
To determine whether the conserved core is important for
SIR2 function, we deleted sequences encoding aa 245-427 to
generate sir2-
CORE, which was then tested for
its ability to complement sir2
mating, HM,
telomeric, and rDNA silencing defects. In these experiments,
MATa and MAT
sir2
mutant yeast strains marked with reporter genes at the HM
loci (LPY1403), telomeres (LPY1953), and within the rDNA (LPY2447) were
transformed with various plasmids. The plasmids contained no
SIR2 gene (vector), wild-type SIR2
(SIR2+), or
sir2-
CORE. Modestly increased expression from
high-copy plasmids under control of the endogenous SIR2
promoter was chosen to increase the likelihood of detecting silencing
function for the mutant protein (Brachmann et al., 1995
;
Smith et al., 1998
). Dilution assays (see MATERIALS AND
METHODS) were used to assess growth and complementation of the
sir2
silencing defects.
Although all of the sir2-
CORE-containing
strains grew equivalently to the vector and SIR2 wild-type
controls, the core deletion mutant was unable to complement any of the
sir2
mutant silencing phenotypes (Figure
2, B-D). The
sir2-
CORE mutant failed to restore silencing
at HML in a sir2
strain containing a
TRP1 reporter (Figure 2B). The
sir2-
CORE mutant transformant remained
derepressed and thus able to grow on selective medium lacking
tryptophan, analogous to the vector transformant. This is in contrast
to the SIR2+-transformed strain, which was
unable to grow because the TRP1 reporter is silenced.
Moreover, both MATa and MAT
sir2
mutant strains (LPY1953 and 1403) transformed with
the sir2-
CORE construct did not mate. Thus,
the core sequences are essential for Sir2p silencing function at the
HM loci.
The inability of the sir2-
CORE mutant to
function in silencing was not limited to the HM loci. It was
also unable to silence a telomeric URA3 reporter in a
sir2
mutant background (Figure 2C). This strain carrying
the sir2-
CORE mutant construct (or the vector
control) was unable to grow on medium containing 5-fluoro-orotic acid
(5-FOA), a suicide substrate for the URA3 gene
product, because URA3 is expressed. Likewise, the
sir2-
CORE mutant did not silence a
URA3 reporter integrated in the rDNA array in a
sir2
mutant background (Figure 2D). The
sir2-
CORE mutant transformants grew on medium
lacking uracil, whereas the wild-type SIR2 transformants grew poorly because of restored rDNA silencing. In fact, the
sir2-
CORE mutant transformants grew slightly better and
thus were slightly more URA+ than the
vector transformants, suggesting that the core deletion mutant
exacerbates the sir2
rDNA silencing defect. The failure of the sir2-
CORE mutant to function in silencing is
not due to protein instability, because immunoblot analysis
indicated that the sir2-
CORE mutant protein was expressed at least
as well as wild-type Sir2p (Figure 2E). Thus, the conserved core of
Sir2p is absolutely essential for its function in HM,
telomeric, and rDNA silencing, suggesting that it is an important
functional domain.
The main difference between Sir2p, which silences all three loci, and
Hst1p, which can only partially silence HMR (Brachmann et al., 1995
), is the length and sequence of their N
termini. Sir2p has an N-terminal extension of ~35 amino acids and is
<15% identical to Hst1p over the next 75 amino acids. This led us to ask whether the N-terminus of Sir2p is important for its ability to
silence genes at the HM loci, telomeres, and rDNA. In
contrast to the complete loss of function observed when the core domain was deleted, deletion of 78 amino acids from the nonconserved N
terminus of Sir2p did not affect its silencing function (Figure 2,
B-D). The N-terminal deletion mutant (sir2-
N)
was able to complement the sir2
mating, HM,
telomeric, and rDNA silencing defects as well as wild-type
SIR2 on both high and low copy plasmids (Figure 2B-D and our
unpublished results). Thus, this nonconserved N-terminal region
encompassing the first 79 amino acids of Sir2p is dispensable for
mating-type silencing and does not promote the telomeric and rDNA
silencing functions of SIR2 that are absent in
HST1 (reviewed by Sherman and Pillus, 1997
).
Sir2p Silencing Requires Conserved Sequence Motifs
We demonstrated that the core domain is required for the
transcriptional silencing functions of SIR2. To test whether
the three motifs found in the core are individually necessary for silencing, sequences encoding smaller regions containing each of these
motifs were deleted (Figure 2A). Amino acids 244-272, which include
the GAG motif, were deleted to construct the mutant denoted hereafter
sir2-
GAG. Similarly, the NID motif was removed with a deletion of aa 275-364 to create
sir2-
NID, and the cysteines were deleted along
with aa 364-428 to yield the mutant designated sir2-
CYS (Figures 1B and 2A). The ability of
these mutants on high-copy plasmids to complement the
sir2
mating, HM, telomeric, and rDNA silencing
defects was tested by dilution assays. Deletion of regions containing
the conserved motifs did not affect growth but did lead to loss of
silencing function. At HML, the
sir2-
GAG, sir2-
NID,
and sir2-
CYS mutant constructs were unable to
complement the sir2
silencing defect of the
TRP1 reporter (Figure 2B), despite being expressed at levels
comparable with wild-type Sir2p (our unpublished results).
Interestingly, the full core and smaller deletions were equally
nonfunctional, resulting in a fully Trp+
phenotype and indicating that deletion of any one motif leads to a
complete loss of function at the HM loci. The deletion
mutants were similarly nonfunctional in telomeric and rDNA silencing. Thus, the regions containing these conserved motifs are individually essential for SIR2 function.
Because the sir2-
CYS mutant, which lacks the
region of Sir2p containing the putative zinc finger, is nonfunctional,
we asked whether it is the region or the cysteines themselves that are necessary for SIR2 silencing. Therefore, the four cysteines
at positions 372, 374, 396, and 398 were changed to alanines (Figure 1)
pairwise (cysteine 1 and 2 and cysteine 3 and 4) and together (cysteines 1-4) and assayed as described (Figure
3). Like the deletion mutants, none of
the point mutant combinations complemented the sir2
HM,
telomeric, or rDNA silencing defects (Figure 3), and each exhibited
complete loss of function in dilution assays. These mutants are,
however, expressed to wild-type levels. Thus, the four cysteines and
the intermolecular interactions they may specify are required for
SIR2 silencing function.
|
Sir2-hSIR2A Chimeras Promote HM Silencing
Our mutational analysis demonstrated that the core and its motifs
were clearly essential for silencing by Sir2p. To learn more about the
corresponding regions in other Hst proteins, we asked whether the core
has a similar role in the other HST subfamilies (Figure 1)
and whether this function is evolutionarily conserved. A series of
chimeras between SIR2 and yeast HST3 or human
SIR2A were constructed. Sequences encoding the most
conserved region of the core from within the GAG motif to just
C-terminal of the NID motif from HST3 or hSIR2A
were exchanged for the equivalent segment of SIR2. These
chimeras were then assayed for complementation of sir2
silencing defects.
The SIR2-HST3 chimera was made by replacing the
fragment of SIR2 encoding aa 276-373 with that of
HST3 encoding aa 74-186 (Figure 1B). This
SIR2-HST3 chimera, despite wild-type levels of
expression, did not complement any of the sir2
silencing
defects (our unpublished results). This may be due to an additional 25 amino acids found in this region of the Hst3p core (Figure 1B). Interestingly, this chimera also failed to supply HST3
function. Although stably expressed, it did not complement the
hst3
hst4
temperature-sensitive phenotype or telomeric
silencing defects (our unpublished results). Thus, regions outside the
core domain of Hst3p appear important for its function.
The SIR2-hSIR2A chimeras, unlike the
SIR2-HST3 chimera, were able to function in yeast
silencing. SIR2-hSIR2A(NID) was constructed by
again replacing aa 276-373 of Sir2p, this time with aa 61-149 of
hSir2Ap (Figures 1B and 4A). Despite being only 36% identical to Sir2p
in this region, the SIR2-hSIR2A(NID) chimera
rescued the sir2
mating defect in both MAT
(Figure 4B) and
MATa strains (our unpublished results). In fact,
it silenced the mating-type information at the HM loci to
wild-type levels in mating assays. Additionally, it partially silenced
the TRP1 reporter genes at HMR (Figure 4C) and
HML (our unpublished results). Although the SIR2-hSIR2A(NID) chimera functioned well at the
HM loci, it could not silence a telomeric URA3
reporter (Figure 4D). At the rDNA, SIR2-hSIR2A(NID) had, at most, a modest
repressive effect on the URA3 reporter; ~25% of the
transformants tested exhibited weak silencing, whereas others, like the
isolate shown, exhibited slightly decreased silencing compared with the
vector control.
|
Similar results were obtained with a larger
SIR2-hSIR2A chimera
[SIR2-hSIR2A(NID+CYS)] that extends from within
the GAG motif to just C-terminal of the four cysteines (Figures 1B and
4A). This chimera was constructed by exchanging the region of
hSIR2A encoding aa 61-209 for that of SIR2
encoding aa 276-456. Almost 30% of the sequence of this chimera is
therefore derived from the human Sir2A protein, and the cysteines,
although conserved, are spaced differently. Nevertheless, the
SIR2-hSIR2A(NID+CYS) chimera restored
HM silencing to near wild-type levels in sir2
strains (Figure 4, B and C). And, like the smaller human chimera, this
chimeric protein was unable to function in telomeric or rDNA silencing
(Figure 4, D and E). Thus, both Sir2-hSir2A chimeras function well in
silencing at HM loci but poorly or not at all at telomeres
and in the rDNA, thereby exhibiting distinct locus specificity.
hSIR2A Cannot Substitute for SIR2 Silencing Function
The silencing function of the human Sir2A core led us to explore
the expression pattern of hSIR2A. We hybridized human tissue Northern blots with a hSIR2A probe. An ~2.0-kb
transcript, consistent with the predicted size of the hSIR2A
transcript, was readily detected in all tissue types examined (Figure
5). However, the abundance varied between
tissues, with the highest amounts of this transcript found in skeletal
muscle, heart, and brain and the lowest in liver, lung, and kidney.
Interestingly, two transcripts were detected in pancreatic tissue. The
significance of this observation has yet to be determined.
|
Thus, hSIR2A is widely expressed in human tissues, and the
core of hSir2Ap provides silencing function in the context of the N and
C termini of Sir2p (Figure 4, B and C). But, can the presumably full-length hSir2A protein function in yeast silencing on its own? To
test this, we designed two constructs. In the first, hSIR2A was cloned behind the endogenous SIR2 promoter on a
high-copy plasmid and tagged with HA or protein A to monitor
expression. In the second construct, hSIR2A was cloned
behind the GAL10 promoter to examine the effect of high
levels of overexpression in yeast. The ability of hSIR2A to
rescue the sir2
mating, telomeric, and/or rDNA silencing
defects was assayed as above, except that for the GAL-hSIR2A
construct, galactose-induced cells were compared on selective plates
with galactose (to maintain high expression levels) or glucose (to
repress further expression) as the carbon source.
Unlike the SIR2-hSIR2A chimeras, neither the
untagged nor tagged versions of hSIR2A cloned behind the
SIR2 promoter rescued any of the sir2
silencing defects (Table 2). This lack of
function was not due to protein instability, because both the HA- and
protein A-tagged versions of hSIR2A gave strong signals on
immunoblots (our unpublished results). Nor is failure to
function simply a matter of dosage, because hSIR2A expressed
from the GAL10 promoter is likewise nonfunctional (Table 2).
The hSir2A protein is likely expressed to even higher levels from the
GAL promoter, because the GAL-hSIR2A
but not the SIR2 promoter-hSIR2A is toxic to
yeast. We observed that strains containing the GAL-hSIR2A
construct exhibited reduced growth compared with control cultures upon
diluting and plating equivalent amounts of saturated GAL-induced
cultures. Analysis of growth rates under inducing conditions indicated
that overexpression of hSir2Ap results in an approximately twofold increase in doubling time and a greater than threefold loss in viability when equivalent numbers of cells were plated on selective plates (Table 3). The loss of viability
observed with GAL-SIR2 (Holmes et al., 1997
), is
similar in magnitude to the effect we measured for
GAL-hSIR2A overexpression. This suggests that the properties
of SIR2, which, upon overexpression, lead to increased chromosome loss and thus cell death (Holmes et al., 1997
),
may be shared by hSIR2A.
|
|
Sir2-hSIR2A Chimeras Dominantly Interfere with Silencing
The ability of the SIR2-hSIR2A chimeras to
complement sir2
HM silencing defects suggests that the
function of the hSir2A core domain is at least partially conserved.
Additional evidence for conserved function of the core and, thus, of
hSIR2A comes from dominance analyses of the chimeras. High-
and low-copy plasmids were transformed into strains analogous to those
used above (Figure 4), except that they were wild type for
SIR2. The effects of these constructs on silencing in the
presence of SIR2+ were quantitated by
dilution assays to monitor growth and silencing of reporters in the
presence of 5-FOA or in the absence of tryptophan or uracil (see above).
In contrast to similarly expressed wild-type SIR2 or the
SIR2-HST3 chimera, both of the
SIR2-hSIR2A chimeras caused a paradoxical dominant derepression phenotype. However, they did so only at the
HM loci and telomeres. The SIR2-hSIR2A
chimeras caused partial derepression of HM and complete
derepression of telomeric reporters (Figure
6, A and B, and our unpublished results).
That is, an intermediate Trp+ phenotype was
observed in SIR2-hSIR2A(NID) transformants of the SIR2+ hml::TRP1
strain. (See for comparison the complete derepression of this reporter
in a sir2
background in Figure 2B.) However, the
derepression of the telomeric URA3 marker in the
SIR2+ TEL::URA3 strain
was total; these transformants were fully Ura+
and did not grow on medium containing 5-FOA. This effect was not dosage
dependent, because the SIR2-hSIR2A chimeras on
low-copy plasmids also dominantly derepressed these loci (our
unpublished results) and was not due to simple loss of function,
because the sir2-
NID mutant did not interfere with
silencing (our unpublished results). Furthermore, the chimeras
derepressed a telomeric ADE2 reporter (our unpublished
results) in addition to TEL::URA3
(Figure 6B), indicating that the observed telomeric dominance is locus and not gene or promoter specific. This interpretation is supported by
the observation that the SIR2-hSIR2A chimeras did
not dominantly derepress the URA3 gene located in the rDNA
(Figure 6C). Instead, in the presence of wild-type SIR2, the
SIR2-hSIR2A(NID) chimera slightly improved rDNA
silencing, a dosage effect similar to that observed for increased
expression of SIR2+ (Figure 6C; Fritze and
Esposito, 1997
; Smith et al., 1998
). Together these
observations are consistent with the participation of Sir2p in distinct
HM/telomeric and rDNA silencing complexes.
|
Sir2-hSIR2A Chimeras Fail to Localize Properly Within the Nucleus
Sir2p has been localized to telomeres and the nucleolus by
indirect immunofluorescence microscopy (Gotta et al., 1997
).
To determine whether the Sir2-hSir2A(NID+CYS) chimera localizes in the
same manner as wild-type Sir2p or whether it localizes with a pattern
that may reflect differences in its ability to function at these loci,
we compared localization of Sir2p with that of the Sir2-hSir2A chimera.
Wild-type Sir2p localized normally (Gotta et al., 1997
);
telomeric foci were present within the main body of DAPI-staining
chromatin, and Sir2p nucleolar staining was coincident with the Nop1p
nucleolar antigen (Figure 7, top row).
Staining of wild-type Sir2p also revealed foci indicative of
localization to subdomains within the nucleolus (Stone and Pillus,
unpublished results). For wild-type Sir2p, 97% of the cells exhibited
the normal telomeric and nucleolar staining pattern (n = 306). In contrast, the Sir2-hSir2A(NID + CYS) chimera localized in a diffuse and sometimes intense pattern in a majority of the nuclei
examined (Figure 7, bottom row). The intense fluorescence signal does
not correlate with higher expression levels of the chimeric protein as
determined by immunoblotting (our unpublished
observations; see DISCUSSION). A representative field is shown for
cells expressing the chimera, in which mislocalization is apparent in
nuclei that are either filled completely with Sir2p signal (49%) or
are partially filled with occasional foci simultaneously observed
(23%). Thus, a total of 72% of Sir2-hSir2A(NID + CYS) cells (n = 352) were abnormal, whereas a minority of cells (28%) retained an
apparently wild-type pattern. DAPI and Nop1p staining were comparable
in wild-type versus the Sir2-hSir2A(NID + CYS) chimera, indicating that
the fundamental organization of chromatin and the nucleolus was not
disrupted. Moreover, Rap1p staining of telomeric foci was normal for
the chimera compared with wild-type Sir2p (our unpublished results).
The smaller chimera Sir2-hSir2A(NID) was also examined, and a
comparable pattern of mislocalization was observed (our unpublished
results). Therefore, the inability of the Sir2-hSir2A proteins to
function at telomeres and the rDNA is correlated with their disrupted
localization.
|
| |
DISCUSSION |
|---|
|
|
|---|
Transcriptional activation is broadly conserved at levels of both
mechanistic and molecular detail. This point is well illustrated by RNA
polymerase itself, as well as regulatory complexes such as SWI-SNF and
RSC (reviewed by Struhl, 1996
; Kadonaga, 1998
; Workman and Kingston,
1998
). By contrast, although chromatin-mediated repression is a
prevalent form of transcriptional regulation, evidence for molecular
equivalence between divergent organisms is scarce. Arguably, silencing
is best understood in molecular detail in S. cerevisiae, so
the recent discovery of widespread homologues of the classically
defined yeast SIR2 gene fueled the prediction that
silencing, like transcriptional activation, might have conserved
molecular mechanisms. SIR2's silencing-related activities
include repression of transcription at the silent mating-type loci,
telomeres, and within the rDNA arrays (Shore et al., 1984
; Ivy et al., 1986
; Aparicio et al., 1991
; Bryk
et al., 1997
; Fritze and Esposito, 1997
; Smith and Boeke,
1997
), suppression of rDNA recombination (Gottlieb and Esposito, 1989
),
and modulation of histone (de)acetylation (Braunstein et
al., 1993
). We previously showed that three of four yeast
homologues can function in silencing (Brachmann et al.,
1995
). Here, we provide evidence from structure-function analysis of
conserved domains involved in Sir2p's functions.
We demonstrate that a region essential for Sir2p function and
comprising approximately one-third of Sir2p can be replaced with human
Sir2A sequences to form a chimera that functions positively in
silencing (see model in Figure 8).
Interestingly, this chimera also has the capacity to dominantly
interfere with Sir2p function at some loci, underscoring the concept
that silencing proteins act in distinct chromatin complexes. That
interacting factors may be species specific is suggested by the fact
that expression of hSIR2A fails to complement. Our analysis
of yeast-human chimeras and hSIR2A itself implicates the
HST gene family in chromatin organization and function in
organisms as diverse as yeast and humans. Furthermore, because even
organisms as deeply rooted evolutionarily as the Archaebacteria have
homologues of SIR2, it is possible that these molecules are
among the most ancient proteins with chromatin function.
|
Motifs Conserved in Sir2p and the Hst Proteins Are Essential for Silencing
Members of the Sir2p family are defined by a core domain including
three diagnostic motifs (Figure 1) (Brachmann et al., 1995
; Derbyshire et al., 1996
). To test the significance of the
core and its motifs for SIR2 silencing function, we analyzed
a series of deletion and cysteine to alanine point mutants. The results demonstrated that the core domain and smaller regions containing the
conserved motifs, as well as the cysteines themselves, are absolutely
essential for SIR2 silencing at the HM loci,
telomeres, and within the rDNA (Figures 2, B-D, and 3). Removal of any
one of the motifs leads to loss of function at all loci (Figure 2B and
our unpublished results). The regions containing these motifs may
specify a catalytic activity, interaction with other silencing proteins, and/or subcellular localization important for Sir2p's function in silencing.
The four essential cysteines may mediate protein-nucleic acid or
protein-protein interactions required for SIR2 activity. Alternatively, the cysteines may be important for folding or activity. Because the stable expression that we observe for the cysteine to
alanine mutant proteins is consistent with proper folding (Parsell and
Sauer, 1989
), the cysteines are more likely to specify intermolecular interactions that contribute to silencing function. These
intermolecular contacts are probably protein-protein interactions
rather than protein-DNA interactions (Moran and Matthews, 1987
;
Coleman, 1992
). Whereas Sir2p has not been shown to bind to DNA in
vitro (Shore and Nasmyth, 1987
; Buchman et al., 1988
) or to
localize to the HM loci or telomeres in the absence of other
silencing factors (Hecht et al., 1996
; Gotta et
al., 1997
; Strahl-Bolsinger et al., 1997
), it has been
shown by affinity chromatography and coimmunoprecipitation experiments
to interact with itself as well as with two other components of the
HM/telomeric silencing complex, Sir3p, and Sir4p (Hecht
et al., 1996
; Moazed and Johnson, 1996
; Gotta et
al., 1997
; Holmes et al., 1997
; Moazed et
al., 1997
; Strahl- Bolsinger et al., 1997
). We
predict that the cysteines are more likely to mediate Sir2p
multimerization or interactions with yet unidentified proteins, rather
than interactions with Sir3p and/or Sir4p. This prediction is based on
the observation that deletion or mutation of the cysteines results in
loss of rDNA silencing, a function requiring Sir2p, but not Sir3p or
Sir4p (Smith and Boeke, 1997
).
In contrast to the loss of function observed in the cysteine to alanine
point mutants or with small deletions of the conserved core domain,
deletion of the nonconserved N-terminal 79 amino acids of Sir2p does
not affect its silencing function or locus specificity (Figure 2,
B-D). This is somewhat surprising, because the length and sequence of
the N terminus appears to be the major sequence difference between
Sir2p and Hst1p, yet high-copy expression of Hst1p rescues only the
sir2
HM, but not telomeric or rDNA silencing or
recombination defects (Brachmann et al., 1995
; Derbyshire et al., 1996
; and Sherman and Pillus, unpublished results).
However, other nonconserved regions outside the core (defined here as
amino acids 275-427) must be important for silencing, because
expression of the SIR2 core alone is not sufficient to
silence the HM loci (Garcia and Pillus, unpublished results).
The conserved core of Sir2p is essential for its function in silencing.
But is the function of the core evolutionarily conserved, and, thus,
are the other Hst proteins likely to have a chromatin-related function?
The complementation of the sir2
mating and HM
silencing defects by the SIR2-hSIR2A(NID) chimera
(Figure 4, B and C) demonstrates that the human Sir2A core can function
in silencing. A larger SIR2-hSIR2A(NID + CYS)
chimera is similarly functional (Figure 4, B and C). This is
particularly remarkable because the human sequence in this chimera
represents >40% of hSir2Ap and constitutes nearly 30% of the chimera.
Furthermore, the Sir2-hSir2A chimeras dominantly derepress the
HM loci and telomeres, but not the rDNA (Figure 6). This
derepression is locus and not gene or promoter specific, because they
derepress both pol II- and pol III-transcribed reporters at the
HM loci and radically interfere with silencing a
URA3 reporter at the telomeres but not within the rDNA
(Figure 6 and our unpublished results). We interpret this dominance in
the context of Sir2p forming distinct complexes that act at
HM and telomeric targets on one hand and at rDNA targets on
the other (Figure 8; Smith and Boeke, 1997
; Smith et al.,
1998
). Specifically, we propose that the chimeric Sir2 proteins
interfere with the assembly or function of the macromolecular complexes
that act in HM and telomeric silencing (Figure 6, A and B)
but have no such effect on the macromolecular complexes involved in
rDNA silencing (Figure 6C). In fact, expression of the Sir2-hSir2A
chimeras in the presence of wild-type Sir2p promotes modestly increased
silencing in the rDNA (Figure 6C), providing further evidence that
distinct Sir2p-containing complexes participate in silencing specific
genomic loci (Figure 8). However, the Sir2-hSir2A(NID) chimera, as well
as the sir2-
CORE mutant protein, can interfere with the residual
rDNA silencing that occurs even in the absence of Sir2p (Figures 2D and
4E). It is possible, for example, that these sir2 variants
interfere with a secondary silencing mechanism that might involve Hst1p
(Gotta et al., 1997
).
The Core Influences Locus-specific Silencing Function
Interestingly, the SIR2-hSIR2A
chimeras exhibit locus specificity; that is, they retain the ability to
silence the HM loci, but not the telomeres or the rDNA in
the context of a sir2
strain (Figures 8 and 4 B-E).
Thus, there may be specificity determinants, or separable elements
required for silencing specific loci, embedded in the conserved core of
Sir2p. This situation is evocative of yeast and human TFIID or
TATA-binding proteins in which functional differences reside in a
conserved domain, rather than in the divergent N termini (Cormack
et al., 1991
; Gill and Tjian, 1991
; Reddy and Hahn, 1991
).
Thus, the coincidence of conserved elements and specificity determinants may be a general feature of transcriptional regulators. In
this model, one or more determinants required for HM locus function must be conserved in the human Sir2A core, because the chimeras are able to partially silence these loci. This region of the
yeast Sir2p core must additionally contain sequences specifying telomeric and rDNA function, which are not found in the human Sir2A
core. These determinants may influence correct Sir2p localization and/or function, because loss of telomeric and rDNA silencing by the
Sir2-hSir2A chimeras correlates with loss of precise localization to
telomeric foci and subnucleolar regions (Figure 7). Because the
Sir2-hSir2A chimeras function at the HM loci, we assume they localize correctly there. However, their overall immunofluorescence signal is diffuse and often intense. The intensity of the signal observed in many nuclei is not likely to be due to differences in
expression, because a similar level of protein to that seen for
wild-type Sir2p is detected by immunoblotting (our
unpublished results). Rather, the intensity may be due to a more open
chromatin configuration. Or it may be due to gross mislocalization of
the chimera to a soluble pool in the nucleoplasm, distinct from the normally chromatin-bound Sir2p. In either case, the Sir2-hSir2A chimera
may be more accessible to the antibody probes. And either possibility
would be consistent with the observed telomeric and rDNA derepression
in chimeric strains.
Another possible explanation for the ability of the SIR2-hSIR2A chimeras to function only in HM silencing is that the chimeras retain enough residual function to silence the HM loci but not the telomeres or rDNA. However, we favor the interpretation that sequence differences in the human core affect locus specificity because the Sir2-hSir2A chimeras both function and dominantly interfere with wild-type Sir2p function at distinct subsets of loci, including the purportedly more stable HM loci. This suggests that the human core affects interactions with various silencing factors differently, both in the presence and absence of Sir2p. Additional evidence for this comes from the chimeras' failure to localize properly and repress the rDNA reporter gene in sir2 mutants and their apparent ability to function in rDNA silencing in SIR2+ strains.
Alternatively, there may be competition between the HM loci
and telomeres for a limiting pool of interacting factors (e.g., Sir2p
or its derivatives), as has been observed between these loci for the
transcriptional regulatory protein Rap1p (Buck and Shore, 1995
).
However, we consider competition for the Sir2-hSir2A chimeras to be an
unlikely explanation for their silencing specificity for two reasons.
First, telomeric silencing is independent of SIR2 dosage
(Renauld et al., 1993
), and the chimeric proteins are
expressed at levels comparable with wild-type Sir2p. Second, deletion
of the HML locus in a MATa
sir2
TEL::URA3-marked strain does not lead to
enhanced telomeric repression by the chimeras (our unpublished
results), as would be predicted if competition were significant. Thus,
the core domain of Sir2p not only carries out a silencing function but
also influences telomeric and rDNA localization and thereby is
important for determining normal locus specificity.
hSIR2A is expressed at significant levels in all
tissues examined (Figure 5) and therefore is available to carry out a
silencing-like function in humans, as suggested by Sir2-hSir2A
chimeras' activity in yeast. However, hSIR2A does not
suppress any of the yeast sir2
silencing defects, thereby
functionally distinguishing it from the Sir2-hSir2A chimeras (Table 2).
Thus, although there are some critical silencing determinants within
the core, there must also be sequences required for HM
silencing residing outside the Sir2p core. These residues, which
influence HM function, may not be found in the hSir2A
protein, or hSir2Ap function may require species-specific factors for
proper function and/or localization.
A Case for SIR-like Silencing in Humans?
That SIR-mediated silencing might occur through a
complex of interacting silencing factors was originally proposed on the basis of genetic arguments (Rine and Herskowitz, 1987
). Since then, it
has been demonstrated that wild-type Sir2p interacts with itself as
well as with Sir3p and Sir4p (Moazed and Johnson, 1996
; Holmes et
al., 1997
; Moazed et al., 1997
; Strahl-Bolsinger et al., 1997
), presumably in a complex along with other
silencing factors that physically associates with the HM
loci and telomeres (Hecht et al., 1996
; Gotta et
al., 1997
; Strahl-Bolsinger et al., 1997
). The results
presented here extend and expand this view of Sir2p's functions in
silencing. We have shown that the core of Sir2p and its motifs are
essential for silencing and that the human Sir2A core can substitute
for the core of Sir2p to silence. We also provide evidence that
silencing of multiple genomic loci is mediated by distinct silencing
complexes of which Sir2p is a common component (Figure 8). These
results suggest that the HSTs from yeast and other organisms
may themselves be involved in silencing and/or chromatin organization.
Like SIR2 and the HSTs, many aspects of
silencing are conserved. These include two in which Sir2p has been
implicated. First, overexpression of Sir2p leads to reduced acetylation
of three of the four core histones (Braunstein et al.,
1993
). In organisms from yeast to mammals, hypoacetylated histones are
associated with silenced regions of the genome (Lin et al.,
1989
; Turner et al., 1992
; Braunstein et al.,
1993
, 1996
; Jeppesen and Turner, 1993
; O'Neill and Turner, 1995
).
Thus, the Hst proteins, including those from yeast and humans, may
modulate histone (de)acetylation to control transcription. Second,
repeat-induced silencing is also evolutionarily conserved and is
involved in many basic biological processes, such as dosage
compensation and host defense (reviewed in Henikoff and Matzke, 1997
).
This combined with the known involvement of Sir2p within the repetitive
telomeric and rDNA arrays (Gottlieb and Esposito, 1989
; Aparicio
et al., 1991
; Bryk et al., 1997
; Fritze and
Esposito, 1997
; Smith and Boeke, 1997
) suggests that the Hst proteins
may also function in silencing of repeated DNAs. Although the
homologues have distinct "architectural" features such as
C-terminal extensions, which may be required for their individual
silencing functions, we provide evidence that the core with its
consensus motifs is a silencing domain. This model, in which conserved
functional domains of a silencing protein specify its activity, is
likely to be universal. However, whether the Hst proteins function
specifically in silencing by directly interacting with chromatin or
have a more general enzymatic function that contributes to silencing
remains to be determined. Such catalytic activities are readily
understood in the case of histone acetylases and deacetylases that are
components of chromatin complexes. Other enzymatic activities may
function in less obvious ways, such as that recently proposed for an
inorganic pyrophosphatase, a component of the Drosophila
NURF chromatin remodeling complex (Gdula et al.,
1998
). Although the precise roles of the Hst proteins in yeast and
other organisms are not yet known, it is plausible that they function
to refine gene regulation. The observation that the human Sir2A core
domain can participate in yeast silencing increases the
significance of this broadly conserved gene family.
| |
ACKNOWLEDGMENTS |
|---|
Strains, plasmids, and other reagents were generously provided by J. Aris, D. Gottschling, J. Rine, J. Smith, and R. Sternglanz. M. Blower and S. Garcia provided helpful comments on the manuscript. Microscopy was made possible in part by a gift from Virginia and Mel Clark. This work was supported by an American Cancer Society postdoctoral fellowship to J.M.S., a Howard Hughes Medical Institute predoctoral fellowship to L.F.C., and the National Institutes of Health.
| |
FOOTNOTES |
|---|
Present address: Department of Biology,
Pacific Hall 0347, 9500 Gilman Drive, University of California, San
Diego, La Jolla, CA 92093-0347.
Corresponding Author: E-mail address:
lpillus{at}biomail.ucsd.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
B. Ozaydin and J. Rine Expanded Roles of the Origin Recognition Complex in the Architecture and Function of Silenced Chromatin in Saccharomyces cerevisiae Mol. Cell. Biol., February 1, 2010; 30(3): 626 - 639. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Yang, A. Miller, and A. L. Kirchmaier HST3/HST4-dependent Deacetylation of Lysine 56 of Histone H3 in Silent Chromatin Mol. Biol. Cell, November 1, 2008; 19(11): 4993 - 5005. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mead, R. McCord, L. Youngster, M. Sharma, M. R. Gartenberg, and A. K. Vershon Swapping the Gene-Specific and Regional Silencing Specificities of the Hst1 and Sir2 Histone Deacetylases Mol. Cell. Biol., April 1, 2007; 27(7): 2466 - 2475. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, S. Yin, Y. Meng, W. Sakr, and S. Sheng Endogenous inhibition of histone deacetylase 1 by tumor-suppressive maspin. Cancer Res., September 15, 2006; 66(18): 9323 - 9329. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Klieger, O. Yizhar, D. Zenvirth, N. Shtepel-Milman, M. Snoek, and G. Simchen Involvement of Sir2/4 in Silencing of DNA Breakage and Recombination on Mouse YACs during Yeast Meiosis Mol. Biol. Cell, March 1, 2005; 16(3): 1449 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Bae, M. J. Swanson, A. Vassilev, and B. H. Howard Human Histone Deacetylase SIRT2 Interacts with the Homeobox Transcription Factor HOXA10 J. Biochem., June 1, 2004; 135(6): 695 - 700. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. D. Kao, W. G. McKenna, M. G. Guenther, R. J. Muschel, M. A. Lazar, and T. J. Yen Histone deacetylase 4 interacts with 53BP1 to mediate the DNA damage response J. Cell Biol., March 31, 2003; 160(7): 1017 - 1027. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Naresh, S. Saini, and J. Singh Identification of Uhp1, a Ubiquitinated Histone-like Protein, as a Target/Mediator of Rhp6 in Mating-type Silencing in Fission Yeast J. Biol. Chem., March 7, 2003; 278(11): 9185 - 9194. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Krishna, I. Majumdar, and N. V. Grishin Structural classification of zinc fingers: SURVEY AND SUMMARY Nucleic Acids Res., January 15, 2003; 31(2): 532 - 550. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. McBurney, X. Yang, K. Jardine, M. Hixon, K. Boekelheide, J. R. Webb, P. M. Lansdorp, and M. Lemieux The Mammalian SIR2{alpha} Protein Has a Role in Embryogenesis and Gametogenesis Mol. Cell. Biol., January 1, 2003; 23(1): 38 - 54. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Pandey, A. Muller, C. A. Napoli, D. A. Selinger, C. S. Pikaard, E. J. Richards, J. Bender, D. W. Mount, and R. A. Jorgensen Analysis of histone acetyltransferase and histone deacetylase families of Arabidopsis thaliana suggests functional diversification of chromatin modification among multicellular eukaryotes Nucleic Acids Res., December 1, 2002; 30(23): 5036 - 5055. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Newman, J. R. Lundblad, Y. Chen, and S. M. Smolik A Drosophila Homologue of Sir2 Modifies Position-Effect Variegation but Does Not Affect Life Span Genetics, December 1, 2002; 162(4): 1675 - 1685. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Onyango, I. Celic, J. M. McCaffery, J. D. Boeke, and A. P. Feinberg SIRT3, a human SIR2 homologue, is an NAD- dependent deacetylase localized to mitochondria PNAS, October 15, 2002; 99(21): 13653 - 13658. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Garcia and L. Pillus A Unique Class of Conditional sir2 Mutants Displays Distinct Silencing Defects in Saccharomyces cerevisiae Genetics, October 1, 2002; 162(2): 721 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Grunweller and A. E. Ehrenhofer-Murray A Novel Yeast Silencer: The 2{micro} Origin of Saccharomyces cerevisiae Has HST3-, MIG1- and SIR-Dependent Silencing Activity Genetics, September 1, 2002; 162(1): 59 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Huang Transcriptional silencing in Saccharomyces cerevisiae and Schizosaccharomyces pombe Nucleic Acids Res., April 1, 2002; 30(7): 1465 - 1482. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sutton, R. C. Heller, J. Landry, J. S. Choy, A. Sirko, and R. Sternglanz A Novel Form of Transcriptional Silencing by Sum1-1 Requires Hst1 and the Origin Recognition Complex Mol. Cell. Biol., May 15, 2001; 21(10): 3514 - 3522. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Smith, C. B. Brachmann, I. Celic, M. A. Kenna, S. Muhammad, V. J. Starai, J. L. Avalos, J. C. Escalante-Semerena, C. Grubmeyer, C. Wolberger, et al. A phylogenetically conserved NAD+-dependent protein deacetylase activity in the Sir2 protein family PNAS, June 6, 2000; 97(12): 6658 - 6663. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Cockell, S. Perrod, and S. M. Gasser Analysis of Sir2p Domains Required for rDNA and Telomeric Silencing in Saccharomyces cerevisiae Genetics, March 1, 2000; 154(3): 1069 - 1083. [Abstract] [Full Text] |
||||
![]() |
L. L. Freeman-Cook, J. M. Sherman, C. B. Brachmann, R. C. Allshire, J. D. Boeke, and L. Pillus The Schizosaccharomyces pombe hst4+ Gene Is a SIR2 Homologue with Silencing and Centromeric Functions Mol. Biol. Cell, October 1, 1999; 10(10): 3171 - 3186. [Abstract] [Full Text] |
||||
![]() |
J. Landry, A. Sutton, S. T. Tafrov, R. C. Heller, J. Stebbins, L. Pillus, and R. Sternglanz The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases PNAS, May 23, 2000; 97(11): 5807 - 5811. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Armstrong, M. Kaeberlein, S. I. Imai, and L. Guarente Mutations in Saccharomyces cerevisiae Gene SIR2 Can Have Differential Effects on In Vivo Silencing Phenotypes and In Vitro Histone Deacetylation Activity Mol. Biol. Cell, April 1, 2002; 13(4): 1427 - 1438. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||