![]() |
|
|
Vol. 11, Issue 1, 103-116, January 2000
Department of Cell Biology and Anatomy, The Johns Hopkins School of Medicine, Baltimore, Maryland 21205
Submitted July 22, 1999; Revised October 12, 1999; Accepted October 15, 1999| |
ABSTRACT |
|---|
|
|
|---|
The mitochondrial inner membrane contains two separate translocons: one required for the translocation of matrix-targeted proteins (the Tim23p-Tim17p complex) and one for the insertion of polytopic proteins into the mitochondrial inner membrane (the Tim54p-Tim22p complex). To identify new members of the Tim54p-Tim22p complex, we screened for high-copy suppressors of the temperature-sensitive tim54-1 mutant. We identified a new gene, TIM18, that encodes an integral protein of the inner membrane. The following genetic and biochemical observations suggest that the Tim18 protein is part of the Tim54p-Tim22p complex in the inner membrane: multiple copies of TIM18 suppress the tim54-1 growth defect; the tim18::HIS3 disruption is synthetically lethal with tim54-1; Tim54p and Tim22p can be coimmune precipitated with the Tim18 protein; and Tim18p, along with Tim54p and Tim22p, is detected in an ~300-kDa complex after blue native electrophoresis. We propose that Tim18p is a new component of the Tim54p-Tim22p machinery that facilitates insertion of polytopic proteins into the mitochondrial inner membrane.
| |
INTRODUCTION |
|---|
|
|
|---|
Mitochondrial function requires the import of hundreds of proteins
synthesized in the cytosol (for review, see Ryan and Jensen, 1995
;
Pfanner, 1998
; Ryan et al., 1998
; Rassow et al.,
1999
). In the yeast Saccharomyces cerevisiae, mitochondrial
protein import uses multiple subunit translocases found in the
mitochondrial outer membrane (called the TOM complex) and in the
inner membrane (called the TIM complexes). Most proteins destined for
mitochondria carry amino-terminal targeting signals called
presequences. Presequences vary in length and primary amino acid
sequence, yet they share a common motif of a positively charged
amphipathic helix (Allison and Schatz, 1986
; Roise et al.,
1986
, 1988
; Roise, 1992
). Once in the matrix, the presequence is
removed by a two-subunit processing protease called MPP (McAda
and Douglas, 1982
; Yaffe et al., 1985
; Jensen and Yaffe,
1988
; Pollock et al., 1988
; Witte et al., 1988
; Yang et al., 1988
). Some proteins destined for the
mitochondrial inner membrane (IM) carry a cleavable presequence
followed by one or more hydrophobic membrane-spanning segments (Stuart
and Neupert, 1996
). The transmembrane segments are proposed to either function as stop-transfer sequences in the IM (Miller and Cumsky, 1991
,
1993
) or facilitate the insertion of the polypeptide into the IM after
its complete import into the matrix (Mahlke et al., 1990
;
Herrmann et al., 1997
).
Mitochondrial precursor proteins bind to one of several receptors on
the mitochondrial surface (Hase et al., 1983
; Hines et al., 1990
; Steger et al., 1990
; Moczko et
al., 1993
; Ramage et al., 1993
; Gratzer et
al., 1995
; Hönlinger et al., 1995
; Lithgow et al., 1995
; Moczko et al., 1997
). Precursors
are then translocated across the outer membrane (OM) via the TOM
complex, which includes Tom40p, Tom22p, Tom7p, Tom6p, and Tom5p
(Alconada et al., 1995
; Honlinger et al., 1996
;
Dietmeier et al., 1997
; Hill et al., 1998
). The
mitochondrial IM appears to have at least two separate import machines.
One multiple subunit complex, the Tim23p-Tim17p translocon, is required
to translocate proteins across the IM into the matrix (Emtage and
Jensen, 1993
; Maarse et al., 1994
; Ryan et al.,
1994
; Lohret et al., 1997
). Tim44p and mt-Hsp70 provide the
pulling force for this import (Pfanner et al., 1994
; Rassow
et al., 1994
; Stuart et al., 1994
; Berthold
et al., 1995
; Glick, 1995
). Precursors that carry positively
charged presequences are targeted to Tim23p-Tim17p after their
translocation across the OM (Moro et al., 1999
). The Tim23p-Tim17p complex also plays a role in the insertion of some proteins into the IM.
A second translocase in the IM is the Tim54p-Tim22p complex (Sirrenberg
et al., 1996
; Kerscher et al., 1997
). Tim54p and
Tim22p are required for the insertion of many polytopic proteins into the IM. Substrates for the Tim54p-Tim22p complex do not carry cleavable, amino-terminal presequences. These include members of the
mitochondrial carrier family, such as the phosphate carrier (PiC) and
the ADP/ATP carrier, as well as the membrane components of the IM
translocases, Tim23p, Tim22p, and Tim17p (Sirrenberg et al.,
1996
; Kerscher et al., 1997
; Davis et al., 1998
;
Koehler et al., 1998a
; Endres et al.,
1999
). Tim54p and Tim22p are integral membrane proteins that associate
with several proteins in the intermembrane space, including Tim12p,
Tim10p, and Tim9p (Koehler et al., 1998b
; Sirrenberg
et al., 1998
; Adam et al., 1999
). Tim12p, Tim10p,
and Tim9p are homologous proteins and are thought to play a role in
shuttling imported proteins from the TOM complex in the OM to the
Tim54p-Tim22p complex in the IM (Koehler et al., 1998a
; Sirrenberg et al., 1998
; Adam et
al., 1999
). Recently, two new members of the Tim12p-Tim10p-Tim9p
family have been identified, Tim13p and Tim8p, but their role in import
is not clear (Koehler et al., 1999
).
To identify additional members of the Tim54p-Tim22p insertion complex, we isolated genes that, when present in multiple copies, suppress the temperature-sensitive growth defect of the tim54-1 mutant. We identified a new gene, called TIM18, which encodes an integral protein residing in the mitochondrial IM. Both genetic and biochemical experiments suggest that Tim18p is a member of the Tim54p-Tim22p complex.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains and Relevant Genotypes
MAT
tim54::URA3 trp1
63
leu2
1 ura3-52 strain 735 contains tim54-1 on
TRP1-CEN6 plasmid pOK24 (Kerscher et al., 1997
).
MATa tim23-1 ura3 trp1 his3 leu2 strain 574 (Ryan et
al., 1998
) and MAT
tim54-1 trp1
63 leu2
1
ura3-52 his3-
200 strain 809 (Kerscher et al., 1997
)
have been described. MATa/MAT
trp1
63/trp1
63
his3
200/his3
200 leu2
1/leu2
1 ura3-52/ura3-52 strain 605 was constructed by crossing strain FY833 to strain FY834 (Winston
et al., 1995
). MATa/MAT
trp1
63/trp1
63 his3
200/his3
200 leu2
1/leu2
1
ura3
0/ura3
0 strain 1082 was constructed by crossing strain
BY4733 to strain BY4734 (Brachmann et al., 1998
).
tim54-1/tim18::HIS3 diploid strain 1009 was
constructed by crossing tim54-1 strain 809 to
tim18::HIS3 strain 994 (see below). Standard yeast
genetic techniques and media were used (Rose et al.,
1988
).
Isolation of TIM18
Yeast strain 735 contains the tim54::URA3
disruption and pOK24, which carries tim54-1 on a
TRP1-CEN6-containing plasmid (Kerscher et al.,
1997
). Strain 735 was transformed with a library containing genomic DNA
fragments in the 2µ-LEU2 plasmid YEp13 (Nasmyth and Tatchell, 1980
). Five thousand Leu+ transformants
were selected at 24°C and then replica plated to YEP medium
containing 2% glycerol and 2% ethanol as the sole carbon source.
Thirty-one transformants that grew at 34°C were isolated, and the
LEU2-containing plasmids were isolated. Seven of the 31 plasmids were able to rescue the tim54-1 defect upon
retransformation. PCR analysis showed that four of the plasmids
contained either TIM22 (three isolates) or TIM54
(one isolate). The remaining three plasmids were partially sequenced,
and two plasmids contained overlapping inserts of DNA from chromosome
XV. Plasmid pOK94 carries the tim54-1-suppressing activity
on an ~6-kilobase pair (kbp) genomic DNA fragment from chromosome XV.
Subcloning experiments localized the tim54-1-suppressing
activity to an ~1.26-kbp EcoRI fragment containing a
single ORF, YOR297c. Plasmid pOK66, which carries the YOR297
EcoRI fragment inserted into plasmid pRS423 (Sikorski and
Hieter, 1989
), suppressed the tim54-1 temperature-sensitive phenotype. One plasmid contained sequences from chromosome VII and has
not been characterized.
Plasmid Constructions
2µ-HIS3 plasmid pOK59 carries TIM54 on a
3-kbp ClaI fragment inserted in pRS423 (Sikorski and Hieter,
1989
) and was constructed by homologous recombination in yeast
(Oldenburg et al., 1997
) between a PvuII fragment
derived from pOK31 (Kerscher et al., 1997
) and
XhoI-EcoRI-digested pRS423. Plasmid pJH203
(Holder, unpublished data) was constructed by insertion of an
EcoRI fragment containing TIM22 from
392 to 863 into pRS423. 2µ-YLR164w plasmid pOK90 was constructed by
amplifying yeast genomic DNA with the use of oligonucleotides 234 (5'-GGAATTCCCTGATTCGCACCTTC-3') and 235 (5'-GGAATTCGTCACCACTAACCAAAC-3') and PCR (Saiki et al.,
1985
). After EcoRI digestion, the PCR product was inserted
into pRS426 (Sikorski and Hieter, 1989
), forming pOK90.
2µ-SDH4 plasmid pOK91 was constructed by isolating a
PvuI fragment containing SDH4 from plasmid
SDH4-17 (a gift from B. Lemire, University of Alberta, Edmonton,
Alberta, Canada) (Bullis and Lemire, 1994
) and using this
fragment for recombination in yeast with
XhoI-BamHI-digested pRS425 (Sikorski and Hieter,
1989
).
Gene Disruption of TIM18 and TIM54
A complete null mutation in the chromosomal copy of
TIM18 was constructed with the use of a PCR-based gene
disruption method (Lorenz et al., 1995
). Briefly, a
HIS3 DNA fragment was amplified with the use of
oligonucleotides 221 (TCTTAGAAATGCAAA-AAAAAAGAAAAAGTATGGGTGAGTCAGATTGTACTGAGAG-TGCAC) and 222 (ATGCGAGGTGCAACAACTGAGTAATTTAATACCTTTGGTACTGTGCGGTATTTCACACCG) and plasmid pRS303 (Sikorski and Hieter, 1989
) as the template. The amplified HIS3 DNA fragment, flanked by 40 base pairs
(bp) of TIM18 sequences immediately upstream and downstream
of the ORF, was transformed into his3/his3 diploid strains
605 and 1082. His+ diploid transformants were
isolated and shown by PCR analysis to have one of two copies of
TIM18 disrupted (tim18::HIS3).
MAT
tim18::HIS3 strain 992, MATa
tim18::HIS3 strain 994, MAT
TIM18 strain
993, and MATa TIM18 strain 995 are the meiotic products from
tim18::HIS3/TIM18 diploid strain 987 (strain 605 background).
tim54::KAN strain 1078, which lacks the
TIM54 ORF, was constructed by PCR-mediated gene replacement
into diploid strain 605 with the use of oligonucleotides 382 (GCTTTAAAGTCCATTG-TTCTCAAAAGAAGCTCAATAGACCAGATTGTACTGAGTGCA-C) and 383 (CGTCGATCGTGCATGATGATAAAACATAATATATAT-CCAACTGTGCGGTATTTCACACCG) and
kanMX4 plasmid pRS400 (Brachmann et al., 1998
).
G418-resistant transformants were then transformed with
TIM54-URA3 plasmid pOK30 (Kerscher et al., 1997
).
After sporulation and meiotic analysis, haploid strain 1078, which
carries tim54::KAN and pOK30, was isolated.
Construction of a Hemagglutinin Epitope-tagged Version of the Tim18 Protein
pOK70, which contains TIM18 with a NotI
site proximal to the stop codon, was constructed as follows. An
~1-kbp PCR product containing the TIM18 ORF was amplified
from plasmid pOK66 with the use of oligonucleotides 229 (GGAATTCGTGTTAATG) and 227 (ATAGTTTAGCGGCCGCCGTTTCTTCCAAATATATAC), digested with EcoRI
and NotI, and inserted into Bluescript SK II+ (Stratagene, La Jolla, CA). A 114-bp
NotI fragment containing three copies of the influenza
hemagglutinin (HA) epitope (Field et al., 1988
; Tyers
et al., 1992
) was inserted into pOK70, yielding pOK73. pOK73
was digested with AatII and SacI, and an
AatII-SacI fragment from pOK48 (Kerscher et
al., 1997
) containing the 3'-untranslated region of
TIM23 was inserted to yield pOK74. TIM18-HA was
isolated from pOK74 as a 2.2-kbp PvuII fragment and inserted
into the HindIII-XhoI-digested LEU2-CEN6 plasmid pRS315 (Sikorski and Hieter, 1989
) by
homologous recombination in yeast (Oldenburg et al., 1997
),
forming pOK1032. pOK1032 was transformed into MAT
tim18::HIS3 strain 992 (making strain 1032).
2µ-TIM18-HA plasmid pOK1030 was constructed as described for pOK1032 except that a 2.2-kbp PvuII fragment containing
TIM18-HA from pOK74 was inserted into the
LEU2-2µ plasmid pRS425 (Sikorski and Hieter, 1989
).
Subcellular and Submitochondrial Fractionation
Yeast cells were grown to OD600 of ~1.0
in YEP medium containing glycerol and ethanol. Cells were converted to
spheroplasts and homogenized in breaking buffer (0.6 M mannitol, 20 mM
HEPES/KOH, pH 7.4), and a crude cytosolic fraction and a mitochondrial
pellet were isolated by centrifugation at 9600 × g for
10 min as described (Daum et al., 1982
). Osmotic disruption
of the mitochondrial OM was accomplished by resuspending mitochondrial
pellets in 20 mM HEPES-KOH, pH 7.4, at a protein concentration of 1 mg/ml. For protease digestions, 100 µg of mitochondria at 1 mg/ml was
treated with 50 µg/ml proteinase K for 20 min on ice, followed by the addition of 1 mM PMSF (Sigma Chemical, St. Louis, MO). Separation of
mitochondrial OM and IM vesicles on sucrose gradients was performed as
described (Emtage and Jensen, 1993
). To show that Tim18p is an integral
membrane protein, mitochondria were treated with either 0.1 M
Na2CO3, pH 11, or 1 M NaCl
and centrifuged for 30 min at ~30 pounds per square inch in a
Beckmann (Fullerton, CA) Airfuge. For analysis, proteins were separated
on SDS-polyacrylamide gels (Laemmli, 1970
; Haid and Suissa, 1983
) and
transferred (Haid and Suissa, 1983
) to Immobilon P membranes
(Millipore, Bedford, MA). Membranes were decorated with
antibodies (Haid and Suissa, 1983
), and immune complexes were detected
by chemiluminescence (SuperSignal West Pico, Pierce, Rockford, IL).
Imports into Isolated Mitochondria
For in vitro transcription, TIM18 was placed behind
the SP6 promoter as follows. The TIM18 ORF was amplified
with the use of PCR and primers 219 (GAATTCCATGGGGAATCTGACTC) and 220 (CCGCTCGAGAGGTGCAACAACTGAG). After digestion with XhoI and
EcoRI, the TIM18 PCR fragment was inserted into
SalI-EcoRI-digested pSP64 (Promega, Madison,
WI), forming plasmid pOK67. pOK68, which expresses a truncated version of TIM18 lacking the first 43 amino acids,
TIM18(44-192), was constructed as described above
except that oligonucleotide 223 (CCGCTCGAGATGGCTGAAAATAAAATAAAC) was
substituted for primer 220. Labeled Tim18p and Tim18p(44-192) proteins
were synthesized with the use of 1.5 mCi/ml
[35S]methionine (Amersham, Arlington Heights,
IL) in the SP6-Quick system (Promega) according to the manufacturer's
instructions. Mitochondria for in vitro imports were isolated from
strain D273-10b (Sherman, 1964
) as described (Daum et
al., 1982
) except that SEH buffer (250 mM sucrose, 1 mM EDTA, 20 mM HEPES-KOH, pH 7.4) was sometimes used in place of breaking buffer.
Fifteen microliters of reticulocyte lysate containing precursor
proteins was added to 80 µg of mitochondria (1 mg/ml) in import
buffer (Scherer et al., 1992
) in each import reaction.
Imports were stopped by incubation on ice and by the addition of
valinomycin (Sigma Chemical) to 0.5 µM and carbonyl cyanide
m-chlorophenylhydrazone (CCCP; Sigma Chemical) to 25 µM.
To remove nonimported proteins, mitochondria were digested with 100 µg/ml trypsin (Sigma Chemical) for 30 min on ice, followed by the
addition of a fivefold molar excess of soybean trypsin inhibitor (Sigma
Chemical). After SDS-PAGE, labeled proteins were visualized by
autoradiography (Bonner and Laskey, 1974
) or exposed to a Molecular
Dynamics (Sunnyvale, CA) Phosphor screen overnight, scanned with a
Molecular Dynamics Storm 860 PhosphorImager, and analyzed with
ImageQuant Software (Molecular Dynamics).
Immune Precipitations and Blue Native Electrophoresis
For immune precipitations, mitochondria were isolated from tim18::HIS3 strain 992 that expresses Tim18p-HA from plasmid 1032. Mitochondria were solubilized in 0.5% digitonin, 50 mM NaCl, 30 mM HEPES-KOH, pH 7.4, 1 mM PMSF, 1 mM 4-(2-aminoethyl) benzenesulfonylfluoride (Calbiochem-Novabiochem, La Jolla, CA)], 1 µg/ml leupeptin (Calbiochem-Novabiochem), and 1 µg/ml aprotinin (Sigma Chemical) at a protein concentration of 1 mg/ml. Unsolubilized material was removed from detergent lysates by centrifugation at 12,500 × g for 10 min. To 500 µl of lysate, 200 µl of a 1:1 slurry of agarose beads coupled to antibodies directed to the HA epitope was added. After rocking for 4 h at 4°C, immune complexes were recovered by centrifugation at 1300 × g for 1 min and washed. Equal amounts of pellets and supernatants were separated by SDS-PAGE and analyzed by immune blotting. HA antibodies were coupled to agarose beads with the use of the ImmunoPure IgG orientation kit (Pierce) according to the manufacturer's instructions.
For blue native gel electrophoresis, mitochondria were isolated from
wild-type strain 993, tim18::HIS3 strain 992, strain 1032 that expresses Tim18p-HA, strain 494 that expresses
Tim54p-HA (Kerscher et al., 1997
), and strain 800 that
expresses Tim22p-HA (Kerscher et al., 1997
). Fifty
micrograms of mitochondria from each strain was solubilized in buffer
containing 1% digitonin and subjected to blue native electrophoresis
as described (Schagger and von Jagow, 1991
; Dekker et al.,
1996
, 1997
).
Antiserum and Antibodies
Antiserum was raised to PiC by expressing the protein in
bacteria from plasmid pNYHM131 as described (Wohlrab and Briggs, 1994
).
Inclusion bodies containing PiC were isolated (Harlow and Lane, 1988
)
and used to immunize rabbits (Covance, Denver, PA). Antibodies to the
HA epitope (Niman et al., 1983
) were isolated from ascites
fluid prepared with the use of the 12CA5 cell line (BABCO, Berkeley,
CA). Antiserum to hexokinase (Davis, unpublished data) was produced
with the use of the purified protein (Sigma Chemical). Antisera to
Tim54p (Kerscher et al., 1997
), Tim22p (Kerscher et
al., 1997
), Tim23p (Emtage and Jensen, 1993
), Tim17p (Ryan
et al., 1998
), OM45p (Yaffe et al., 1989
), and
Cox4p (Jensen et al., 1992
) have been described.
| |
RESULTS |
|---|
|
|
|---|
TIM18 Encodes a Multiple Copy Suppressor of the tim54-1 Mutant
Part of the evidence that Tim22p interacts with Tim54p came from
our previous observation that multiple copies of the TIM22 gene suppressed the temperature-sensitive growth defect of a
tim54-1 mutant (Kerscher et al., 1997
). To
identify additional components of the Tim54p-Tim22p import complex, we
screened a yeast genomic library for new high-copy suppressors of
tim54-1. We transformed tim54::URA3 trp1
leu2 strain 735, which contains tim54-1 on plasmid pOK24, with a genomic library carried in the 2µ-LEU2
vector YEp13 (Nasmyth and Tatchell, 1980
). Plasmids carrying the 2µ
origin of replication are present in 10-40 copies per cell, resulting in overexpression of genes carried on these plasmids (Armstrong et al., 1989
). Approximately 5000 Leu+
transformants were isolated at 24°C and tested for their ability to
grow at 34°C. We initially identified 36 colonies that grew at
34°C, but the temperature-resistant phenotype was shown to be plasmid
dependent for only 7 transformants. PCR analysis showed that three of
the plasmids carried TIM22 and one of the plasmids contained
TIM54. The remaining three plasmids were partially
sequenced. Two plasmids contained overlapping inserts of DNA from
chromosome XV, and the tim54-1-suppressing activity was
localized to an ~1.26-kbp EcoRI fragment containing a
single ORF, YOR297c (Poirey et al., 1997
). As
described below, we found that the protein encoded by YOR297c is located in the mitochondrial IM and is part of
the Tim54p-Tim22p complex. YOR297c encodes a 21.9-kDa
protein that is processed to an ~18-kDa mature form after its import
into mitochondria (see below). We have named the gene TIM18
and the protein Tim18p, consistent with the nomenclature for
mitochondrial import components (Pfanner et al., 1996
).
To determine if the suppression activity of TIM18 is limited
to tim54-1, we examined the consequence of multiple copies
of TIM18 on the tim23-1 mutant. The
tim23-1 mutant was transformed with 2µ plasmids containing
TIM18, TIM23, TIM17, or an empty
vector, and we compared the results with those of tim54-1
cells transformed with 2µ plasmids carrying TIM18,
TIM54, TIM22, or an empty vector (Figure
1A). In the tim54-1 mutant,
all transformants grew at 24°C, but only cells that contained
TIM54, TIM22, or TIM18 grew at 34°C.
Multiple copies of either TIM18 or TIM22
suppressed the growth defect of the tim54-1 mutant. In
contrast, TIM18 did not allow tim23-1 cells to
grow at 34°C. Only TIM17- or TIM23-containing plasmids rescued the growth defect of tim23-1. Therefore, we
found that there is a specific genetic interaction between
TIM18 and tim54-1 similar to that seen with
TIM22. Our results raise the possibility that Tim18p is part
of the Tim54p-Tim22p pathway.
|
Although multiple copies of TIM18 allow the temperature-sensitive tim54-1 mutant to grow at 34°C, high levels of Tim18p do not completely bypass the requirement for Tim54p or Tim22p. As shown in Figure 1B, the 2µ-TIM18 plasmid did not allow strains carrying a tim54::KAN or a tim22::TRP1 disruption to grow in the absence of TIM54 or TIM22, respectively.
Tim18p Is Required for Wild-Type Cell Growth
To examine the function of the Tim18 protein, we
constructed a complete disruption of TIM18 coding sequences
with HIS3. We identified transformants in which one of the
two copies of TIM18 was replaced by the
tim18::HIS3 disruption. His+
diploid cells were sporulated, and the haploid progeny were allowed to
grow at 24, 30, or 34°C on rich medium containing glucose as the
carbon source (Figure 2A). When spores
were grown at 34°C, all four meiotic progeny germinated and formed
colonies of approximately equal size. In each tetrad, two of the
colonies were His+ and were assumed to carry the
tim18::HIS3 disruption, whereas the other two
colonies were His
and thus carried the
wild-type TIM18 gene. At 30°C,
tim18::HIS3 cells formed colonies but grew slower
than wild-type cells. Our results indicate that TIM18 is not
an essential gene.
|
We found that tim18::HIS3 mutants are cold
sensitive for growth on glucose-containing medium. When tetrads from
tim18::HIS3/TIM18 diploids were grown at 24°C,
only two of the four spores grew into distinct colonies (Figure 2A).
These colonies were shown to be His
and
therefore contained the wild-type TIM18 gene.
His+ spores containing
tim18::HIS3 germinated, grew into very small colonies, and then arrested in their growth after about eight divisions. The microcolonies formed from these spores did not undergo
additional growth even after prolonged incubation. We found that the
cold-sensitive growth defect was limited to glucose-containing medium.
As shown in Figure 2B, tim18::HIS3 cells
pregrown at 34°C and then spotted onto glucose-containing medium
displayed a clear growth defect at 24°C compared with wild-type
cells. At 30°C, the growth defect of tim18::HIS3
was detectable, but it was less than at 24°C. By comparison,
tim18::HIS3 cells grown on medium containing
raffinose or glycerol/ethanol medium grew at rates indistinguishable
from those of wild-type cells at all temperatures tested.
tim18::HIS3 disruptions in a second strain
background displayed a more extreme growth defect than those in the 605 background (not shown). Haploid tim18::HIS3 cells
derived from strain 1082 were inviable on glucose medium at 18, 24, 30, and 34°C. tim18::HIS3 cells were able to grow on
glycerol or raffinose medium, although they grew at reduced rates
compared with wild-type cells. The reason that
tim18::HIS3 disruptions show a strain-specific
phenotype is not known. However, disruptions of other yeast genes, such as CHC1 (Munn et al., 1991
) and HRD2
(Yokota et al., 1996
), often yield distinct results in
different strain backgrounds.
We found that tim18::HIS3 cells cannot tolerate
the loss of mitochondrial DNA (Figure 2C).
tim18::HIS3 and TIM18 cells were grown
for 3 d at 30°C on medium containing 25 µg/ml ethidium bromide (YEPD+EtBr) to induce loss of mitochondrial DNA (Goldring et
al., 1970
) and then tested for growth on different carbon sources. TIM18 cells were able to grow on glucose medium (YEPD) after
ethidium bromide treatment but were unable to grow on nonfermentable
medium (YEPgly/eth) as a result of loss of mitochondrial DNA. In
contrast, tim18::HIS3 cells pregrown on ethidium
bromide failed to grow on either YEPD or YEPgly/eth medium. We conclude
that tim18::HIS3 cells that have lost
mitochondrial DNA are inviable.
tim18::HIS3 Is Lethal in Combination with tim54-1
Because multiple copies of TIM18 suppress the
temperature-sensitive growth defect of the tim54-1 mutant,
Tim18p, like the Tim54 protein, may play a role in import. Supporting
this idea, we found that tim18::HIS3 tim54-1
double mutants were inviable, exhibiting a synthetic-lethal phenotype.
tim18::HIS3/tim54-1 diploid strain 1009 was
sporulated, and the meiotic progeny were allowed to grow at 24°C on
medium containing glycerol and ethanol (Figure 3A). In 20 tetrads (9 are shown in Figure
3A), we failed to recover any progeny carrying both tim54-1
and tim18::HIS3. Spores inferred to be double
mutants germinated but arrested their growth after a few divisions. The
result that the combination of tim18::HIS3 and
tim54-1 is lethal provides additional genetic evidence for an interplay between Tim18p and Tim54p.
tim18::HIS3 did not exhibit synthetic lethality
with tim23-1 (Kerscher, unpublished observations), indicating that the interaction of Tim18p and Tim54p is specific.
|
Multiple Copies of TIM22 Suppress tim18::HIS3
We previously showed that the tim54-1 mutant was
suppressed by high levels of TIM22 expression (Kerscher
et al., 1997
). We found a similar interaction between
tim18::HIS3 and TIM22. We transformed
tim18::HIS3 cells with 2µ-containing plasmids
carrying either TIM18, TIM22, TIM54,
or an empty vector and tested the cells for growth at 24°C on
glucose-containing medium. As shown in Figure 3B,
tim18::HIS3 cells containing either the
TIM18 or TIM22 gene grew similar to wild-type
cells on YEPD at 24°C. High levels of TIM54, on the other
hand, did not suppress the cold-sensitive growth defect of
tim18::HIS3. Our results show that the function of
Tim18p can be bypassed by increased levels of Tim22p and suggest that
Tim18p, like Tim22p, is part of the protein import pathway.
Tim18p Is Homologous to Two Other Yeast Proteins
The predicted protein from the TIM18 sequence (yeast
ORF YOR297c) is a protein of 21.9 kDa (Figure
4A). Hydropathy analysis suggested that
Tim18p is a membrane protein with three potential membrane-spanning
segments (Figure 4A, underlined amino acids). In addition, the amino
terminus of Tim18p has many of the characteristics of a mitochondrial
presequence (Roise and Schatz, 1988
; Claros and Vincens, 1996
). The
first 44 amino acids of Tim18p contain five basic residues, no acidic
amino acids, numerous polar residues, and no long stretches of
hydrophobic amino acids. When plotted on a helical wheel (Claros and
Vincens, 1996
), the basic residues of the amino terminus cluster to one
side of the helix. Tim18p is predicted to contain a matrix processing
protease site at amino acid position 44/45 (Claros and Vincens, 1996
).
|
The Tim18 protein is homologous to two other proteins in the yeast
genome. One of these proteins, Sdh4p, is 39.5% identical to Tim18p and
has been reported to encode a membrane anchor for the mitochondrial IM
succinate dehydrogenase complex (Bullis and Lemire, 1994
). The other
protein is 36.4% identical to Tim18p and is an uncharacterized ORF
(YLR164w). Both SDH4p and Ylr164p are 52.6% identical to
each other. The two Tim18p homologues, however, do not suppress the
tim54-1 mutant (Figure 4B). SDH4 and
YLR164w were cloned into 2µ-containing plasmids,
transformed into the tim54-1 mutant, and tested for their
ability to rescue the growth defect of tim54-1 at 34°C.
Multiple copies of SDH4 or YLR164w did not allow
the tim54-1 strain to grow at the nonpermissive temperature.
Only cells that expressed high levels of Tim18p, or a Tim18p-HA fusion
protein (see below), grew at 34°C.
Tim18p Is Located in the Mitochondrial IM with Its Carboxyl Terminus Facing the Intermembrane Space
To identify the function of Tim18p, we determined
the location of Tim18p in the cell. First, we inserted a HA epitope tag at the carboxyl terminus of Tim18p, forming Tim18p-HA. We found that Tim18p-HA is functional, because the growth defect of the tim18::HIS3 disruption is rescued by Tim18p-HA
(Kerscher, unpublished results) and multiple copies of
TIM18-HA suppress the growth defect of the
tim54-1 mutant (Figure 4B). Cells expressing Tim18p-HA were
homogenized and separated into a mitochondrial fraction and a
postmitochondrial supernatant (Figure
5A). We found by immune blotting that
Tim18p-HA cofractionated with the
-subunit of the F1-ATPase (F1
), a mitochondrial protein. No
Tim18p-HA was found in the supernatant along with the cytosolic
hexokinase protein.
|
Supporting our localization data, we found that Tim18p was imported
into isolated mitochondria. Tim18p synthesized in vitro yielded an
~22-kDa 35S-labeled protein after SDS-PAGE
(Figure 5B, lane 1). When incubated with energized mitochondria, Tim18p
was processed to an ~18-kDa protein (Figure 5B, lane 4) that was
protected from externally added protease (Figure 5B, lane 5). When the
potential across the mitochondrial IM was dissipated with CCCP, import
and processing of Tim18p were inhibited (Figure 5B, lane 3). Tim18p is
predicted to contain a mitochondrial processing protease site at amino
acid position 44/45 (Claros and Vincens, 1996
). To test this
possibility, we constructed a truncated version of Tim18p,
Tim18p(44-192), lacking its first 43 amino acids. In vitro synthesized
Tim18p(44-192) comigrates with the imported and processed form of
Tim18p (Figure 5B, compare lanes 2 and 5). Our results thus indicate
that Tim18p is a mitochondrial protein with an amino-terminal cleavable presequence.
Tim18p is located in the mitochondrial IM. First, mitochondria
were isolated from cells expressing Tim18p-HA and treated with either
sodium carbonate or sodium chloride (Figure 5C). Tim18p-HA and the
IM-localized PiC protein (Phelps et al., 1991
) remained in
the membrane pellet after carbonate or salt treatment. In contrast, F1
, a peripheral membrane protein (Chen and Douglas, 1987
), was found in the supernatant after carbonate treatment. To determine in
which of the two mitochondrial membranes Tim18p resides, we prepared
membrane vesicles from Tim18p-HA mitochondria and separated them into
OM and IM fractions on sucrose gradients. As shown in Figure 5D,
Tim18p-HA cofractionates with the IM vesicle fraction, along with the
F1
protein. OM45p, a marker for the OM (Yaffe et al.,
1989
), migrates near the top of the gradient in fractions separate from
Tim18p-HA and F1
.
The carboxyl terminus of Tim18p faces the intermembrane space
(IMS). Tim18p-HA mitochondria were treated with protease either in the
presence or in the absence of an intact OM (Figure 5E). Immune blots
showed that the IM proteins Tim18p-HA, F1
, and Tim23p were all
resistant to digestion in intact mitochondria. In contrast, Tom70p, an
OM protein that faces the cytosol is removed by protease treatment.
When the mitochondrial OM was disrupted by osmotic shock, Tom70p,
Tim23p, and Tim18p-HA were all digested, and only F1
, which faces
the matrix, was protected from the protease. Our antibodies to Tim23p
recognize a domain that faces the IMS, which is accessible to digestion
in mitoplasts (Ryan et al., 1998
). Therefore, we conclude
that the carboxyl-terminal HA tag on Tim18p-HA is located in the IMS.
Tim18p Is Part of the Tim54p-Tim22p Complex in the IM
The genetic experiments described above suggest that Tim18p
physically interacts with Tim54p and Tim22p. To test this idea directly, we asked if Tim54p or Tim22p could be immune precipitated along with Tim18p. Tim18p-HA mitochondria were solubilized with digitonin-containing buffer, and Tim18p-HA was precipitated with antibodies to the HA epitope (Figure 6A).
Using antibodies to the HA epitope to decorate immune blots, we found
that the majority of Tim18p-HA was located in the pellet. Only a small
amount of the Tim18p-HA was not precipitated by the HA antibodies and
remained in the supernatant. When we examined our fractions with
antibodies to Tim22p, we found that virtually all of the Tim22 protein
coprecipitated with Tim18-HA, indicating that Tim22p physically
associates with the Tim18 protein in mitochondria. Using antibodies to
Tim54p, we found that part, but not all, of Tim54p interacts with
Tim18p. Only about half of Tim54p appeared to interact tightly with
Tim18p. This result was similar to the results of previous experiments, in which we found that half of total Tim54p associated with Tim22p (Kerscher et al., 1997
). We also found that the Tim23p or
Tim17p proteins did not coprecipitate with Tim18p-HA, indicating that Tim18p's interaction with
|
|
Supporting our observations that Tim18p is a member of the
Tim54p-Tim22p complex, we found that all three proteins were present in
an ~300-kDa complex after blue native electrophoresis (Figure 6B).
Mitochondria isolated from cells expressing Tim18p-HA, Tim54p-HA, or
Tim22p-HA were solubilized with digitonin-containing buffer, and the
membrane protein complexes were separated on blue native polyacrylamide
gradient gels. The mobility of the different proteins was monitored by
immune blotting with antibodies to the HA epitope. Tim18p-HA comigrated
with Tim54p-HA and Tim22p-HA, both of which were previously shown to be
part of a 300-kDa complex (Koehler et al., 1998b
; Kurz et
al., 1999
). Tim18p was not found in an ~90-kDa complex
containing Tim23p and Tim17p (Dekker et al., 1997
). Tim54p,
Tim22p, and Tim18p thus appear to be part of the same translocon.
Also supporting our conclusion that Tim18p associates with Tim54p and
Tim22p, we found that the mobility of the Tim54p-Tim22p complex was
altered in mitochondria lacking Tim18p (Figure 6C). Mitochondria
isolated from wild-type (WT) and tim18::HIS3 (
) cells were subjected to blue native electrophoresis. In
tim18::HIS3 mitochondria, we found that Tim54p and
a Tim54p-HA fusion protein migrated in a complex of ~200 kDa, in
contrast to the ~300-kDa complex seen with wild-type mitochondria.
Other IM complexes, such as the Tim23p-Tim17p translocon or the PiC
dimer, were not affected by the absence of Tim18p. To
examine the distribution of Tim22p, mitochondria from
wild-type or tim18::HIS3 cells were first
subjected to blue native electrophoresis, and the lane was then cut out
and analyzed by SDS-PAGE. Immune blots showed that Tim22p was located
in an ~300-kDa complex in wild-type mitochondria and in an ~200-kDa
complex in mitochondria lacking Tim18p. In contrast, the OM protein,
Tom40p, was located in an ~400-kDa complex (Dekker et al.,
1997
) in both wild-type and tim18::HIS3 mitochondria.
Several proteins of the intermembrane space, including Tim12p, Tim10p,
and Tim9p, interact with the Tim54p-Tim22p complex (Koehler et
al., 1998a
,b
; Sirrenberg et al., 1998
; Adam et
al., 1999
). All of Tim12p is part of the TIM complex, whereas only a fraction of Tim10p and Tim9p associate with Tim54p and Tim22p. We
found that the interaction of Tim12p with the TIM complex does not
require Tim18p. As shown in Figure 6D, Tim12p is located in an
~300-kDa complex containing Tim54p and Tim22p in wild-type mitochondria and in an ~200-kDa complex in
tim18::HIS3 mitochondria.
tim18::HIS3 Cells Are Cold Sensitive for the Import or Stability of Several IM Proteins
Because Tim18p is part of the Tim54p-Tim22p complex, it is
possible that Tim18p also plays a role in the import of proteins into
mitochondria. Tim54p and Tim22p are required for the insertion of a
number of polytopic proteins into the IM, including PiC and the Tim22
protein (Sirrenberg et al., 1996
; Kerscher et
al., 1997
). However, we found that mitochondria isolated from
tim18::HIS3 cells were not defective in the import
of several proteins, including PiC and Cox4p (Kerscher, unpublished
observations). To determine if Tim18p plays a more subtle role in
import, we took advantage of the cold-sensitive growth defect of
tim18::HIS3 cells grown on glucose-containing
medium. We grew wild-type and tim18::HIS3 strains
in YEPD medium at 34°C, at which tim18::HIS3
cells grow at wild-type rates, and then shifted the cells to 24°C, at
which tim18::HIS3 cells grow very slowly. For
comparison, we also grew TIM18 and
tim18::HIS3 cells at 30 and 34°C. Total protein
was then isolated from these cells, and the level of different
mitochondrial proteins was determined by immune blotting. As shown in
Figure 7,
tim18::HIS3 cells grown at 34°C contained
similar amounts of all mitochondrial IM proteins examined, including
PiC, Tim22, subunit IV of cytochrome oxidase (Cox4p),
Tim54p, Tim23p, and the
-subunit of the
F1ATPase (F1
). In contrast,
tim18::HIS3 cells grown at 24°C contained
greatly reduced levels of PiC, Tim22p, and Cox4p compared with
wild-type cells. At 30°C, the levels of PiC, Tim22, and Cox4p in
tim18::HIS3 cells were reduced, but the amounts
were higher than in tim18::HIS3 cells grown at
24°C. Cells lacking Tim18p appear to be cold sensitive for the import
or stability of at least several IM proteins. Whether this defect is a
direct consequence of the lack of Tim18p or an indirect effect (e.g., caused by the reduced amount of Tim22p) requires further study. Our
results also indicate that Tim18p may not be required for import of all
IM proteins, because we found wild-type levels of Tim54p, Tim23p, and
F1
in tim18::HIS3 cells grown at 24, 30, or
34°C.
|
| |
DISCUSSION |
|---|
|
|
|---|
We have identified a new mitochondrial IM protein named Tim18p.
Several observations suggest that Tim18p, like Tim54p and Tim22p, plays
a role in the import of proteins into mitochondria. For example, we
identified TIM18 as a high-copy suppressor of the
temperature-sensitive tim54-1 mutant. We previously showed that TIM22, when present in multiple copies, likewise
rescues the growth defect of tim54-1 cells (Kerscher
et al., 1997
). Tim18p and Tim22p, therefore, both show a
similar genetic interplay with Tim54p. We also found that the
tim18::HIS3 disruption is lethal in combination
with the tim54-1 mutation. Moreover, we showed that the
cold-sensitive growth defect of the tim18::HIS3
disruption is suppressed by multiple copies of TIM22. Our
results thus provide genetic evidence that Tim18p, Tim22p, and Tim54p
interact and suggest that these three proteins function at a common
step in the import pathway.
We also found evidence for physical interaction between Tim18p, Tim54p,
and Tim22p. These proteins form a complex together, because all three
proteins coimmune precipitated from mitochondrial extracts, and they
comigrated as an ~300-kDa complex during blue native electrophoresis.
The 300-kDa complex is separate from an ~90-kDa complex containing
Tim23p and Tim17p and from the ~400-kDa TOM complex in the OM (Dekker
et al., 1997
). Interestingly, the integrity of the 300-kDa
complex requires the Tim18 protein. Blue native electrophoresis of
mitochondria isolated from tim18::HIS3 cells
showed that Tim54p and Tim22p migrate together as a smaller complex of
~200 kDa, whereas other IM complexes, such as the Tim23p-Tim17p translocon, were not affected. Whether the 100-kDa decrease in size of
the translocon represents the loss of multiple Tim18p subunits or the
loss of other proteins dependent on Tim18p for assembly awaits further
study. Regardless, our results indicate that Tim18p is a new member of
the Tim54p-Tim22p translocon.
Tim18p is homologous to two proteins in yeast, Sdh4p (39.5% identical)
and the uncharacterized ORF YLR164w (36.4% identical). Although both
Sdh4p (Bullis and Lemire, 1994
) and the YLR164w protein (Kerscher,
unpublished data) are mitochondrial IM proteins, neither homologue
appears to be part of the Tim54p-Tim22p-Tim18p complex. Multiple copies
of SDH4 or YLR164w did not suppress the tim54-1 mutant. Furthermore, in preliminary experiments, we
observed that the YLR164w and Sdh4 proteins do not immune precipitate
along with Tim18p (Kerscher, unpublished data). Although the role of YLR164w is unknown, Sdh4p is proposed to function as the membrane anchor for other members of the succinate dehydrogenase complex (Bullis
and Lemire, 1994
). It is possible, therefore, that Tim18p plays an
anchor function in the TIM complex. Arguing against this possibility,
we found that Tim18p is not required for the interaction of Tim12p with
Tim54p and Tim22p. Whether Tim10p, Tim9p, or other import proteins use
Tim18p for their association with Tim54p-Tim22p awaits further studies.
TIM18 encodes a 21.9-kDa protein with a cleavable
presequence. After its import into mitochondria, Tim18p was processed
to an ~18-kDa mature form. Tim18p is predicted to carry a cleavage site for the mitochondrial processing protease, MPP, between
residues 44 and 45 (Claros and Vincens, 1996
). Hydropathy analysis
suggests that Tim18p contains three transmembrane segments, and Tim18p was located in the IM after mitochondrial fractionation. A HA tag
inserted at the carboxyl terminus of Tim18p was digested when mitoplasts were treated with protease. We conclude that the mature form
of Tim18p is inserted in the mitochondrial IM with three transmembrane
segments, with its amino terminus facing the matrix and its carboxyl
terminus exposed to the intermembrane space.
The genetic interactions between TIM18, TIM22,
and TIM54 and our evidence for physical interaction suggest
that Tim18p, like Tim22p and Tim54p, functions in the insertion of
polytopic proteins into the IM. Consistent with such a role, we found
that tim18 mutants contain lower steady-state amounts of
several IM proteins. Nevertheless, Tim18p is not an essential protein
and thus differs from Tim54p and Tim22p. Disruptions of
TIM54 and TIM22 are inviable under all growth
conditions (Sirrenberg et al., 1996
; Kerscher et
al., 1997
), whereas tim18::HIS3 cells are
cold sensitive for growth on glucose-containing medium. Several
possibilities may explain why Tim18p is not essential under most growth
conditions. For example, the function of Tim18p may be redundant,
overlapping with the activity of another mitochondrial protein. In this
case, we speculate that the second Tim18p-like activity is either
absent or reduced when cells are grown on glucose, thus explaining why tim18::HIS3 mutants are defective only on glucose
medium. An alternative possibility is that Tim18p is required for
efficient, but not basal, levels of import. For example, the Tom6 and
Tom7 proteins are nonessential subunits of the TOM complex and modulate
the assembly and disassembly of the TOM complex in the mitochondrial OM, but their role in import can be detected only under special assay
conditions (Alconada et al., 1995
; Honlinger et
al., 1996
). A third possibility why the Tim18 protein is not
essential is that Tim18p may be required for the import of some, but
not all, proteins. For example, each import receptor in the
mitochondrial OM mediates the import of a subset of proteins (Lithgow
et al., 1995
). Similarly, the TRAM protein of the
endoplasmic reticulum translocon is required to translocate only some
substrates (High et al., 1993
). We are currently testing
these possibilities by examining the import of many different proteins
into tim18::HIS3 mitochondria.
Finally, our results also raise the possibility that Tim18p could play
a role in the assembly of IM protein complexes. In particular, we found
that tim18::HIS3 cells grown on glucose medium at
24°C contain reduced levels of Cox4p, in addition to low amounts of
Tim22p and PiC. Although Tim22p and PiC are inserted into the IM by
Tim54p-Tim22p (Sirrenberg et al., 1996
; Kerscher et
al., 1997
), the Cox4p precursor carries an amino-terminal
cleavable presequence and is imported into the mitochondrial matrix via the Tim23p-Tim17p complex (Emtage and Jensen, 1993
). Cox4p, however, is
a subunit of a complex in the IM, and its assembly requires chaperone
activity, including that of the AAA complexes (Arlt et al.,
1998
). Mutants defective in chaperone activity of Yta10p and Yta12p,
subunits of the m-AAA complex, have reduced levels of Cox4p similar to
that seen in tim18::HIS3 cells. In addition, disruptions of YME1 (Thorsness et al., 1993
;
Weber et al., 1996
), a subunit of the i-AAA complex, gives
rise to a cold-sensitive growth defect on glucose-containing medium
similar to tim18::HIS3. Furthermore, both
tim18::HIS3 and yme1 mutants cannot
tolerate the loss of mitochondrial DNA (Thorsness et al.,
1993
). We found in preliminary studies that the import, stability, or
assembly of AAA complex subunits is not defective in
tim18::HIS3 mutants (Kerscher, unpublished data).
The interesting possibility that Tim18p itself is a chaperone or
mediates an interaction with chaperones, such as the i-AAA or m-AAA
complex, awaits future studies.
| |
ACKNOWLEDGMENTS |
|---|
We especially thank Bernard Lemire for
SDH4-containing plasmids. We also thank Jeff Schatz for
antisera to Tom70p and F1
and Mike Yaffe for antiserum to F1
. We
thank Kathy Wilson, Carolyn Machamer, Alyson Aiken, Alison Davis, Scott
Canna, Kara Cerveny, and Hiromi Sesaki for comments on the manuscript.
This work was supported by grant R01-GM46803 from the U.S. Public
Health Service to R.E.J.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: rjensen{at}jhmi.edu.
| |
REFERENCES |
|---|
|
|
|---|
-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.
Science
230, 1350-1354This article has been cited by other articles:
![]() |
C. D. Dunn, Y. Tamura, H. Sesaki, and R. E. Jensen Mgr3p and Mgr1p Are Adaptors for the Mitochondrial i-AAA Protease Complex Mol. Biol. Cell, December 1, 2008; 19(12): 5387 - 5397. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wagner, N. Gebert, B. Guiard, K. Brandner, K. N. Truscott, N. Wiedemann, N. Pfanner, and P. Rehling The Assembly Pathway of the Mitochondrial Carrier Translocase Involves Four Preprotein Translocases Mol. Cell. Biol., July 1, 2008; 28(13): 4251 - 4260. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K. Hwang, S. M. Claypool, D. Leuenberger, H. L. Tienson, and C. M. Koehler Tim54p connects inner membrane assembly and proteolytic pathways in the mitochondrion J. Cell Biol., September 24, 2007; 178(7): 1161 - 1175. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. V. Peixoto, F. Grana, T. J. Roy, C. D. Dunn, M. Flores, R. E. Jensen, and M. L. Campo Awaking TIM22, a Dynamic Ligand-gated Channel for Protein Insertion in the Mitochondrial Inner Membrane J. Biol. Chem., June 29, 2007; 282(26): 18694 - 18701. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Gallas, M. K. Dienhart, R. A. Stuart, and R. M. Long Characterization of Mmp37p, a Saccharomyces cerevisiae Mitochondrial Matrix Protein with a Role in Mitochondrial Protein Import Mol. Biol. Cell, September 1, 2006; 17(9): 4051 - 4062. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Dunn, M. S. Lee, F. A. Spencer, and R. E. Jensen A Genomewide Screen for Petite-negative Yeast Strains Yields a New Subunit of the i-AAA Protease Complex Mol. Biol. Cell, January 1, 2006; 17(1): 213 - 226. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Stribinskis, H.-C. Heyman, S. R. Ellis, M. C. Steffen, and N. C. Martin Rpm2p, a Component of Yeast Mitochondrial RNase P, Acts as a Transcriptional Activator in the Nucleus Mol. Cell. Biol., August 1, 2005; 25(15): 6546 - 6558. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Brandner, P. Rehling, and K. N. Truscott The Carboxyl-terminal Third of the Dicarboxylate Carrier Is Crucial for Productive Association with the Inner Membrane Twin-pore Translocase J. Biol. Chem., February 18, 2005; 280(7): 6215 - 6221. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Muhlenbein, S. Hofmann, U. Rothbauer, and M. F. Bauer Organization and Function of the Small Tim Complexes Acting along the Import Pathway of Metabolite Carriers into Mammalian Mitochondria J. Biol. Chem., April 2, 2004; 279(14): 13540 - 13546. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Hoppins and F. E. Nargang The Tim8-Tim13 Complex of Neurospora crassa Functions in the Assembly of Proteins into Both Mitochondrial Membranes J. Biol. Chem., March 26, 2004; 279(13): 12396 - 12405. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Lister, O. Chew, M.-N. Lee, J. L. Heazlewood, R. Clifton, K. L. Parker, A. H. Millar, and J. Whelan A Transcriptomic and Proteomic Characterization of the Arabidopsis Mitochondrial Protein Import Apparatus and Its Response to Mitochondrial Dysfunction Plant Physiology, February 1, 2004; 134(2): 777 - 789. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Allen, H. Lu, D. Thornton, and K. Tokatlidis Juxtaposition of the Two Distal CX3C Motifs via Intrachain Disulfide Bonding Is Essential for the Folding of Tim10 J. Biol. Chem., October 3, 2003; 278(40): 38505 - 38513. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Dunn and R. E. Jensen Suppression of a Defect in Mitochondrial Protein Import Identifies Cytosolic Proteins Required for Viability of Yeast Cells Lacking Mitochondrial DNA Genetics, September 1, 2003; 165(1): 35 - 45. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Dyall, S. C. Agius, C. De Marcos Lousa, V. Trezeguet, and K. Tokatlidis The Dynamic Dimerization of the Yeast ADP/ATP Carrier in the Inner Mitochondrial Membrane Is Affected by Conserved Cysteine Residues J. Biol. Chem., July 11, 2003; 278(29): 26757 - 26764. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Pray-Grant, D. Schieltz, S. J. McMahon, J. M. Wood, E. L. Kennedy, R. G. Cook, J. L. Workman, J. R. Yates III, and P. A. Grant The Novel SLIK Histone Acetyltransferase Complex Functions in the Yeast Retrograde Response Pathway Mol. Cell. Biol., December 15, 2002; 22(24): 8774 - 8786. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. N. Truscott, N. Wiedemann, P. Rehling, H. Muller, C. Meisinger, N. Pfanner, and B. Guiard Mitochondrial Import of the ADP/ATP Carrier: the Essential TIM Complex of the Intermembrane Space Is Required for Precursor Release from the TOM Complex Mol. Cell. Biol., November 15, 2002; 22(22): 7780 - 7789. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vial, H. Lu, S. Allen, P. Savory, D. Thornton, J. Sheehan, and K. Tokatlidis Assembly of Tim9 and Tim10 into a Functional Chaperone J. Biol. Chem., September 20, 2002; 277(39): 36100 - 36108. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Curran, D. Leuenberger, E. Schmidt, and C. M. Koehler The role of the Tim8p-Tim13p complex in a conserved import pathway for mitochondrial polytopic inner membrane proteins J. Cell Biol., September 16, 2002; 158(6): 1017 - 1027. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Roesch, S. P. Curran, L. Tranebjaerg, and C. M. Koehler Human deafness dystonia syndrome is caused by a defect in assembly of the DDP1/TIMM8a-TIMM13 complex Hum. Mol. Genet., March 1, 2002; 11(5): 477 - 486. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Murphy, D. Leuenberger, S. P. Curran, W. Oppliger, and C. M. Koehler The Essential Function of the Small Tim Proteins in the TIM22 Import Pathway Does Not Depend on Formation of the Soluble 70-Kilodalton Complex Mol. Cell. Biol., September 15, 2001; 21(18): 6132 - 6138. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sesaki and R. E. Jensen UGO1 Encodes an Outer Membrane Protein Required for Mitochondrial Fusion J. Cell Biol., March 12, 2001; 152(6): 1123 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Geissler, T. Krimmer, U. Bömer, B. Guiard, J. Rassow, and N. Pfanner Membrane Potential-Driven Protein Import into Mitochondria. The Sorting Sequence of Cytochrome b2 Modulates the Delta psi -Dependence of Translocation of the Matrix-targeting Sequence Mol. Biol. Cell, November 1, 2000; 11(11): 3977 - 3991. [Abstract] [Full Text] |
||||
![]() |
A. J. Davis, N. B. Sepuri, J. Holder, A. E. Johnson, and R. E. Jensen Two Intermembrane Space TIM Complexes Interact with Different Domains of Tim23p during Its Import into Mitochondria J. Cell Biol., September 18, 2000; 150(6): 1271 - 1282. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Saeki, H. Suzuki, M. Tsuneoka, M. Maeda, R. Iwamoto, H. Hasuwa, S. Shida, T. Takahashi, M. Sakaguchi, T. Endo, et al. Identification of Mammalian TOM22 as a Subunit of the Preprotein Translocase of the Mitochondrial Outer Membrane J. Biol. Chem., October 6, 2000; 275(41): 31996 - 32002. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Suzuki, Y. Okazawa, T. Komiya, K. Saeki, E. Mekada, S. Kitada, A. Ito, and K. Mihara Characterization of Rat TOM40, a Central Component of the Preprotein Translocase of the Mitochondrial Outer Membrane J. Biol. Chem., November 22, 2000; 275(48): 37930 - 37936. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||