![]() |
|
|
Vol. 11, Issue 11, 3777-3789, November 2000
Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, and Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, Massachusetts 02115
Submitted July 7, 2000; Revised August 16, 2000; Accepted August 23, 2000| |
ABSTRACT |
|---|
|
|
|---|
In Saccharomyces cerevisiae, the 60S ribosomal subunit assembles in the nucleolus and then is exported to the cytoplasm, where it joins the 40S subunit for translation. Export of the 60S subunit from the nucleus is known to be an energy-dependent and factor-mediated process, but very little is known about the specifics of its transport. To begin to address this problem, an assay was developed to follow the localization of the 60S ribosomal subunit in S. cerevisiae. Ribosomal protein L11b (Rpl11b), one of the ~45 ribosomal proteins of the 60S subunit, was tagged at its carboxyl terminus with the green fluorescent protein (GFP) to enable visualization of the 60S subunit in living cells. A panel of mutant yeast strains was screened for their accumulation of Rpl11b-GFP in the nucleus as an indicator of their involvement in ribosome synthesis and/or transport. This panel included conditional alleles of several rRNA-processing factors, nucleoporins, general transport factors, and karyopherins. As predicted, conditional alleles of rRNA-processing factors that affect 60S ribosomal subunit assembly accumulated Rpl11b-GFP in the nucleus. In addition, several of the nucleoporin mutants as well as a few of the karyopherin and transport factor mutants also mislocalized Rpl11b-GFP. In particular, deletion of the previously uncharacterized karyopherin KAP120 caused accumulation of Rpl11b-GFP in the nucleus, whereas ribosomal protein import was not impaired. Together, these data further define the requirements for ribosomal subunit export and suggest a biological function for KAP120.
| |
INTRODUCTION |
|---|
|
|
|---|
Although eukaryotic ribosomes function in the cytoplasm, the
synthesis, processing, and assembly of the ribosomal subunits in
Saccharomyces cerevisiae and higher eukaryotes occur in the nucleolus. The entire ribosome is composed of four rRNA species and
~75 ribosomal proteins (r-proteins) distributed between two subunits.
The 18S, 5.8S, and 25S rRNAs are derived from a single 35S rRNA
precursor that is synthesized by RNA polymerase I and then processed by
a series of endonucleolytic and exonucleolytic cleavages (reviewed by
Kressler et al., 1999
; Venema and Tollervey, 1999
). The 5S
rRNA is synthesized separately by RNA polymerase III and associates
with the 60S preribosomal subunit early in assembly. The mature 40S
ribosomal subunit contains the 18S rRNA and ~32 r-proteins, whereas
the 60S subunit is composed of the 5S, 5.8S, and 25S rRNAs and ~45
r-proteins. Proper assembly of each ribosomal subunit requires the
coordination of several events, including the synthesis and import of
r-proteins, the synthesis and processing of rRNA, and the concomitant
assembly of r-proteins into the preribosomal subunits. Although a
pathway for 35S rRNA maturation has been well defined through both
genetic and biochemical approaches (reviewed by Kressler et
al., 1999
; Venema and Tollervey, 1999
), less is known about the
association of r-proteins with the rRNA and the export of the assembled
subunits out of the nucleus.
All nucleocytoplasmic transport occurs through the nuclear pore complex
(NPC). The yeast NPC is composed of multiple copies of ~30 different
nuclear pore proteins referred to as nucleoporins (Rout et
al., 2000
). Together, these nucleoporins form the overall structure of the NPC, which consists of a membrane-embedded central core with fibrils protruding from its cytoplasmic face and a
basket-like structure that extends out on the nuclear side (Yang
et al., 1998
; Stoffler et al., 1999
; Allen
et al., 2000
). The active nuclear pore can accommodate
transport of large macromolecules, including export of the ribosomal subunits.
Transport of cargo into and out of the nucleus requires not only
interactions with the NPC but also soluble transport factors. The best
defined transport path is the import of proteins containing a classic
nuclear localization signal (NLS) by the importin
/
receptor
(reviewed by Corbett and Silver, 1997
; Gorlich and Kutay, 1999
; Wente,
2000
). Importin
/Srp1 recognizes and binds to proteins containing a
NLS and together with importin
/Rsl1 travels through the NPC.
Thirteen importin
homologues termed karyopherins were identified in
S. cerevisiae by sequence comparison to importin
(Gorlich et al., 1997
). These karyopherins act as receptors for specific import and export cargoes. Transport substrates for several of the karyopherins have already been identified (reviewed by
Gorlich and Kutay, 1999
). The nucleotide-bound state of the small
GTPase Ran/Gsp1 imparts directionality to transport (Gorlich et al., 1996
; Izaurralde et al., 1997
).
Dissociation of the karyopherin-cargo complex in the nucleus is
mediated by RanGTP association (Rexach and Blobel, 1995
; Chi et
al., 1996
; Gorlich et al., 1996
), whereas GTP
hydrolysis in the cytoplasm results in the release of export cargo
(Bischoff and Gorlich, 1997
; Floer et al., 1997
; Lounsbury and Macara, 1997
). In yeast, the high concentration of RanGTP in the
nucleus is maintained by the guanine nucleotide exchange factor Prp20
(Amberg et al., 1993
; Kadowaki et al., 1993
), and the cytoplasmic pool of RanGDP is generated by the
GTPase-activating protein Rna1 (Becker et al., 1995
).
The mechanism by which the transport complexes travel through the NPC
is not as clear.
Microinjection experiments in Xenopus oocytes demonstrated
that ribosomal subunit export is an energy-dependent, factor-mediated, and unidirectional process that requires components of the NPC (Bataille et al., 1990
). In addition, export of
microinjected 40S ribosomal subunits does not compete with export of
tRNA out of the nucleus, indicating separate pathways for export
(Pokrywka and Goldfarb, 1995
). A role for the GTPase Ran in ribosome
assembly or export was proposed based on the observation that rRNA
processing is delayed in yeast strains bearing conditional alleles of
either of the Ran regulators PRP20 or RNA1
(Traglia et al., 1989
; Kadowaki et al., 1993
).
These early observations were recently confirmed for both the 40S and
60S ribosomal subunits with the use of two independent assays (Hurt
et al., 1999
; Moy and Silver, 1999
). Mutation of the Ran
regulators Rna1, Prp20, and Yrb1 caused the 40S ribosomal subunit to
accumulate in the nucleus of yeast, as determined by in situ
hybridization to 20S rRNA (Moy and Silver, 1999
). In addition to the
Ran regulators, a subset of nucleoporin mutations and a
temperature-sensitive mutation of the nuclear export sequence receptor
Xpo1/Crm1 also blocked export of the 40S ribosomal subunit (Moy and
Silver, 1999
). The 60S ribosomal subunit also accumulated in the
nucleus of yeast strains bearing conditional alleles of RNA1
and PRP20, as determined by the localization of a fusion
between the ribosomal protein L25 (Rpl25) and the green fluorescent
protein (GFP) (Hurt et al., 1999
). In addition, temperature-sensitive mutations of the nucleoporins Nsp1, Nup49, and
Nic96 also caused mislocalization of the 60S ribosomal subunit (Hurt
et al., 1999
). It is likely that the factors identified to
date represent only a subset of the transport factors required for
ribosome export.
Here we describe an assay to follow the localization of the 60S
ribosomal subunit in S. cerevisiae with the use of a fusion between the ribosomal protein L11b (Rpl11b) and GFP. This assay differs
from the Rpl25-GFP export assay described previously (Hurt et
al., 1999
) in that nuclear accumulation of Rpl11b-GFP can be detected under conditions of logarithmic growth. A large panel of
mutant yeast strains were screened for defects in 60S ribosomal subunit
assembly and transport with the use of this assay. Surprisingly, deletion of KAP120, one of the nonessential karyopherins,
caused a strong accumulation of the 60S ribosomal subunit in the
nucleus. Further characterization revealed that kap120
cells have a slight delay in rRNA processing and a significant
reduction in free 60S ribosomal subunits.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Strains
Table
1 lists
the yeast strains used in this study. The strains PSY2083 and PSY2084
were constructed by replacing the ORF of RPL11A and
RPL11B with HIS3 by means of a PCR-based method (Baudin et al., 1993
). The haploid strain PSY685 was
transformed with a HIS3 PCR product targeted to the
RPL11A locus to generate PSY2083, and PSY581 was transformed
with a HIS3 PCR product targeted to the RPL11B
locus to create PSY2084. Disruptions of RPL11A and RPL11B were verified by Southern blot analysis (Southern,
1975
).
|
Yeast strains lacking wild-type copies of both RPL11A and
RPL11B were generated by crossing PSY2083 carrying a
wild-type copy of RPL11A on a URA3 CEN plasmid to
PSY2084. The diploid was sporulated, and tetrads were analyzed.
HIS+ and 5-FOA-sensitive
(FOAS) spores in tetrads that segregated 2:2
HIS+:his
and 2:2
FOAS:FOAR
(5-FOA-resistant) were identified as the double mutant strain rpl11a::HIS3
rpl11b::HIS3.
Plasmids
The LEU2 CEN (pPS2167) and TRP1 CEN
(pPS2168) RPL11B-GFP plasmids were constructed as follows.
Yeast genomic DNA was amplified by PCR with a 5' primer that annealed
891 base pairs 5' of the ORF for RPL11B
(5'GCATCTACTAGTGCAGGATTACGAAGACTTC3') and a 3' primer that annealed to
the 3' end of RPL11B excluding the stop codon
(5'CAGTCACTCGAGCTTTATCGAGCACATCAGCG3'). The PCR product was digested
with SpeI and XhoI and cloned into the
SpeI-XhoI site of either a LEU2 or a
TRP1 CEN vector that contained the ORF of GFP followed by
the 3' untranslated region of NUF2 (Kahana and Silver,
1998
). To generate the URA3 CEN RPL11B-GFP
plasmid (pPS2169), a NotI-XhoI fragment of
pPS2167 was cloned into the NotI-XhoI site of a
URA3 CEN plasmid that contained GFP and
the 3' untranslated region of NUF2 (Kahana and Silver,
1998
). The wild-type RPL11A clone YCp50L16A (RPL11A
URA3 CEN) was provided by J. Woolford (Carnegie Mellon
University, Pittsburgh, PA) (Rotenberg et al., 1988
).
Separation of Ribosomal Subunits
Yeast cells expressing Rpl11b-GFP from pPS2167 were grown in
100 ml of synthetic complete medium lacking leucine
(leu
) to a density of 1 × 107 cells/ml at 25°C. Cells were harvested by
centrifugation at 2000 rpm at room temperature and washed with buffer B
(50 mM Tris-Cl, pH 7.5, 50 mM NaCl, 1 mM DTT [Foiani et
al., 1991
]). Lysate was prepared by glass-bead disruption of cell
pellets resuspended in buffer B containing protease inhibitors (1 mM
PMSF and 2.5 µg/ml each pepstatin A, leupeptin, chymostatin, and
aprotinin). Lysate (200 µg of total RNA) was loaded onto a 10 ml
7-30% sucrose gradient prepared in buffer B and centrifuged at 39,000 rpm for 2.5 h at 4°C. Sucrose gradient profiles were recorded by
absorption at 254 nm, and 0.5-ml fractions were collected.
Total protein was precipitated from each 0.5 ml sucrose gradient
fraction by the addition of ice-cold trichloroacetic acid to a final
concentration of 12% and incubation overnight at
20°C. The
fractions were pelleted by centrifugation at 14,000 rpm for 15 min at
4°C, and pellets were washed two times with 200 µl of ice-cold
100% acetone. Dried pellets were resuspended in 90 µl of 1× gel
sample buffer (10% glycerol, 2% SDS, 0.1 M DTT, 0.1% bromphenol blue), and 10 µl of each fraction was separated on a 10% SDS-polyacrylamide gel followed by transfer to a nitrocellulose membrane by standard methods (Sambrook et al., 1989
). For
GFP detection, anti-GFP was used at a 1:2500 dilution in PBST (PBS, 0.25% Tween 20) plus 2.5% milk for 1 h at 25°C. HRP-conjugated anti-rabbit secondary antibody (Jackson Immunoresearch, West Grove, PA) was used at a dilution of 1:5000 in PBST plus milk, and ECL (Amersham Pharmacia Biotech, Uppsala, Sweden) was used to detect immunoreactive bands.
Rpl11b-GFP Localization Assay
Yeast strains expressing Rpl11b-GFP were grown in selective
medium (12 ml) to 1-2 × 107 cells/ml at
25°C. Strains that were ade2 were grown in selective medium supplemented with 20 µg/ml adenine sulfate. Before shifting the culture to the nonpermissive growth temperature, a 3-ml aliquot was
removed and cells were fixed by the addition of formaldehyde to 3.7%
and incubation with agitation at 25°C. After 30 min, the fixed cells
were collected, washed two times with 1 ml of 0.1 M potassium
phosphate, pH 6.5 (KPi), and stored in 1 ml of solution P (0.1 M KPi,
pH 6.5, 1.2 M sorbitol) at 4°C. The remaining culture was shifted to
either 37°C for temperature-sensitive strains or 15°C for
cold-sensitive strains. The length of the shift depended on the yeast
strain being tested and the onset of its growth defect as determined
from the literature. At the end of the temperature shift, a 3-ml
aliquot was fixed as described above with incubation at the shift
temperature (37 or 15°C). The culture was then shifted back to
25°C, and aliquots were removed at 30 and 60 min and fixed at 25°C
as described. After permeabilization with 0.5% Triton X-100 for 10 min
at room temperature, cell nuclei were stained with DAPI at a final
concentration of 1 µg/ml for 3 min at room temperature. Cells were
washed two times with 1 ml of 1× PBS and stored at 4°C in 100-200
µl of 1× PBS. Rpl11b-GFP was visualized by fluorescence microscopy
as described previously with the use of a Nikon (Garden City, NY)
microscope (Ferrigno et al., 1998
). Images of cells were
captured with a Princeton Instruments (Trenton, NJ) Micromax camera and
Metamorph Imaging software (Universal Imaging, Westchester, PA).
Pulse-Chase Labeling of rRNA
Yeast cultures (100 ml) were grown in synthetic complete medium
lacking methionine (met
) to 1 × 107 cells/ml at 25°C. Cells were harvested by
centrifugation at 2000 rpm and resuspended in 3 ml of
met
medium. To label rRNA specifically, 250 µCi of [3H-methyl]-methionine (specific
activity, 70-85 Ci/mmol; Amersham Pharmacia Biotech) was added, and
cells were incubated for 3 min at 25°C. At 3 min, unlabeled
methionine in met
medium was added to a final
concentration of 5.1 mM, and at chase times of 15 s, 2 min 15 s, and 9 min 15 s, 1 ml aliquots of cells were removed from the
reaction. Cells were collected by brief centrifugation, the supernatant
was removed, and the pellets were frozen on dry ice. Processing of each
sample took ~45 s, so this time was included in the time of chase,
giving 1-, 3-, and 10-min chase time points.
Total RNA was extracted from labeled cells by hot acid phenol treatment
as described previously (Lundblad, 1997
), and 10,000 cpm of each sample
was separated on a 1.2% formaldehyde agarose gel. RNA was transferred
to a Hybond-N+ membrane (Amersham Pharmacia
Biotech) by vacuum transfer (VacuGene XL, Amersham Pharmacia Biotech),
and the membrane was sprayed with EN3HANCE (New
England Nuclear, Boston, MA) before exposure to film for 3 d at
80°C.
| |
RESULTS |
|---|
|
|
|---|
Rpl11b-GFP Serves as a Marker for the 60S Ribosomal Subunit in S. cerevisiae
Rpl11 is one of the ~45 ribosomal proteins that together with
5S, 5.8S, and 25S rRNA forms the 60S ribosomal subunit in S. cerevisiae. Like many of the r-proteins in yeast, Rpl11 is
expressed from two gene copies, RPL11A and RPL11B
(Woolford et al., 1979
; Leer et al., 1984
). These
two copies code for 99% identical proteins; however, the level of
expression from each copy differs significantly (Rotenberg et
al., 1988
). Two-thirds of Rpl11 expressed in yeast is from the B
copy and one-third is from the A copy. Deletion of both
RPL11A and RPL11B is lethal, indicating that
Rpl11 is an essential component of the 60S subunit in yeast (Rotenberg et al., 1988
). Rpl11 associates with the preribosomal
subunit late in the assembly pathway, presumably after the 35S rRNA
precursor is cleaved into its 40S and 60S components (Kruiswijk
et al., 1978
; Kressler et al., 1999
). We chose to
use Rpl11b as a marker for the 60S subunit because it is an essential
component of the 60S subunit, it binds specifically to the 60S
preribosomal subunit, and it is expressed at a higher level than
Rpl11a. Because a fusion between Rpl11a and
-galactosidase was
functional in yeast (Tsay et al., 1994
), we predicted that
the addition of the much smaller GFP to the carboxyl terminus of Rpl11b
would also produce a functional fusion protein. In addition, the GFP
tag would allow visualization of the 60S ribosomal subunit in living cells.
For Rpl11b-GFP to serve as a reporter for the 60S ribosomal subunit, it must meet three criteria. First, Rpl11b-GFP must be able to functionally replace endogenous Rpl11; second, the localization of Rpl11b-GFP in the cell must reflect that of the 60S ribosomal subunit; and third, the majority of Rpl11b-GFP expressed in the cell must be incorporated into the 60S ribosomal subunit.
A low-copy LEU2 plasmid bearing GFP fused
in frame to the 3' end of RPL11B was constructed. The 5'
promoter of RPL11B was used to drive expression of the
fusion protein. A genetic background in which RPL11B is
required for viability was generated to verify that
RPL11B-GFP was functional in yeast. A diploid
strain disrupted for one copy of each RPL11A and
RPL11B by replacement with HIS3 and carrying a
wild-type copy of RPL11A on a URA3 CEN plasmid was constructed. The diploid was sporulated, and the resulting tetrads
were analyzed to identify tetrads that segregated 2:2 his
:HIS+ and 2:2
FOAR:FOAS, indicating the
presence of two wild-type (RPL11A RPL11B) and two double
mutant spores (rpl11a::HIS3
rpl11b::HIS3), respectively. An example tetrad is shown
in Figure 1A (left), where spores a and d
do not grow on synthetic complete medium containing FOA and thus
require the RPL11A URA3 CEN plasmid for cell viability, and
spores b and c, the wild-type spores, are FOA-resistant. Spores a and d
were no longer FOA-sensitive when transformed with the RPL11B-GFP LEU2 CEN plasmid (Figure 1A, right),
indicating that RPL11B-GFP is a functional gene
fusion.
|
The localization of Rpl11b-GFP in wild-type yeast cells grown to early log phase was determined by fluorescence microscopy. Rpl11b-GFP is predominantly cytoplasmic and for the most part excluded from both the vacuoles (v) and the nucleus (n) (Figure 1B, arrows). This localization is consistent with the steady-state cytoplasmic location of 60S ribosomal subunits active in translation. To verify that the GFP signal seen in the cytoplasm is due to intact Rpl11b-GFP, lysate prepared from wild-type yeast cells expressing Rpl11b-GFP was run on a 10% SDS-polyacrylamide gel and immunoblotted with anti-GFP (Figure 1B, right). A single polypeptide migrating just under 50 kDa was present, consistent with the predicted molecular mass of ~47 kDa for a fusion between ~20-kDa Rpl11b and 27-kDa GFP.
The incorporation of Rpl11b-GFP into the 60S ribosomal subunit was
verified by preparing lysate from wild-type yeast cells expressing
Rpl11b-GFP and separating the individual ribosomal subunits by
high-speed sucrose gradient centrifugation. Fractions from the sucrose
gradient were assayed for the presence of Rpl11b-GFP by separation on
a 10% SDS gel and immunoblotting with anti-GFP. As
seen in Figure 2, Rpl11b-GFP sedimented
with the 60S ribosomal subunit and only trace amounts of Rpl11b-GFP
were detectable in the 40S subunit and soluble fractions of the sucrose
gradient. The gradient profile and distribution of Rpl11b-GFP were
similar for a yeast strain that has GFP integrated at the 3' end of the genomic copy of RPL11B (our unpublished results).
|
60S Ribosomal Subunit Localization Assay
An assay was developed to screen for factors involved in ribosome
subunit synthesis or export with the use of Rpl11b-GFP as a marker for
the 60S ribosomal subunit. Mutant yeast cells expressing Rpl11b-GFP
were grown to early log phase in liquid culture at 25°C, shifted to
the nonpermissive growth temperature to induce the mutant phenotype,
and then shifted back to the permissive growth temperature to induce
new ribosomal protein synthesis. Yeast cells were formaldehyde fixed,
their nuclei were stained with DAPI at each step of the assay, and the
localization of Rpl11b-GFP was determined by fluorescence microscopy.
The location and distribution of Rpl11b-GFP in cells was not affected
by the fixing procedure. The shift back to the permissive temperature
was required because synthesis of ribosomal proteins, and thus of the
reporter Rpl11b-GFP, is reduced at 37°C in yeast (Gorenstein and
Warner, 1976
; Kim and Warner, 1983
; Hurt et al., 1999
). A
yeast strain that is defective in 60S ribosomal subunit assembly or
transport should accumulate Rpl11b-GFP in the nucleus upon shifting
back to the permissive temperature if the rate of ribosome synthesis is
faster than the rate at which the mutant phenotype reverses. The 60S
ribosomal subunit should remain cytoplasmic in wild-type yeast cells
throughout this assay. As seen in Figure
3, Rpl11b-GFP is cytoplasmic in a
wild-type strain after a 1-h shift to 37°C (Figure 3a) and after shifting the cells back to 25°C for 30 min (Figure 3c). The GFP signal was not as bright at 37°C, consistent with a reduction in
r-protein synthesis at this temperature. Because this assay depends on
the synthesis, import, and assembly of Rpl11b-GFP into the 60S
subunit, mutants that slow the import of r-proteins, inhibit rRNA
synthesis or processing, or reduce import of any factor required for
ribosome transport may also affect Rpl11b-GFP localization.
|
Yeast Strains Defective in Ribosome Assembly Accumulate Rpl11b-GFP in the Nucleus
Proper assembly of 60S ribosomal subunits is required for
their export from the nucleus (Gorlich and Kutay, 1999
). Therefore, yeast mutants that are defective in 60S ribosomal subunit assembly may
alter the steady-state localization of Rpl11b-GFP. To test this
prediction, several ribosomal assembly mutants, including mtr4-1/dob1-1, nop1-3, fal1-1,
nsr1
, and rat1-1, were screened for effects on
Rpl11b-GFP localization. Mtr4p/Dob1p is involved in the processing of
7S rRNA to mature 5.8S rRNA, and mutations cause defects in 60S
ribosomal subunit assembly (de la Cruz et al., 1998
). The
location of Rpl11b-GFP in mtr4-1 cells grown to early log
phase, shifted to 37°C for 1 h, and then shifted back to 25°C
was determined by fluorescence microscopy. As predicted for an assembly
mutant, Rpl11b-GFP accumulated in the nucleus of >70% of
mtr4-1 cells as early as 30 min after shifting back to the
permissive temperature (Figure 3g). The fluorescent signal overlaps
with the DAPI signal, indicating that Rpl11b-GFP is in the nucleus of
mtr4-1 cells (Figure 3h). Similar results were obtained with
the dob1-1 mutation, although the defect was even more
pronounced in this strain. Rpl11b-GFP accumulated in the nucleus of
>90% of dob1-1 cells after the shift back to 25°C.
The data for all of the ribosomal assembly mutants tested are
summarized in the fourth column of Table
2. The temperature-sensitive nop1-3 strain that has defects in rRNA methylation and 60S
subunit assembly mislocalized Rpl11b-GFP to the nucleus of 20-25% of
cells after shifting back to the permissive temperature. Unexpectedly, fal1-1 and to a greater extent nsr1
cells also
accumulated Rpl11b-GFP in the nucleus. Both mutations inhibit cleavage
of the 35S rRNA at sites that divide the precursor into the 40S (20S
RNA) and 60S precursor RNAs (27SA2 RNA). These
strains have a reduced level of mature 18S rRNA and therefore are
considered to be primarily defective in 40S ribosomal subunit assembly
(Kondo and Inouye, 1992
; Kondo et al., 1992
; Lee et
al., 1992
; Kressler et al., 1997
). The localization of
Rpl11b-GFP was not altered in yeast cells bearing a mutation of the 5'
to 3' exonuclease Rat1 that is involved in the conversion of the
7SS RNA precursor to 5.8SS
rRNA (Amberg et al., 1992
; Henry et al., 1994
).
|
Several Nucleoporin Mutations Cause Rpl11b-GFP to Accumulate in the Nucleus
Eighteen nucleoporin mutants were screened for their effect on
Rpl11b-GFP localization, and the results for two of these mutants are
shown in Figure 4A. Nup157 is a
nonessential nucleoporin that is one of the core nuclear pore proteins
(Aitchison et al., 1995b
). Rpl11b-GFP remained
cytoplasmic in nup157-2 cells throughout the localization
assay (Figure 4A, a and c). In contrast, mutation of NUP120
(rat2-2), a nucleoporin implicated in mRNA export,
accumulated Rpl11b-GFP in the nucleus of >50% of cells 30 min after
shifting back to the permissive temperature (Figure 4A, g). The change in Rpl11b-GFP localization in nup120 cells was not due to
accumulation of free Rpl11b-GFP because Rpl11b-GFP remained in the
60S ribosomal subunit throughout the assay, as determined by sucrose
gradient analysis (our unpublished results).
|
The results for all of the nucleoporin mutants screened for mislocalization of the 60S ribosomal subunit are summarized in Table 2. Temperature-sensitive alleles of the essential nucleoporins NSP1, NUP1, NUP49, NUP82, NIC96, and NUP159 all caused a strong accumulation of Rpl11b-GFP in the nucleus after shift back to the permissive temperature (Table 2). In addition, several of these strains accumulated Rpl11b-GFP in the nucleus at the permissive temperature (Table 2). Interestingly, nup85 cells accumulated Rpl11b-GFP in the nucleus at the permissive temperature of 25°C before shifting to 37°C and appeared to concentrate Rpl11b-GFP in the nucleolus after 1 h at 37°C. Not all of the nucleoporin mutants tested accumulated Rpl11b-GFP in the nucleus (Table 2), indicating that there is some degree of specificity for the 60S ribosomal subunit.
Transport Factors
Several known transport factors, including mutations of the
RAN regulators PRP20 and RNA1, were
screened for accumulation of Rpl11b-GFP in the nucleus, and the
results are shown in Table 2. Both prp20-1 and
rna1-1 cells accumulated Rpl11b-GFP in the nucleus after
shift back to the permissive temperature; however, the defect was
present in only ~25% of the cells. A temperature-sensitive mutation
of the Ran-binding protein Yrb1 caused a strong accumulation of
Rpl11b-GFP in the nucleus. Mutations in the hnRNP-like protein Npl3
and its importer Mtr10 also caused accumulation of Rpl11b-GFP in the
nucleus. Rpl11b-GFP also accumulated in the nucleus of cells bearing
mutant alleles of RAT8, a gene that codes for a helicase
that is implicated in mRNA export (Snay-Hodge et al., 1998
;
Tseng et al., 1998
). Not all mutations that cause defects in
mRNA export mislocalized Rpl11b-GFP, because mutation of the RNA
export factor Mex67 did not block export of Rpl11b-GFP from the nucleus.
Karyopherins
Mutations of importin
(SRP1), importin
(RSL1), and 12 additional karyopherins were screened for
their effect on 60S ribosomal subunit localization (Table 2).
Temperature-sensitive mutations of the NLS receptor SRP1
(srp1-31) and of the importin
receptor RSL1
(rsl1-4) both caused Rpl11b-GFP to accumulate in the
nucleus. A cold-sensitive mutation of CSE1
(cse1-1), the export receptor for Srp1, also caused
Rpl11b-GFP to accumulate in cells shifted to 15°C. The results for
two nonessential karyopherins, MSN5 and KAP120,
are shown in Figure 4B. Deletion of MSN5 did not alter the
cytoplasmic localization of Rpl11b-GFP at either 37 or 25°C (Figure
4B, a-d), whereas deletion of KAP120 caused a surprisingly strong mislocalization of Rpl11b-GFP in the nucleus at 25°C (Figure 4B, g). Rpl11b-GFP was trapped in the nucleus of >90% of
kap120
cells even before shifting to 37°C, whereas at
37°C, when ribosomal protein synthesis was reduced, Rpl11b-GFP was
distributed throughout the cell (Figure 4B, e).
Deletion of NMD5, the yeast homologue of the mammalian
ribosomal protein importer RanBP7 (Gorlich et al., 1997
;
Jakel and Gorlich, 1998
), also caused a strong nuclear accumulation of
Rpl11b-GFP at 25°C. Deletion of KAP123, one of the
ribosomal protein importers in yeast (Rout et al., 1997
),
and a temperature-sensitive mutant of KAP104, the yeast
homologue of the mammalian ribosomal protein importer transportin
(Jakel and Gorlich, 1998
), also caused the 60S subunit to accumulate in
the nucleus to a lesser extent. Although Pse1 has been implicated in
the import of ribosomal proteins (Rout et al., 1997
), the
60S reporter Rpl11b-GFP remained in the cytoplasm of pse1-1
cells throughout the localization assay. Interestingly, Rpl11b-GFP
also accumulated in ~30% of xpo1-1 cells that were first
shifted to 37°C for 1 h and then shifted back to 25°C for 1 h. Xpo1 is the receptor for nuclear export signal-containing proteins (Stade et al., 1997
). Deletion of the karyopherins
KAP114, SXM1, and LOS1 had no effect
on the localization of the 60S ribosomal subunit (Table 2).
Deletion of KAP120 Causes a Delay in rRNA Processing and a Reduction in the Level of 60S Ribosomal Subunits
Because Kap120 is one of the few karyopherins whose transport
substrate(s) has not yet been identified and whose function is not
known, we chose to characterize the 60S export defect in kap120
cells in more detail. Processing of the 35S rRNA
precursor was analyzed in kap120
cells to investigate
whether nuclear accumulation of Rpl11b-GFP was due to a defect in
ribosomal rRNA maturation. The 35S rRNA precursor can be specifically
labeled with [3H]methionine because rRNA is
highly methylated in vivo. To follow the processing of the 35S rRNA
precursor, KAP120 and kap120
strains were
grown to 1 × 107 cells/ml at 25°C, pulse
labeled with [3H]methionine for 3 min, and then
chased with an excess of unlabeled methionine for up to 10 min.
Conversion of the 35S rRNA precursor to the mature 25S and 18S rRNAs
was nearly complete after 10 min of chase with unlabeled methionine for
wild-type KAP120 cells (Figure
5). In contrast, deletion of
KAP120 led to an accumulation of the 35S rRNA precursor that
was still detectable after 10 min of chase (Figure 5). A 23S aberrant
RNA species was also detected in kap120
cells at early
chase times (Figure 5). Although rRNA processing was delayed in
kap120
cells, the levels of mature 25S and 18S rRNA were
not depleted significantly (Figure 5).
|
Because a delay in rRNA processing is often indicative of a ribosome
assembly defect, the ratio of 60S to 40S ribosomal subunits in
kap120
and KAP120 cells was determined.
Lysates prepared from kap120
and KAP120 cells
grown at 25°C were subjected to sucrose gradient sedimentation to
separate the individual subunits. The subunit peaks were detected by
their absorption at 254 nm. As seen in the sucrose gradient profiles in
Figure 6, deletion of KAP120
reduced the 60S ribosomal subunit peak significantly compared with the
wild-type KAP120 strain. The level of 40S ribosomal
subunits, however, was reduced only slightly in kap120
cells (Figure 6).
|
The accumulation of Rpl11b-GFP in the nucleus of kap120
cells was not an indirect effect of trapping mRNA in the nucleus. Polyadenylated RNA was localized throughout the cytoplasm of
kap120
cells, as determined by in situ hybridization with
a digoxigenin-labeled oligo-dT probe (our unpublished results). In
addition, nuclear accumulation of Rpl11b-GFP in kap120
cells was not due to free Rpl11b-GFP because Rpl11b-GFP was
incorporated in the 60S ribosomal subunit, as determined by sucrose
gradient analysis (our unpublished results). Although it is possible
that Kap120 is another ribosomal protein importer, it does not import
either Rpl11 or Rpl25. Rpl11b-GFP and a Rpl25-NLS-GFP-GFP reporter
are both localized in the nucleus of kap120
cells at
25°C, indicating that their import is not blocked. In contrast, the
Rpl25-NLS-GFP-GFP reporter is distributed in both the cytoplasm and
the nucleus of cells deleted for KAP123, an Rpl25 importer
(our unpublished results).
| |
DISCUSSION |
|---|
|
|
|---|
To further our understanding of 60S ribosomal subunit assembly and
export, we have designed an assay that uses Rpl11b-GFP to follow 60S
ribosomal subunit localization in yeast. Mutant yeast strains that are
defective for 60S ribosomal subunit assembly or export accumulate
Rpl11b-GFP in the nucleus upon shifting cells from the nonpermissive
growth temperature back to the permissive growth temperature. The shift
back to the permissive growth temperature is required to increase the
nuclear pool of Rpl11b-GFP available for ribosome biogenesis because
r-protein synthesis in yeast is reduced under mild stress conditions
(Gorenstein and Warner, 1976
; Kim and Warner, 1983
). Using this assay,
we identified mutations in several nucleoporins and transport factors
that trap the 60S ribosomal subunit in the nucleus, including mutation
of the karyopherin Kap120.
The Rpl11b-GFP localization assay described here differs from the 60S
export assay that uses Rpl25-GFP as the tag for the 60S ribosomal
subunit (Hurt et al., 1999
). Nuclear accumulation of
Rpl11b-GFP can be detected in cells during logarithmic growth when
they are actively producing ribosomes, whereas Rpl25-GFP accumulation
is observed when cells are shifted from conditions of starvation
(saturation) to fresh medium (Hurt et al., 1999
). The two
r-proteins also bind at different points on the ribosome biogenesis
pathway (Kruiswijk et al., 1978
; Kressler et al.,
1999
). Rpl25 binds to the 35S rRNA precursor before it is divided into its 40S (20S rRNA) and 60S (27SA2 rRNA) specific
components, whereas Rpl11 associates later in the pathway, most likely
with the 27SA2 preribosomal particle. Although
the differences between these two 60S localization assays may seem
minor, they have the potential to identify a different set of factors
required for ribosomal subunit assembly and export. Because Rpl25 binds
directly to the rRNA, it is likely to be buried within the 60S
ribosomal subunit (El-Baradi et al., 1984
, 1987
; Yeh and
Lee, 1998
). Rpl11 binds later in ribosome assembly and appears to be
located at the surface of the 60S ribosomal subunit (Tsay et
al., 1994
). Thus, Rpl11 may be available for recognition by the
ribosome assembly or export machinery.
The distribution of Rpl11b-GFP in yeast cells is sensitive to defects
in ribosome synthesis, as expected. Rpl11b-GFP is predominantly cytoplasmic in wild-type yeast cells at all temperatures assayed, consistent with the cytoplasmic localization of active 80S ribosomes. In contrast, Rpl11b-GFP accumulates in the nucleus of yeast strains bearing temperature-sensitive mutations in the 60S ribosome assembly factors Mtr4/Dob1 and Nop1. Although rat1-1 cells have a
defect in 5.8S rRNA processing (Amberg et al., 1992
; Henry
et al., 1994
), Rpl11b-GFP did not accumulate in this
strain. It is possible that a defect in rat1-1 cells was not
detected because in its absence the exonuclease Xrn1 completes 5.8S
rRNA processing (Henry et al., 1994
; Petfalski et
al., 1998
). Rpl11b-GFP did accumulate in fal1-1 and
nsr1
cells, which are defective in cleavage of the 35S
rRNA precursor into the 20S and 27SA2 rRNAs
(Kondo and Inouye, 1992
; Kondo et al., 1992
; Lee et
al., 1992
; Kressler et al., 1997
). Rpl11b-GFP may
accumulate in the nucleus of these strains because it binds to the
27SA2 preribosomal particle after this major
cleavage event (Kressler et al., 1999
). Thus, we were able
to detect defects in ribosome assembly mutants with the use of
Rpl11b-GFP as a marker for the 60S ribosomal subunit. In contrast, Rpl25-GFP did not mislocalize in cells bearing a mutation in the 60S
subunit assembly factor Nop1 (Hurt et al., 1999
), and we
were unable to detect a defect in mtr4-1 cells with the use
of the Rpl25-GFP assay (our unpublished results).
The 60S ribosomal subunit accumulates in the nucleus of several yeast
strains bearing mutations in nucleoporins. The nucleoporin mutants
nup49-313, nic96-1, nsp1,
nup82
108, nup116-5, and
nup120 cause Rpl11b-GFP to accumulate in the nucleus (Table
2). The 40S ribosomal subunit also accumulates in the nucleus of these strains (Moy and Silver, 1999
; T. Moy and P. Silver, unpublished results), suggesting that these nucleoporins may be involved in the
export of both ribosomal subunits. In addition, the yeast strains
nup85, nup133, nup159,
nup1, nup40, and gle1-4 all
accumulated Rpl11b-GFP in the nucleus to various degrees (Table 2).
These strains have also been shown to accumulate
poly(A)+ RNA in the nucleus at nonpermissive
growth temperatures (Bogerd et al., 1994
; Doye et
al., 1994
; Gorsch et al., 1995
; Li et al., 1995
; Goldstein et al., 1996
; Murphy et al.,
1996
; Murphy and Wente, 1996
). Some of these nucleoporins may play a
role in the export of both poly(A)+ RNA and 60S
ribosomal subunits. Rpl11b-GFP accumulation in nup1-8, nup133, gle1-4, and nup159 cells may
be due to a delay in ribosome assembly and not an export defect,
because the 40S ribosomal subunit accumulated in the nucleolus of
nup1-8, nup133, and gle1-4 cells (Moy
and Silver, 1999
) and rRNA processing was inhibited in
nup159 cells (Del Priore et al., 1996
; Goldstein
et al., 1996
).
Mutation of either Nup120 or Nup85, two members of the Nup84 nuclear
pore subcomplex, causes nuclear accumulation of Rpl11b-GFP. The Nup84
subcomplex also contains Nup145-C, Seh1, and Sec13 (Siniossoglou et al., 1996
, 2000
). It has been proposed that this
subcomplex plays a role in mRNA export because mutations in Nup120,
Nup85, Nup84, and Nup145 trap poly(A)+ RNA in the
nucleus (Aitchison et al., 1995a
; Heath et
al., 1995
; Goldstein et al., 1996
; Siniossoglou
et al., 1996
; Dockendorff et al., 1997
). The 60S
subunit accumulated in nup120 cells after a 1-h shift to
37°C, and a slight defect was also detected at the permissive
temperature. It does not appear that nuclear accumulation of
Rpl11b-GFP in nup120 cells is due to a defect in ribosome
assembly, because the ratio of 60S to 40S subunits is similar to that
of wild-type cells in all conditions assayed (our unpublished results). In nup85 cells, Rpl11b-GFP accumulates in the entire
nucleus at 25°C and is concentrated in the nucleolus at 37°C,
suggesting that both ribosome assembly and export are affected by this
mutation. It is possible that the Nup120 and Nup85 portion of the Nup84 subcomplex plays a role in 60S ribosomal subunit export in addition to
mRNA export.
Consistent with a role for Ran in ribosomal subunit export, mutation of
the Ran regulators Rna1, Prp20, and Yrb1 resulted in nuclear
accumulation of Rpl11b-GFP. The 40S ribosomal subunit also accumulates
in the entire nucleus of rna1-1, prp20-1, and yrb1-1 cells (Moy and Silver, 1999
). It is not clear whether
Ran and its regulators play a direct role in ribosomal subunit export or if the defect in these mutants is due to a block in other transport processes. The importin
and importin
mutants srp1-31
and rsl1-4 also caused 60S subunit accumulation, presumably
due to a delay in the import of factors required for 60S ribosomal
subunit assembly or export.
The mutants rat8-1 and rat8-2 accumulated
Rpl11b-GFP in the nucleus. Rat8 is a member of the DEAD box family of
helicases that is localized in the cytoplasm and associates with the
NPC in yeast cells (Snay-Hodge et al., 1998
; Tseng et
al., 1998
; Hodge et al., 1999
). A role for Rat8 in mRNA
export has been proposed (Snay-Hodge et al., 1998
). The 60S
export defect in rat8 mutants was not due to a ribosome
assembly defect, because processing of the 35S rRNA in
rat8-1 cells was delayed only slightly and the ratio of 60S
to 40S subunits as well as the polyribosome profiles of
rat8-1 and rat8-2 cells were similar to those of
wild-type cells (our unpublished results). We were also able to detect
the 60S export defect in rat8-1 cells with the use of the
Rpl25-GFP export assay described previously (our unpublished results).
Rpl25-GFP accumulated in both the nucleolus and the nucleus of
rat8-1 cells within 15 min of shifting cells from the
nonpermissive growth temperature back to the permissive temperature
(our unpublished results). It is possible that Rat8 is involved in both
mRNA and 60S ribosomal subunit export. A role for a helicase in the
release of mRNA or 60S ribosomal subunits from the cytoplasmic face of the NPC is an intriguing possibility.
A subset of karyopherin mutants mislocalize Rpl11b-GFP to the nucleus.
Mutation of KAP104 and deletions of NMD5 and
KAP123 all lead to nuclear accumulation of the 60S ribosomal
subunit. Because Kap123 is a putative yeast r-protein importer (Rout
et al., 1997
) and both Nmd5 and Kap104 are homologous to
mammalian r-protein importers (Jakel and Gorlich, 1998
), it is possible that mutation of these factors slows r-protein import, which in turn
inhibits ribosome subunit assembly. In contrast, mutation of Pse1 and
Sxm1, two karyopherins implicated in r-protein import (Rosenblum
et al., 1997
; Rout et al., 1997
), did not affect
Rpl11b-GFP localization. Because ribosome biogenesis is essential for
cell viability, it is likely that there are multiple r-protein
importers in yeast. Mutation of the nuclear export sequence receptor
Xpo1/Crm1 also mislocalizes Rpl11b-GFP to the nucleus, although the
defect occurs in only 30% of cells. Because Rna1 accumulates in the
nucleus of xpo1-1 cells at the nonpermissive temperature
(Feng et al., 1999
), it is possible that disruption of the
RanGTP gradient causes the 60S mislocalization defect in these cells.
We have identified a potential role for the karyopherin Kap120 in the
assembly or export of 60S ribosomal subunits in yeast. Deletion of
KAP120 causes a strong accumulation of Rpl11b-GFP in the
nucleus at 25°C (Figure 4B) and a large reduction in the level of
mature 60S ribosomal subunits (Figure 6). The decrease in 60S ribosomal
subunits is not simply due to a deficiency in the level of mature 25S
rRNA because deletion of KAP120 only delays (does not block)
processing of the 35S rRNA precursor (Figure 5). The 60S ribosomal
subunit defect is also not caused by a block in mRNA export because
poly(A)+ RNA is cytoplasmic in
kap120
cells (our unpublished results). Deletion of
KAP120 appears to affect only the 60S ribosomal subunit. The
40S subunit is not mislocalized in kap120
cells (Moy and Silver, 1999
), and nearly wild-type levels of 40S ribosomal subunits are present (Figure 6). At both 37°C (Figure 4B) and at saturation (our unpublished results), conditions in which ribosome synthesis in
the cell is reduced, Rpl11b-GFP is distributed throughout the cytoplasm of kap120
cells. This redistribution of
Rpl11b-GFP indicates that deletion of KAP120 does not cause
a complete block in assembly or export. There are several potential
roles for Kap120 in ribosome biogenesis and export. Kap120 may be an
importer for factor(s) involved in ribosomal subunit assembly, a
r-protein importer, or a factor that recognizes fully assembled
ribosomal subunits for export. We are currently investigating the role
of Kap120 in ribosome assembly and export in more detail.
| |
ACKNOWLEDGMENTS |
|---|
Special thanks to J. Woolford and E. Hurt for providing plasmids used in this study. We also thank Alexander S. Brodsky, for critical input at the initial phase of the project, Terrence Moy for technical assistance and helpful discussions, Karin Anderson and Anne McBride for critical reading of the manuscript, and members of the Silver laboratory for their useful advice. This work was funded by grants from the National Institutes of Health to P.A.S. and a National Institutes of Health postdoctoral fellowship to T.S.-Z
| |
FOOTNOTES |
|---|
* Present address: Department of Cellular Biochemistry, Max Planck Institute for Biophysical Chemistry, AM Fassberg 11, 37077 Goettingen, Germany.
Corresponding author. E-mail address:
pamela_silver{at}dfci.harvard.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
I. Zemp, T. Wild, M.-F. O'Donohue, F. Wandrey, B. Widmann, P.-E. Gleizes, and U. Kutay Distinct cytoplasmic maturation steps of 40S ribosomal subunit precursors require hRio2 J. Cell Biol., June 29, 2009; 185(7): 1167 - 1180. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Perreault, C. Bellemer, and F. Bachand Nuclear export competence of pre-40S subunits in fission yeast requires the ribosomal protein Rps2 Nucleic Acids Res., November 1, 2008; 36(19): 6132 - 6142. [Abstract] [Full Text] [PDF] |
||||
![]() |
N.-J. Hung, K.-Y. Lo, S. S. Patel, K. Helmke, and A. W. Johnson Arx1 Is a Nuclear Export Receptor for the 60S Ribosomal Subunit in Yeast Mol. Biol. Cell, February 1, 2008; 19(2): 735 - 744. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dez, M. Dlakic, and D. Tollervey Roles of the HEAT repeat proteins Utp10 and Utp20 in 40S ribosome maturation RNA, September 1, 2007; 13(9): 1516 - 1527. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. West, J. B. Hedges, K.-Y. Lo, and A. W. Johnson Novel Interaction of the 60S Ribosomal Subunit Export Adapter Nmd3 at the Nuclear Pore Complex J. Biol. Chem., May 11, 2007; 282(19): 14028 - 14037. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oeffinger, A. Fatica, M. P. Rout, and D. Tollervey Yeast Rrp14p is required for ribosomal subunit synthesis and for correct positioning of the mitotic spindle during mitosis Nucleic Acids Res., February 28, 2007; 35(4): 1354 - 1366. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Seiser, A. E. Sundberg, B. J. Wollam, P. Zobel-Thropp, K. Baldwin, M. D. Spector, and D. E. Lycan Ltv1 Is Required for Efficient Nuclear Export of the Ribosomal Small Subunit in Saccharomyces cerevisiae Genetics, October 1, 2006; 174(2): 679 - 691. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Q. Ni, L.-P. Liu, D. Hess, J. Rietdorf, and F.-L. Sun Drosophila ribosomal proteins are associated with linker histone H1 and suppress gene transcription Genes & Dev., July 15, 2006; 20(14): 1959 - 1973. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bakhrat, K. Baranes, O. Krichevsky, I. Rom, G. Schlenstedt, S. Pietrokovski, and D. Raveh Nuclear Import of Ho Endonuclease Utilizes Two Nuclear Localization Signals and Four Importins of the Ribosomal Import System J. Biol. Chem., May 5, 2006; 281(18): 12218 - 12226. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Caesar, M. Greiner, and G. Schlenstedt Kap120 Functions as a Nuclear Import Receptor for Ribosome Assembly Factor Rpf1 in Yeast Mol. Cell. Biol., April 15, 2006; 26(8): 3170 - 3180. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Butterfield-Gerson, L. Z. Scheifele, E. P. Ryan, A. K. Hopper, and L. J. Parent Importin-{beta} Family Members Mediate Alpharetrovirus Gag Nuclear Entry via Interactions with Matrix and Nucleocapsid J. Virol., February 15, 2006; 80(4): 1798 - 1806. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Du, M. R.K. S. Rao, X. Q. Chen, W. Wu, S. Mahalingam, and D. Balasundaram The Homologous Putative GTPases Grn1p from Fission Yeast and the Human GNL3L Are Required for Growth and Play a Role in Processing of Nucleolar Pre-rRNA Mol. Biol. Cell, January 1, 2006; 17(1): 460 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dong, R. Lai, J. L. Jennings, A. J. Link, and A. G. Hinnebusch The Novel ATP-Binding Cassette Protein ARB1 Is a Shuttling Factor That Stimulates 40S and 60S Ribosome Biogenesis Mol. Cell. Biol., November 15, 2005; 25(22): 9859 - 9873. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. THOMSON and D. TOLLERVEY Nop53p is required for late 60S ribosome subunit maturation and nuclear export in yeast RNA, August 1, 2005; 11(8): 1215 - 1224. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. West, J. B. Hedges, A. Chen, and A. W. Johnson Defining the Order in Which Nmd3p and Rpl10p Load onto Nascent 60S Ribosomal Subunits Mol. Cell. Biol., May 1, 2005; 25(9): 3802 - 3813. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Irwin, M. Aye, P. Baldi, N. Beliakova-Bethell, H. Cheng, Y. Dou, W. Liou, and S. Sandmeyer Retroviruses and yeast retrotransposons use overlapping sets of host genes Genome Res., May 1, 2005; 15(5): 641 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shiina, K. Shinkura, and M. Tokunaga A Novel RNA-Binding Protein in Neuronal RNA Granules: Regulatory Machinery for Local Translation J. Neurosci., April 27, 2005; 25(17): 4420 - 4434. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. BRUNE, S. E. MUNCHEL, N. FISCHER, A. V. PODTELEJNIKOV, and K. WEIS Yeast poly(A)-binding protein Pab1 shuttles between the nucleus and the cytoplasm and functions in mRNA export RNA, April 1, 2005; 11(4): 517 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Schaper, J. Franke, S. H. Meijsing, and A. E. Ehrenhofer-Murray Nuclear import of the histone acetyltransferase complex SAS-I in Saccharomyces cerevisiae J. Cell Sci., April 1, 2005; 118(7): 1473 - 1484. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Saiardi, R. Bhandari, A. C. Resnick, A. M. Snowman, and S. H. Snyder Phosphorylation of Proteins by Inositol Pyrophosphates Science, December 17, 2004; 306(5704): 2101 - 2105. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Belanger, L. A. Simmons, J. K. Roth, K. A. VanderPloeg, L. B. Lichten, and B. Fahrenkrog The Karyopherin Msn5/Kap142 Requires Nup82 for Nuclear Export and Performs a Function Distinct from Translocation in RPA Protein Import J. Biol. Chem., October 15, 2004; 279(42): 43530 - 43539. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dong, R. Lai, K. Nielsen, C. A. Fekete, H. Qiu, and A. G. Hinnebusch The Essential ATP-binding Cassette Protein RLI1 Functions in Translation by Promoting Preinitiation Complex Assembly J. Biol. Chem., October 1, 2004; 279(40): 42157 - 42168. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oeffinger, M. Dlakic, and D. Tollervey A pre-ribosome-associated HEAT-repeat protein is required for export of both ribosomal subunits Genes & Dev., January 15, 2004; 18(2): 196 - 209. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. FATICA, M. OEFFINGER, D. TOLLERVEY, and I. BOZZONI Cic1p/Nsa3p is required for synthesis and nuclear export of 60S ribosomal subunits RNA, December 1, 2003; 9(12): 1431 - 1436. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Fingerman, V. Nagaraj, D. Norris, and A. K. Vershon Sfp1 Plays a Key Role in Yeast Ribosome Biogenesis Eukaryot. Cell, October 1, 2003; 2(5): 1061 - 1068. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Kallstrom, J. Hedges, and A. Johnson The Putative GTPases Nog1p and Lsg1p Are Required for 60S Ribosomal Subunit Biogenesis and Are Localized to the Nucleus and Cytoplasm, Respectively Mol. Cell. Biol., June 15, 2003; 23(12): 4344 - 4355. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Thomas and U. Kutay Biogenesis and nuclear export of ribosomal subunits in higher eukaryotes depend on the CRM1 export pathway J. Cell Sci., June 15, 2003; 116(12): 2409 - 2419. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Nikolaev, M.-F. Cochet, and B. Felenbok Nuclear Import of Zinc Binuclear Cluster Proteins Proceeds through Multiple, Overlapping Transport Pathways Eukaryot. Cell, April 1, 2003; 2(2): 209 - 221. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sydorskyy, D. J. Dilworth, E. C. Yi, D. R. Goodlett, R. W. Wozniak, and J. D. Aitchison Intersection of the Kap123p-Mediated Nuclear Import and Ribosome Export Pathways Mol. Cell. Biol., March 15, 2003; 23(6): 2042 - 2054. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. P. Lei, C. A. Stern, B. Fahrenkrog, H. Krebber, T. I. Moy, U. Aebi, and P. A. Silver Sac3 Is an mRNA Export Factor That Localizes to Cytoplasmic Fibrils of Nuclear Pore Complex Mol. Biol. Cell, March 1, 2003; 14(3): 836 - 847. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhao, J.-H. Sohn, and J. R. Warner Autoregulation in the Biosynthesis of Ribosomes Mol. Cell. Biol., January 15, 2003; 23(2): 699 - 707. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bjork, G. Bauren, S. Jin, Y.-G. Tong, T. R. Burglin, U. Hellman, and L. Wieslander A Novel Conserved RNA-binding Domain Protein, RBD-1, Is Essential For Ribosome Biogenesis Mol. Biol. Cell, October 1, 2002; 13(10): 3683 - 3695. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Ferrezuelo, B. Steiner, M. Aldea, and B. Futcher Biogenesis of Yeast Telomerase Depends on the Importin Mtr10 Mol. Cell. Biol., September 1, 2002; 22(17): 6046 - 6055. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. I. Moy and P. A. Silver Requirements for the nuclear export of the small ribosomal subunit J. Cell Sci., July 15, 2002; 115(14): 2985 - 2995. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-B. Jin, J. Zhao, P. Bjork, K. Schmekel, Per. O. Ljungdahl, and L. Wieslander Mrd1p Is Required for Processing of Pre-rRNA and for Maintenance of Steady-state Levels of 40 S Ribosomal Subunits in Yeast J. Biol. Chem., May 17, 2002; 277(21): 18431 - 18439. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Franke, B. Reimann, E. Hartmann, M. Kohler, and B. Wiedmann Evidence for a nuclear passage of nascent polypeptide-associated complex subunits in yeast J. Cell Sci., March 9, 2002; 114(14): 2641 - 2648. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Plafker and I. G. Macara Ribosomal Protein L12 Uses a Distinct Nuclear Import Pathway Mediated by Importin 11 Mol. Cell. Biol., February 15, 2002; 22(4): 1266 - 1275. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Valentini, J. M. Casolari, C. C. Oliveira, P. A. Silver, and A. E. McBride Genetic Interactions of Yeast Eukaryotic Translation Initiation Factor 5A (eIF5A) Reveal Connections to Poly(A)-Binding Protein and Protein Kinase C Signaling Genetics, February 1, 2002; 160(2): 393 - 405. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-E. Gleizes, J. Noaillac-Depeyre, I. Leger-Silvestre, F. Teulieres, J.-Y. Dauxois, D. Pommet, M.-C. Azum-Gelade, and N. Gas Ultrastructural localization of rRNA shows defective nuclear export of preribosomes in mutants of the Nup82p complex J. Cell Biol., December 10, 2001; 155(6): 923 - 936. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. G. Macara Transport into and out of the Nucleus Microbiol. Mol. Biol. Rev., December 1, 2001; 65(4): 570 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.W. JOHNSON, J.H.-N. HO, G. KALLSTROM, C. TROTTA, E. LUND, L. KAHAN, J. DAHLBERG, and J. HEDGES Nuclear Export of the Large Ribosomal Subunit Cold Spring Harb Symp Quant Biol, January 1, 2001; 66(0): 599 - 606. [Abstract] [PDF] |
||||
![]() |
N. P. C. Allen, L. Huang, A. Burlingame, and M. Rexach Proteomic Analysis of Nucleoporin Interacting Proteins J. Biol. Chem., July 27, 2001; 276(31): 29268 - 29274. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||