![]() |
|
|
Vol. 11, Issue 11, 3873-3883, November 2000

and
Departments of *Anatomy and
Developmental
and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY
10461
| |
ABSTRACT |
|---|
|
|
|---|
To determine the distribution of the epidermal growth factor (EGF) receptor (EGFR) on the surface of cells responding to EGF as a chemoattractant, an EGFR-green fluorescent protein chimera was expressed in the MTLn3 mammary carcinoma cell line. The chimera was functional and easily visualized on the cell surface. In contrast to other studies indicating that the EGFR might be localized to certain regions of the plasma membrane, we found that the chimera is homogeneously distributed on the plasma membrane and becomes most concentrated in vesicles after endocytosis. In spatial gradients of EGF, endocytosed receptor accumulates on the upgradient side of the cell. Visualization of the binding of fluorescent EGF to cells reveals that the affinity properties of the receptor, together with its expression level on cells, can provide an initial amplification step in spatial gradient sensing.
| |
INTRODUCTION |
|---|
|
|
|---|
Chemotaxis, the oriented movement of cells in a spatial gradient
of a soluble chemoattractant, is an important mechanism for directing
cell motion in normal and pathologic circumstances (Devreotes and
Zigmond, 1988
; Zigmond, 1996
; Milne et al., 1997
; Jones
et al., 1998
). For eukaryotic cells, this process involves a
determination of chemoattractant concentration differences over the
cell surface. Based on a spatial difference in chemoattractant
concentration, amoeboid cells develop a polarized morphology and move
toward higher concentrations of chemottractant. Chemoattractant
concentrations are typically detected by cell surface receptors. Both G
protein-coupled receptors and receptor tyrosine kinases have been shown
to mediate chemotactic responses to their specific ligands. Downstream
signaling pathways triggered by these receptors are presumed to amplify spatial differences in the number of occupied receptors and to polarize
the cell for movement in the appropriate direction. Thus, the initial
step in gradient detection relies on the binding properties and spatial
distributions of occupied and unoccupied receptors on the cell surface.
Chemotactic responses mediated by G protein-coupled receptors have been
extensively studied in Dictyostelium and neutrophils, demonstrating that the receptors are evenly distributed over the cell
surface, even in polarized cells (Xiao et al., 1997
; Servant et al., 1999
). On the contrary, previous data had suggested
that receptor tyrosine kinases, such as the epidermal growth factor (EGF) receptor (EGFR), concentrate at the site of protrusions (Gonzalez
et al., 1993
; Diakonova et al., 1995
; Bretscher
and Aguado-Velasco, 1998a
). In the presence of electric fields and ligand, receptors for EGF, transforming growth factor-
, and
fibroblast growth factor are concentrated in the front of the cell,
although the majority may be in vesicles (Zhao et al.,
1999
). Macrophages migrating in a gradient of colony-stimulating factor
1 (CSF-1) also show increased amounts of internalized CSF-1 receptor in the front half of the cell (Jones et al., 1998
). Such
studies suggest that a different mechanism may be involved in
chemotactic responses mediated by receptor tyrosine kinases.
To resolve this issue, we have followed the distribution of a green fluorescent protein (GFP)-tagged EGFR in cells responding to EGF, both as spatial gradients and as sudden changes in concentration. We find that receptors are evenly distributed on the surfaces of chemotaxing cells but that receptor internalization is polarized. In addition, the high affinity of the EGFR together with the high numbers of receptors on the cell surface provides an opportunity for an initial amplification step at the level of the receptor.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cells and Reagents
MTLn3 metastatic rat mammary adenocarcinoma cells (Neri et
al., 1982
) and the E11 stable transfectants derived from MTLn3 cells were grown as previously described (Segall et al.,
1996
). Unless otherwise mentioned, cells were prepared for all
experiments as follows: cells were plated at low density in complete
medium for ~24 h on acid-cleaned dishes (MatTek Corp., Ashland, MA)
and were starved for 3 h before the experiment in either MEMH
(alpha-MEM, Life Technologies, Grand Island, NY; supplemented with
0.35% bovine serum albumin (BSA) and 12 mM HEPES, pH 7.4) or L15B
medium (Life Technologies; supplemented with 0.35% BSA).
Tetramethylrhodamine (TMR) EGF was obtained from Molecular Probes (Eugene, OR), and murine EGF was obtained from Life Technologies. Antitransferrin receptor antibodies were obtained from PharMingen (San Diego, CA) (22191D), anti EGFR receptor antibody was obtained from Upstate Biotechnology (Lake Placid, NY), and labeled secondary antibodies were from Accurate Biochemicals (Westbury, NY).
Construction of Cells Expressing GFP-tagged Rat EGFR
The rat EGFR cDNA was generously provided by H. S. Earp (University of North Carolina, Chapel Hill, NC). Polymerase chain reaction (PCR) primers were designed to produce a product with 5' SalI digestion site with Kozak consensus sequence and a 3' SacII site. The primer sequences were: TGAGTCGACGCGGCCGCCACCATGCGACCCTCAGGGACTGC and TTCCGCGGTGCTCCAATAAACTCACTGCT. PCR was performed using Pwo polymerase (Promega, Madison, WI). The PCR product was fully digested with SacII followed by partial digestion with SalI, and the larger partial digest product was subcloned into pEGFPN1 digested with SacII and SalI. The absence of PCR-induced mutations was confirmed by sequencing. The sequence linking the C-terminal amino acid of the EGFR to the N-terminal amino acid of GFP was ProArgAlaArgAspProProValAlaThr.
MTLn3 cells were transfected with the EGFR-GFP fusion construct using lipofectamine and stable transfectants were selected with neomycin. Isolated clones were subcloned and screened for membrane-bound GFP fluorescence. One clone, termed E11, was used for further experiments.
Western Blotting
Samples were collected using SDS sample buffer or NP40 lysis buffer directly from culture dishes. For quantitation, equal protein amounts from MTLn3 and E11 cell lysates in NP40 lysis buffer were loaded on the gel in 2-fold dilutions. Blots were probed with a primary antibody to the EGFR that recognizes the rat EGFR (Santa Cruz). Enhanced-chemiluminescence was used for the detection of primary antibody binding, and bands of equivalent intensity on the same blots were identified. The corresponding amounts of protein loaded were used to estimate the relative numbers of receptors in E11 cells compared with MTLn3 cells.
EGF-induced Lamellipod Extension and Chemotaxis
EGF-induced lamellipod extension was measured as changes in
total cell area and chemotaxis to EGF was measured in modified Boyden
chambers as previously described (Segall et al., 1996
; Bailly et al., 1998a
; Wyckoff et al., 1998
).
Immunofluorescence
Immunofluorescence labeling for transferrin receptors was
performed as previously described (Bretscher and Aguado-Velasco, 1998a
;
Bailly et al., 1998b
).
Binding of TMR-EGF
To measure the binding of TMR-EGF, cells were starved for
3 h in MEMH, were washed with ice-cold DPBSB (DPBS with 0.5 mM
MgCl2, 0.5 mM CaCl2, and
0.35% BSA), and were placed at 4°C. The cells were incubated with
varying concentrations of TMR-EGF and EGF in ice-cold DPBSB for 3 h at 4°C (Lichtner et al., 1995
), were rinsed four times
with ice-cold DPBSB, and were fixed with 3.7% formaldehyde in fix
buffer (Bailly et al., 1998b
) for 20 min. Cells were imaged
on an Olympus (Melville, NY) IX70 microscope with a 40× long
working distance objective coupled to a cooled CCD camera
(Photometrics, Roper Scientific, Tucson, AZ) using IPLab
Spectrum software (Scanalytics, Fairfax, VA). Constant exposure and
gain settings were used for all samples on a given day to allow for
direct linear comparison. Digitized images were converted linearly in
NIH Image (http://rsb.info.nih.gov/nih-image/) and were analyzed for
average cellular fluorescence in the fluorescein channel (for GFP
fluorescence) and the rhodamine channel (for TMR-EGF
fluorescence). For each cell, average background fluorescence around
that cell was subtracted. To compare total TMR-EGF binding between E11
and MTLn3 cells, the average fluorescence of cells binding 5 nM
TMR-EGF + 100 nM EGF (nonspecific binding) was subtracted from the
average fluorescence of cells binding 5 nM TMR-EGF alone.
Time-lapse Live-Cell Fluorescence Imaging
Cells were starved in L15 with 0.35% BSA for 3 h
and were viewed on an Olympus IX70 microscope with 60× NA 1.4 infinity-corrected optics coupled to a Power Macintosh (Apple Computer,
Cupertino, CA)-driven cooled CCD camera (Photometrics) using IPLab
Spectrum software (Scanalytics) in a 37°C environmental chamber. The
dishes were covered with mineral oil (Sigma Chemical, St. Louis, MO) to
reduce drying artifacts, and excitation light levels were 1-5% of
maximum with 1- to 5-s exposure times for optimal viability. To
minimize cell damage by the imaging process, exposure times that only
visualized the cell expressing the highest density of EGFR-GFP were
used when analyzing the distribution of labeled EGF (TMR-EGF) and EGFR
(EGFR-GFP) on the same cells. Similar results were seen for cells
expressing lower amounts of EGFR-GFP if only imaging for TMR-EGF over
shorter periods of time was performed. User-programmed scripts took
phase and fluorescence images every 5-30 s. Fluorescence intensity of
extending flat lamellipods was quantitated as a function of distance
back from the leading edge in NIH Image using a user-defined macro
(Chan et al., 1998
).
Micropipets were pulled on a Narishige (East Meadow, NY) PB-7 puller. They were filled with 50 µM EGF (for stimulation by diffusion), 50 nM EGF, or 250 nM EGF (for chemotaxis or saturation stimulation, respectively, using pressure pulses). For pressure ejection of EGF, an Eppendorf (Eppendorf Scientific, Inc., Westbury, NY) microinjection system and pressures of 10-40 psi were used.
For confocal live cell imaging, a Noran (Middleton, WI) OZ real-time imaging system on an Olympus IX 70 microscope with 60× NA1.4 infinity-corrected optics was utilized with an environmental chamber, as described above. Cells were imaged with 19% of maximum laser intensity using a 15-µm slit size. Images were typically averaged 32 times for each confocal slice (1 s total exposure), and slices were obtained every 0.5 or 1 µm. A new z-series was obtained every 20-40 s. High-speed and reproducible Z planes were achieved using a piezo controller. Z-series stacks were imported into NIH-Image and analyzed.
For the analysis of cells stained with NBD-C6-SM (Molecular Probes), cells were starved in MEMH for 3 h, then were rinsed twice with MEMH (without BSA) and stained with 25 µM total lipid (NBD-C6-SM:dioleylphosphatidylcholine 1:1) at 36°C for 30 min. They were then rinsed five times with MEMH lacking BSA, twice with L15, and were imaged on the cooled CCD station described above.
Vesicle Counting
To evaluate the direction of vesicle movement in cells exposed to a homogeneous concentration of EGF, individual cells were observed and the movement of EGFR-containing vesicles was recorded using time lapse microscopy. The numbers reported concern only the vesicles, regardless of size, that were moving consistently in one given direction (either toward the leading edge, or from the leading edge toward the nucleus) during the course of a video (5-10 min), and do not reflect the total number of vesicles. A significant number of vesicles mainly orbited around the nucleus, while others simply could not be followed from frame to frame. A total of 140 vesicles (large and small) were analyzed from 15 cells in eight different EGF upshifts, and the percentage of vesicles moving toward and away from the leading edge were calculated. It should be noted that the percentage of vesicles moving toward the leading edge is probably an overestimate of the real value, because the vesicles moving away from the edge were sometimes too dense to be counted with complete accuracy.
To determine the distribution of EGFR-containing vesicles in polarized cells, the number of vesicles were counted on a steady image of cells after they had clearly oriented toward the gradient of EGF (3-5 min after initiation of the gradient). Each cell was divided into a posterior part (away from the pipet) and an anterior part (facing the pipet) using a line drawn perpendicularly to the pipet orientation through the center of the nucleus. The vesicles were counted in the two different parts, and the numbers were converted to the percentage of total vesicles for each cell. Results are expressed as mean ± SEM.
Gradient Evaluation
Changes in the steepness of the gradient were evaluated using fluorescence measurements in 10 cells responding to a gradient of TMR-EGF generated by pressure applied to micropipets filled with 50 nM TMR-EGF. Measurements for each cell were made using a constant (roughly 1-µm) region on an Olympus microscope to allow linear measurements of fluorescence, as described above. For each cell, fluorescence was measured as follows: 1) an extending lamellipod on the side of the cell closest to the micropipet, 2) in the medium next to the lamellipod, 3) on a lamellipod or flat membrane structure on the side of the cell away from the micropipet, and 4) in the medium next to the side of the cell away from the micropipet. The differences in fluorescence in the medium then were calculated by subtracting the fluorescence value for the medium on the side near the micropipet from the value for the medium on the side far from the micropipet. For TMR-EGF bound to the cell surface, the fluorescence value for the medium next to the appropriate side of the cell was subtracted from the cell value. Then the difference in fluorescence between the sides of the cell near and far from the micropipet was calculated. For measuring TMR-EGF in internalized vesicles, the average value of the fluorescence of the internalized vesicles on the side of the cell closer to the micropipet was measured and the fluorescence value for the medium on the side of the cell near the micropipet was subtracted.
| |
RESULTS |
|---|
|
|
|---|
The EGFR-GFP Chimera Is Functional
To follow the distribution of EGFRs on cells responding to EGF, an EGFR-GFP fusion protein was expressed in MTLn3 cells. Stable clones expressing the construct were selected by screening neomycin-resistant colonies by fluorescence microscopy. The E11 clone that showed relatively high GFP fluorescence associated with cell membranes was analyzed in more detail and was used in further experiments.
The EGFR-GFP construct expressed in E11 cells was deemed to be
functional according to the following criteria. Western blotting with
an anti-EGFR antibody revealed the expression of a new band of
increased molecular weight, as expected from the fusion of GFP to the
receptor (Figure 1A, inset). The ability
of the transfected receptor to bind EGF was evaluated using TMR-labeled
EGF, and E11 cells bound roughly five times more TMR-EGF than MTLn3
cells (Figure 1A), which is consistent with quantitation by Western blot (our unpublished results). TMR-EGF binding correlated with GFP
fluorescence on a single-cell basis as well (Figure 1B), confirming that the EGF binding reflected the expression level of the EGFR-GFP construct.
|
Using EGF-induced lamellipod extension as a sensitive assay for
receptor functionality (Segall et al., 1996
; Bailly et
al., 1998b
), EGFR-GFP expressing E11 cells were found to be more
sensitive to the addition of EGF compared with control untransfected
MTLn3 cells (Figure 1C). Similarly, chemotactic responses to EGF were increased compared with the parental cell line and were shifted to
lower EGF concentrations, as expected from an increase in the expression of the functional receptor (Figure 1D). Furthermore, we
observed a dramatic increase in tyrosine phosphorylation (as measured
by mean fluorescence intensity) in E11 cells after stimulation with
EGF, with a clear accumulation of phosphotyrosine at the membrane,
which is consistent with activation of the transfected GFP-tagged
receptor (our unpublished results). These results are consistent with
analyses by Carter and Sorkin (1998)
that fusion of GFP to the C
terminus produces a functional receptor.
Cell Responses to EGF Upshifts
In the absence of stimulation, the distribution of the EGFR-GFP
construct on the plasma membrane was uniform (Figure
2A; Figure 2B first frame), with apparent
slight increases in ruffles or internalized vesicles, most likely due
to the three-dimensional character of these structures. On stimulation
with EGF, E11 cells show transient ruffling (Figure 2B, thin arrows;
see corresponding video), as well as typical horizontal lamellipod
extension (large arrows), as has been seen in the parental MTLn3 cells
(Bailly et al., 1998b
; Wyckoff et al., 1998
).
Similar effects are seen using time-lapse confocal microscopy and
stereo reconstruction (our unpublished results). The stimulation with
EGF was also followed by the appearance of large bright vesicles (white
arrowheads), that could be seen forming from the ruffles (Figure 2B and
video) and from the extending lamellipods. In regions of flat
lamellipod extension, smaller fluorescent dots also could be observed
forming from ruffles and moving back from the extending lamellipods
(Figure 2B, sequence at right). The video clearly demonstrates that
after stimulation the cell undergoes ruffling and extension phases, most of the vesicles (large or small) being generated when the ruffles
curl back at the edge of the lamellipod. It is also clear from the
video (not shown in Figure 2B) that a lot of ruffling occurs on the top
of the cell and extending lamellipod, generating numerous vesicles
(visible in the frames that have a slightly higher focus in the video).
These two types of internalization (large vesicles and small punctate
structures) are consistent with current knowledge of endocytosis and
probably reflect macropinocytosis (Swanson and Watts, 1995
) and
clathrin-mediated (Marsh and McMahon, 1999
) endocytic events,
respectively.
|
The ability of certain parts of the cell to extend more efficiently
than others in response to EGF could reflect localized regions of
increased density of EGFR. Indeed, studies with A431 cells have
suggested that there were increases in numbers of EGFRs in EGF-induced
protrusions (Rijken et al., 1991
; Gonzalez et
al., 1993
). However, as can be seen in Figure 2, A and B, receptor density on the plasma membrane appears to be uniform. Furthermore, although there was dramatic internalization of the receptor mainly from
sites of extension, if we analyzed areas of the cell periphery in which
flat lamellipods were extending, there was no indication of increased
fluorescence at the edges of the lamellipods (Figure 2C), confirming
that receptor density over the cell surface remained uniform.
Distribution of the EGFR in Polarized Cells
An even distribution of EGFRs would provide chemotactic cells with
greater sensitivity to changing gradients of the chemoattractant. However, it is possible that receptors only accumulate in particular regions of the plasma membrane under conditions of cell polarization, similar to apical/basal segregation of cell surface proteins or to the
accumulation of the yeast mating factor receptor in spatial gradients
of mating factor. To evaluate this possibility, cells were stimulated
with spatial gradients of EGF using micropipets filled with
EGF to generate polarized extension (Figure
3 and corresponding video). After a few
minutes in the presence of the gradient of EGF, the cells reoriented
themselves and became polarized toward the gradient (Bailly et
al., 1998b
; and Figure 3). However, there was again no evidence
for a significant increase in receptor density at the leading edges of
lamellipods in these conditions. On the other hand, increased ruffling
(Figure 3, arrows) and internalization of EGF-receptors (Figure 3,
arrowheads) were observed on the side of the cell nearest the pipet,
indicating polarization of receptor endocytosis. It is possible that
the density of the receptor is increased on dorsal ruffles just before
or concomitant with internalization, which is most easily seen by
viewing the video from which Figure 3 was made. Evaluation of the
number of EGFR-containing vesicles 3-5 min after stimulation when they
are clearly oriented toward the pipet showed that 66 ± 6% of the
vesicles in polarized cells are concentrated in the anterior part of
the cell facing the EGF-containing pipet (572 vesicles were analyzed on
nine different cells, as defined in MATERIALS AND METHODS).
|
Role of Polarized Membrane Secretion in Maintaining Even Receptor Distribution
Given the increased endocytosis of the receptor at the protruding
edges of the cell, one mechanism for maintaining a uniform distribution
of receptors might be exocytosis of new receptors at the leading edge
of the cell. It also has been proposed that exocytosis of new membrane
at the leading edge might be the key mechanism for determining sites of
cell protrusion (Bretscher and Aguado-Velasco, 1998b
). Receptors, as
they bind the attractant, move back from the leading edge as they are
endocytosed. Exocytosis of new receptors might compensate for the loss
of these endocytosed receptors. Such exocytic mechanisms might predict
the following: 1) movement of new receptors to the leading edge of the
cell, where they can bind EGF and maintain the polarization; 2) massive movement of membrane to the leading edge of the cell to replace the
endocytosed membrane and to provide new membrane for the cell protrusion; 3) increases in recycled proteins such as the transferrin receptor at the leading edge of the cell; and 4) a gradient of EGF
bound to the cell with the lowest amount of EGF bound at the extreme
edge of the lamellipod (where EGF has not yet bound newly exocytosed receptors).
The above predictions were tested to evaluate the likelihood of the
receptor distribution being maintained by polarized secretion of
membrane. First, analysis of the movement of EGFR-GFP-containing vesicles at the leading edge showed that the majority of them (86%)
moved back from the leading edge, and only after careful observation
were we able to detect vesicle movement toward the leading edge (14%
of the moving vesicles, see MATERIALS AND METHODS). Furthermore, most
of the vesicles moving toward the leading edge did not reach the
extreme edge of the lamellipod, and we were not able to identify fusion
of these vesicles at the leading edge (our unpublished results). In
addition, movement of membrane particles toward the leading edge of
EGF-stimulated cells was not observed using membrane dyes such as
NBD-C6-CM, PKH26, or NBD-C6-SM. As shown in Figure
4 and the corresponding video,
observation of membrane-recycling dynamics using NBD-C6-SM showed that
most of the vesicles orbit as satellites around the nucleus and that
relatively few actually move toward the leading edge. The vesicles that
move away from the center of the cell tend to go to limited regions of
the periphery, while lamellipod extension occurs over a much broader
area. Membrane recycling is occurring during this time, as indicated by
the reduction in overall fluorescence in Figure 4D compared with Figure
4C. Comparable results were obtained with the two other membrane dyes
used (our unpublished results). Transferrin receptors, which are part
of a rapidly recycling receptor system (Inoue et al., 1993
;
Cavanaugh and Nicolson, 1998
; Bretscher and Aguado-Velasco, 1998a
) did
not demonstrate dramatic concentration on extending lamellipods (Figure
5). Finally, addition of TMR-EGF did not
produce a gradient of rhodamine fluorescence on extending lamellipods. Rather, the extreme edge of the lamellipod appeared to be
as intensely labeled as the regions back from the edge (Figure 6A). Thus, we conclude that membrane
exocytosis at the leading edge of the cell is unlikely to be the cause
of the even receptor distribution on the plasma membrane.
|
|
|
Localization of EGF During Gradient Detection
We used TMR-labeled EGF to analyze the binding of EGF to the
receptors. Application of saturating amounts of TMR-EGF indicated that
cells can concentrate EGF on their plasma membranes since the TMR-EGF
fluorescence was higher on cells than in the surrounding medium (Figure
6A). This observation suggests two mechanisms by which high-affinity
receptors could enhance gradients of chemoattractant. First, at low EGF
concentrations, the concentration of the ligand on the cell surface
indicates that the absolute number of bound ligands is increased
compared with the number of free EGF molecules present in an equivalent
volume of solution, potentially amplifying any signals that are
generated. Second, because EGFRs have off rates and internalization
rates, which are both on the order of minutes (French et
al., 1995
; Ware et al., 1997
), cells can act like
absorbers of EGF. Thus, as EGF molecules bind to the side of the cell
closest to the micropipet, they are removed from solution. This
potentially reduces the effective concentration of EGF reaching receptors at the rear of the cell, and consequently lowers the internalization rate in that area.
To evaluate the effects of receptor affinity on gradient detection, micropipets were filled with low concentrations of TMR-EGF (50 nM, Figure 6B). On application of a pressure pulse to induce the release of TMR-EGF from the micropipet, accumulation of TMR-EGF on the side of the cell closest to the pipet could be detected. A dramatic enhancement of the internalization of labeled EGF on the side of the cell closest to the pipet followed. Imaging of both the receptor (EGFR-GFP) and the ligand (TMR-EGF) demonstrated that the internalization of the ligand-receptor complex was highly polarized, although, as reported above, there was no accumulation of the receptor itself on the plasma membrane nearest to the pipet. To determine whether the cells enhanced the gradient of EGF, fluorescence due to TMR-EGF in the medium and on the cell surface was measured on flat lamellipods near and far from the pipet. The mean difference in medium TMR-EGF between the side of the cell nearest the pipet and the side away from the pipet (in arbitrary units) was 116 ± 23. The corresponding value for surface TMR-EGF was 294 ± 121. These values are significantly different from each other (p < 0.02 [t test]), indicating a 2.5-fold larger absolute difference in TMR-EGF on the cell surface compared with the medium. The amount of EGFR-GFP fusion protein measured at the same positions in the same cells showed no significant difference between the two ends of the cells. To determine whether the presence of the cell actually steepened the relative concentration gradient across the cell, we compared the relative amounts of TMR-EGF bound to the two ends of the cell. There was 2.5 ± 0.29 times more TMR-EGF bound to the side of the cell nearest to the pipet. Using the diffusion equation, and the distances between the cells and the pipet, that ratio would be predicted to be 3.4 ± 0.28. Thus, we do not detect an enhancement of the relative gradient across the cell. On the other hand, when the amount of TMR-EGF present in vesicles was quantified, the maximum intensity of internalized TMR-EGF on the side of the cell closest to the pipet was found to be six times the amount of TMR-EGF bound to the side of the cell away from the pipet. These results suggest that although receptor densities do not vary across the cell surface, the affinity and internalization properties of the receptors can amplify the apparent signal in the two following ways: 1) by increasing the absolute difference of ligand bound to the two ends of the cell, and 2) by concentrating the internalized ligand-receptor complexes on the side of the cell closest to the gradient source.
| |
DISCUSSION |
|---|
|
|
|---|
We focused this study on examining the initial steps in receptor
tyrosine kinase-ligand interaction and its contributions to
chemotactic responses, using a GFP-tagged EGFR. The EGFR appeared to be
uniformly distributed over the cell surface under all of the following
observed conditions: unstimulated motility, lamellipod extension in
response to a uniform increase in EGF concentration, and during
polarized motility in response to an EGF gradient. This uniform
distribution is consistent with what was observed for heterotrimeric G
protein-coupled chemoattractant receptors in Dictyostelium
(Xiao et al., 1997
) and neutrophils (Servant et
al., 1999
). On the other hand, previous studies of the EGFR have
suggested that the receptor might be concentrated in lamellipods in
A431 cells (Diakonova et al., 1995
) or in keratinocytes
polarized by electric fields (Zhao et al., 1999
). However,
contrary to the MTLn3 cells studied here, A431 cells have extremely
high levels of EGFRs, a fraction of which might then be more stably
associated with certain subcellular compartments. In keratinocytes
polarized by electric fields, the receptor-ligand complex might be
physically oriented by the electric field (Giugni et al.,
1987
), such redistribution being unnecessary in simple chemotactic gradients.
Although there was clear polarization in the sites of internalization
of the EGFR, with internalization occurring just behind the leading
edges of cells, we could not find any evidence of polarized membrane
recycling to the leading edges of extending lamellipods. Thus, it is
unlikely that polarized membrane secretion is responsible for the
maintenance of the even surface distribution of the receptor we
observed in our system. Likewise, the major sites of membrane
reinsertion do not appear to be at the leading edge of the extending
lamellipod. More probably, membrane insertion occurs over the dorsal
surface of the cell where dorsal protrusions transiently form,
providing additional membrane to allow extension at sites determined by
the chemotactic orientation of the cell. Lateral diffusion of receptors
with a diffusion coefficient of 0.5
1 × 10
10 cm2/s (Benveniste
et al., 1988
; Kusumi et al., 1993
; Brock et
al., 1999
) is likely to be sufficient for maintaining an even
receptor distribution, given the lamellipod extension rates of roughly 1 µm/min. These results are consistent with studies of neutrophils that indicate that membrane insertion is unlikely to occur directly at
the site of lamellipod extension (Lawson and Maxfield, 1995
; Lee
et al., 1990
). We cannot rule out the possibility that a
small fraction of membrane vesicles fuse at the leading edge or that vesicles that are poorly stained by all the dyes that we have tried
(NBD-C6-SM, NBD-C6-CM, or PKH26) are the primary vesicles moving to the
leading edge. However, such vesicles would not carry concentrated
amounts of EGFR either, since we observe movement of GFP-labeled
vesicles away from the leading edge rather than toward it. Similarly,
although there are significant numbers of transferrin receptors cycling
in these cells (Inoue et al., 1993
), the recycling is likely
to be occurring over the entire cell surface since we did not observe a
significant concentration of the transferrin receptor on the leading
edges of extending lamellipods.
Due to the relatively high affinity of the receptor, EGF becomes
concentrated on the cell surface relative to its concentration in
suspension. For example, the typical low-affinity EGF binding site has
a Kd of around 1 nM (Lichtner et
al., 1995
). With 50,000 receptors per cell, and a cell volume of 2 pl, when the EGF concentration in the medium is 1 nM, the concentration
of occupied receptors averaged over the entire cell volume will be 21 nM. However, the receptors are concentrated on the cell surface and not
evenly distributed throughout the cell, resulting in even more dramatic fluorescence at the cell membrane. This property raises the possibility of a receptor-mediated mechanism for gradient amplification in which
the absolute difference in the amount of chemoattractant bound to the
near and far ends of the cell is greater than the difference in
molecules in the medium between the two ends of the cell. Our
measurements using fluorescent EGF confirmed that the difference in
bound EGF between the two ends of the cell was greater than the
corresponding difference in the medium. Dictyostelium chemoattractant receptors do not have such high affinities (Janssens and Van Haastert, 1987
), and increases in bound ligand due to the
affinity are unlikely to occur in these cells. On the contrary, neutrophils do have high-affinity receptors for chemoattractants (Sklar, 1987
), and these affinity properties have been used for detailed comparisons of ligand-receptor kinetics with downstream signaling pathways in neutrophils (Sklar, 1987
), although not in
studies involving spatial gradients of fluorescent ligands.
Because of the relatively low off rate for dissociation of EGF from its
receptor, it is likely that as an EGF molecule binds to a receptor, it
is internalized before it is released. In this case, most of the ligand
that binds the receptors would be internalized, resulting in two
effects. First, there may be a perturbation of ligand binding to the
cell: for a gradient of chemoattractant, the binding of EGF to the
front of the cell will sequester molecules that would normally diffuse
to the rear of the cell and bind there, amplifying the gradient
detected by the cell. Such effects could also steepen morphogenetic
gradients during development. However, our measurements of TMR-EGF
bound to flat lamellipods do not show an enhancement greater than that
expected from diffusion from a point source, arguing against this
effect being significant under our stimulation conditions. A second
effect of the internalization of the EGFR is polarization of the
endocytosed receptor-ligand complexes. We found that endocytosis of
the receptor and the ligand was polarized to the side of the cell
exposed to the higher concentration of EGF. This is consistent with
studies of the CSF-1 receptor, which indicate that the amount of
internalized receptor is higher at the front of the cell than at the
rear in cells polarized by a gradient of CSF-1 (Jones et
al., 1998
). Transient increases in gradient steepness that are
present during the formation of the gradient (when release is initiated
from the pipet) are retained in the form of increased amounts of
internalized complexes on the side of the cell closest to the source.
Such prolonged increases may aid in providing an initial determination
of the source of the chemoattractant or may stabilize cell polarization.
In summary, we envision the following sequence of events occurring for the early stages of chemotactic responses of cells stimulated with a spatial gradient of EGF. A responsive cell begins with a uniform distribution of EGFRs over the cell surface with relatively small amounts of the internalized receptor. As the EGF gradient is applied, higher amounts of EGF bind to the side of the cell closest to the source. The affinity of the receptors amplifies the signal provided by low concentrations of EGF. In addition, internalized receptor-ligand complexes remain concentrated on the side of the cell closest to the EGF source, potentially continuing to contribute to polarization of the cell. The fusion of recycling vesicles occurs over the dorsal surface of the cell, providing additional membrane for lamellipod extension, but not focussed at the precise site of extension. Internalization of the receptor occurs through both small clathrin-coated pits as well as through the formation of endosomes from ruffles. Further internal signaling mechanisms probably aid in amplifying the signaling difference between receptors on the near and far sides of the cell to generate a polarized cell that moves toward the source of EGF. We expect that this scenario will be applicable to all chemoattractant receptors that have high affinity and are endocytosed rapidly in response to binding of the ligand.
| |
ACKNOWLEDGMENTS |
|---|
We thank H. S. Earp for the cDNA of the rat EGFR, and the Analytical Imaging Facility for microscopy. This work was supported by grants from the National Institutes of Health, the Department of Defense, and the Mortimer Harriman Trust. J.E.S. is supported by an Established Scientist Award from the New York City Affiliate of the American Heart Association. M.B. is supported by National Institutes of Health training grant 2-T32-CA09475. Videos corresponding to the figures can be seen at http://www.aecom.yu.edu/asb/segall/segall.htm.
| |
FOOTNOTES |
|---|
Online version of this article contains video material to
accompany Figures 1-6. Online version is available at
www.molbiolcell.org
Corresponding author. E-mail address:
segall{at}aecom.yu.edu
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Monypenny, D. Zicha, C. Higashida, F. Oceguera-Yanez, S. Narumiya, and N. Watanabe Cdc42 and Rac Family GTPases Regulate Mode and Speed but Not Direction of Primary Fibroblast Migration during Platelet-Derived Growth Factor-Dependent Chemotaxis Mol. Cell. Biol., May 15, 2009; 29(10): 2730 - 2747. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Z. Rappoport and S. M. Simon Endocytic trafficking of activated EGFR is AP-2 dependent and occurs through preformed clathrin spots J. Cell Sci., May 1, 2009; 122(9): 1301 - 1305. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Ghosh, M. Garcia-Marcos, S. J. Bornheimer, and M. G. Farquhar Activation of G{alpha}i3 triggers cell migration via regulation of GIV J. Cell Biol., July 28, 2008; 182(2): 381 - 393. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pu, C. D. McCaig, L. Cao, Z. Zhao, J. E. Segall, and M. Zhao EGF receptor signalling is essential for electric-field-directed migration of breast cancer cells J. Cell Sci., October 1, 2007; 120(19): 3395 - 3403. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gampel, L. Moss, M. C. Jones, V. Brunton, J. C. Norman, and H. Mellor VEGF regulates the mobilization of VEGFR2/KDR from an intracellular endothelial storage compartment Blood, October 15, 2006; 108(8): 2624 - 2631. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Orth, E. W. Krueger, S. G. Weller, and M. A. McNiven A novel endocytic mechanism of epidermal growth factor receptor sequestration and internalization. Cancer Res., April 1, 2006; 66(7): 3603 - 3610. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Xue, J. Wyckoff, F. Liang, M. Sidani, S. Violini, K.-L. Tsai, Z.-Y. Zhang, E. Sahai, J. Condeelis, and J. E. Segall Epidermal Growth Factor Receptor Overexpression Results in Increased Tumor Cell Motility In vivo Coordinately with Enhanced Intravasation and Metastasis Cancer Res., January 1, 2006; 66(1): 192 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-X. Zhu, S. Goldoni, G. Bix, R. T. Owens, D. J. McQuillan, C. C. Reed, and R. V. Iozzo Decorin Evokes Protracted Internalization and Degradation of the Epidermal Growth Factor Receptor via Caveolar Endocytosis J. Biol. Chem., September 16, 2005; 280(37): 32468 - 32479. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. McCaig, A. M. Rajnicek, B. Song, and M. Zhao Controlling Cell Behavior Electrically: Current Views and Future Potential Physiol Rev, July 1, 2005; 85(3): 943 - 978. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Hunton, W. G. Barnes, J. Kim, X.-R. Ren, J. D. Violin, E. Reiter, G. Milligan, D. D. Patel, and R. J. Lefkowitz {beta}-Arrestin 2-Dependent Angiotensin II Type 1A Receptor-Mediated Pathway of Chemotaxis Mol. Pharmacol., April 1, 2005; 67(4): 1229 - 1236. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gallio, C. Englund, P. Kylsten, and C. Samakovlis Rhomboid 3 orchestrates Slit-independent repulsion of tracheal branches at the CNS midline Development, August 1, 2004; 131(15): 3605 - 3614. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Kempiak, S.-C. Yip, J. M. Backer, and J. E. Segall Local signaling by the EGF receptor J. Cell Biol., September 1, 2003; 162(5): 781 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Neumeister, F. J. Pixley, Y. Xiong, H. Xie, K. Wu, A. Ashton, M. Cammer, A. Chan, M. Symons, E. R. Stanley, et al. Cyclin D1 Governs Adhesion and Motility of Macrophages Mol. Biol. Cell, May 1, 2003; 14(5): 2005 - 2015. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Denker and D. L. Barber Cell migration requires both ion translocation and cytoskeletal anchoring by the Na-H exchanger NHE1 J. Cell Biol., December 23, 2002; 159(6): 1087 - 1096. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Parsons, M. D. Keppler, A. Kline, A. Messent, M. J. Humphries, R. Gilchrist, I. R. Hart, C. Quittau-Prevostel, W. E. Hughes, P. J. Parker, et al. Site-Directed Perturbation of Protein Kinase C- Integrin Interaction Blocks Carcinoma Cell Chemotaxis Mol. Cell. Biol., August 15, 2002; 22(16): 5897 - 5911. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Caric, H. Raphael, J. Viti, A. Feathers, D. Wancio, and L. Lillien EGFRs mediate chemotactic migration in the developing telencephalon Development, November 1, 2001; 128(21): 4203 - 4216. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Ridley Rho GTPases and cell migration J. Cell Sci., January 8, 2001; 114(15): 2713 - 2722. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||