![]() |
|
|
Vol. 11, Issue 11, 4005-4018, November 2000

and
*Department of Developmental and Molecular Biology and
Departments of Radiation Oncology and Cell Biology,
Albert Einstein College of Medicine of Yeshiva University, Jack and
Pearl Resnick Campus, Bronx, New York 10461
| |
ABSTRACT |
|---|
|
|
|---|
Mammalian INT6 protein has been considered to be a subunit of the
eukaryotic translation initiation factor, eIF3. The Int6 locus is also
known as a common integration site of mouse
mammary tumor virus
(MMTV). However, the function of Int6 in translation initiation and the
mechanism of Int6-mediated tumor induction are yet to be explored. In
this study, the fission yeast, Schizosaccharomyces pombe, int6+, which is 43%
identical to the mammalian counterpart, was deleted. Despite the
evidence that the majority of Int6 protein was associated with 40S
particles in this organism, strains lacking
int6+
(
int6) were viable and showed only
moderate inhibition in the rate of in vivo global protein synthesis.
Polysome profile analysis showed no apparent defects in translation
initiation.
int6 exhibited a
hypersensitivity to caffeine, which could be suppressed by the addition
of sorbitol to the growth medium. This and other phenotypes would imply
that int6+ is required for the integrity of
cell membrane. In meiosis,
int6 produced incomplete tetrads frequently. High dosage expression of a
truncated mutant of int6+ conferred a
hypersensitivity to caffeine, but did not cause the defect in meiosis.
A possible link between the function of
int6+ and the
int6-phenotypes is discussed.
| |
INTRODUCTION |
|---|
|
|
|---|
Initiation of translation in eukaryotic cells requires the
participation of GTP and a large number of specific proteins called eukaryotic translation initiation
factors (eIFs). Among the initiation factors, eIF3 is the
most complex initiation factor known with respect to both its function
and its subunit composition. In vitro, the factor binds to the 40S
ribosomal subunit and the 40S-bound eIF3 plays an essential role in the
eIF1A-dependent transfer of initiator Met-tRNAf
(as Met-tRNAf·eIF2·GTP ternary complex) to 40S subunits to form the 40S-preinitiation complex
(40S·eIF3·Met-tRNAf·eIF2·GTP) (Chaudhuri
et al., 1999
). The presence of eIF3 bound to the 40S preinitiation complex is also a stringent prerequisite for the 40S
preinitiation complex to bind at the 5'-capped end of mRNA as well as
for the subsequent scanning of the mRNA by the 40S preinitiation
complex to locate the initiation AUG codon of the mRNA to form the 40S
initiation complex
(40S·eIF3·mRNA·Met-tRNAf·eIF2·GTP) (Merrick and Hershey, 1996
; Kozak, 1999
). The precise mechanism by
which eIF3 functions in each of the above steps is yet to be defined.
There is considerable uncertainty regarding the subunit composition of
functional eIF3. The factor has been isolated in several laboratories
from a variety of eukaryotic sources based on an assay that measured
its ability to stimulate mRNA translation in a protein synthesizing
system reconstituted with purified proteins (Benne and Hershey, 1976
;
Safer et al., 1976
; Schreier et al., 1977
;
Merrick, 1979
; Spremulli et al., 1979
; Checkley et
al., 1981
; Brown-Luedi et al., 1982
; Seal et
al., 1983
). Mammalian eIF3, purified in this way, was reported to
consist of ten major polypeptides, p170, p116, p110, p66, p48, p47,
p44, p40, p36,and p35 (Hershey et al., 1996
). In contrast to
mammalian eIF3, eIF3 purified from Saccharomyces cerevisiae
on the basis of an assay that measures AUG-dependent
methionyl-puromycin synthesis consisted of eight major polypeptides of
apparent molecular masses, 135, 90, 62, 39, 33, 29, 21, and 16 kDa
(Naranda et al., 1994
). However, when budding yeast eIF3 was
purified based on a direct assay for the presence of Prt1p, a known
subunit of yeast eIF3, it was observed that Prt1p copurified with only
four other polypeptides (Danaie et al., 1995
; Phan et
al., 1998
). This five-subunit core complex, consisting of Rpg1p
(also designated Tif32p), Prt1p, Nip1p, Tif34p, and Tif35p subunits,
stimulated the transfer of Met-tRNAf to 40S ribosomal subunits nearly 10-fold (Danaie et al., 1995
; Phan
et al., 1998
).
Comparison of the predicted amino acid sequence of each of the 10 mammalian eIF3 subunits with the derived protein sequences in the yeast
S. cerevisiae genomic data base revealed that all the five
subunits of yeast eIF3 core complex (Rpg1p, Prt1p, Nip1p, Tif34p, and
Tif35p) have corresponding homologues in mammalian eIF3, which are
p170, p116, p110, p36, and p44, respectively (Asano et al.,
1998
). However, the other mammalian eIF3 subunits, p66, p48, p47, p40,
and p35 have no structural homologues in S. cerevisiae. This
was somewhat surprising in view of the well-accepted notion that the
basic translation machinery including the pathway of translation
initiation is highly conserved between yeast and mammals (Donahue and
Huang, 1997
).
Among the mammalian eIF3 subunits that have no structural homologues in
budding yeast, the p48 subunit is of particular interest. Sequence
analysis of the p48-cDNA showed that p48 is identical to the mouse
protein INT6 (Asano et al., 1997
). The genomic locus of Int6
has been a frequent integration site for mouse
mammary tumor virus (MMTV) (Marchetti
et al., 1995
). This integration induces formation of mammary
tumors in mice although the mechanism of tumor formation is not clear.
The key question from the point of view of translation is what specific
role p48 (INT6), as a subunit of mammalian eIF3, performs in
translation initiation in mammalian cells. Interestingly, database
searches revealed that p48 has a structural homologue in the fission
yeast Schizosaccharomyces pombe. This observation provided a
unique opportunity to study the role of p48 (Int6) in translation
initiation in S. pombe.
In this paper, we describe the cloning and characterization of the
S. pombe gene encoding Int6 protein. Deletion of
int6+ (
int6) is
viable and exhibits only moderate inhibition in the rate of in vivo
protein synthesis, with no apparent defects in translation initiation.
int6 as well as expression of a C-terminally truncated version of Int6 cause phenotypes suggestive of a defect in
the maintenance of cell wall/membrane integrity.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains and Media
All strains used in this study were derived from wild-type strains. S. pombe was grown in standard YEA and PM media to which leucine and/or uracil were added when necessary.
Cloning of int6+ and Plasmid Construction
BLAST (Basic Local Alignment
Search Tool) search of the web-based genome
database (www.Sanger.ac.uk/BLAST) of the Sanger Centre (Cambridge,
United Kingdom) database with human Int6 sequence revealed that
the S. pombe homologue of human Int6 is present in cosmid
No. 646. A 3.5-kb XhoI/SpeI fragment containing
int6+ was obtained from cosmid No. 646 and
cloned into pBluescript SK (-) to generate the plasmid pINT6. The
coding sequence of Int6 cDNA was amplified by PCR from an S. pombe cDNA library, using pfu DNA polymerase
(Stratagene. L Jolla, CA) and two primer sequences as follows:
N-terminus, 5'-d GGCACTCGAGCATATGGGGTCCGAGCTTAAGAG-3' having a
XhoI/NdeI overhang; C-terminus,
5'-dAGCTGAATTCGGATCCCTAAACAGTAGCATGCTT-3' having a
BamHI/EcoRI overhang. The PCR product was
digested with NdeI and BamHI, was cloned into the
same sites of pREP41 to generate the thiamine-repressible pREP41-INT6
expression plasmid, and was sequenced to ensure error-free DNA
synthesis. To express the C-terminally truncated 50 amino acid shorter
version of Int6 protein, the same N-terminal primer was used in the PCR
reaction, while the other primer used for C-terminus was 5'-d
AGCTGAATTCGGATCCCTACTTAGCTTTAAACCCAAATTG -3'. The PCR product was
digested with NdeI and BamHI and was cloned in
pREP41 to generate a thiamine-repressible pREP41-C
50 INT6 expression
plasmid. Wild-type cells were transformed following standard procedures.
Gene Disruption
An SphI site was generated at a BamHI site
on pINT6, which is 4 bp downstream of the first ATG initiation codon of
the putative int6+ open reading frame. The
modified plasmid pINT6-1 contained two SphI sites in the
open reading frame of int6+, one generated
at the BamHI site and the other ~ 1543 bp downstream of the first ATG codon. A 1.8-kb SphI fragment containing
the fission yeast ura4+ gene was inserted
between the two SphI sites resulting in plasmid p
INT6,
which would remove a 1539 bp segment of
int6+ open reading frame. This construct,
digested by XhoI and SpeI, was used to disrupt
one copy of the int6+ gene in a diploid
(h+/h
leu1-32/leu1-32
ura4-d18/ura4-d18 ade6-216/210). Stable
Ura+ transformants were selected, and the
presence of ura4+ at the
int6+ locus was confirmed by Southern analysis.
Construction of Myc or Green Fluorescent Protein-Tagged int6+
Open reading frame (ORF) of
Enhanced Green Fluorescence
Protein (EGFP) was amplified by PCR using pfu DNA
polymerase (Stratagene) and two primer sequences as follows:
N-terminus, 5'-d
CCGCTCGAGGGGCATGCTAGTAAAGAGAAGAACTTTTC-3' having
a XhoI/SphI overhang; C-terminus, 5'-d
TCCGAATTCAGCATGCTTTTTGTATAGTTCATCCATGCC-3' having a
SphI/EcoRI overhang. The PCR product was digested
with SphI and was cloned into SphI linearized
pINT6 plasmid, thus generating pINT6-GFP plasmid. The resulting
construct was digested by XhoI and SpeI and was
used to knock in Int6-GFP fusion gene in the
int6 haploid
in which int6+ locus was disrupted with
ura4+.
The N-terminally Myc-tagged Int6-expressing strain was also generated using a similar strategy except that the BamHI site at + 4 position was utilized to insert the Myc tag at the N-terminus, maintaining the correct reading frame.
Caffeine Sensitivity Assay
The wild-type and
int6 strains were streaked on
fresh YEA plates and incubated at 32°C for two days. Cells from YEA
plates were inoculated into YEA medium containing 10 mM caffeine and were incubated at 32°C for 12 h. Cells were harvested and washed with 1.2 M sorbitol, followed by staining with DAPI (4',
6-diamidine-2-phenylindole dihydro-chloride), then examined under a
fluorescence microscope enhanced by CCD. For the experiment presented
in Figure 10, fresh wild-type cells transformed with empty pREP41,
pREP41-INT6, or pREP41-C
50 INT6 were streaked on PM plates
supplemented with 10 µg/ml thiamine and were grown at 32°C for
12 h. The cells were inoculated into PM medium containing 5 mM
caffeine and were grown for another 12 h at 32°C. Cells were
harvested, washed with 1.2 M sorbitol, stained with DAPI, and examined
under a fluorescence microscope enhanced by CCD.
Cloning and Expression of Full-length Human Int6 Gene in S. pombe
Full-length human INT6 ORF was reverse-transcribed and PCR
amplified from total HeLa RNA using Superscript preamplification system
(Life Technologies-BRL Lifetech, GIBCO, Grand Island, NY). Sequences of
the two primers used were as follows: N-terminus, 5'-d
CCGCTCGAGCATATGGCGGAGTACGACTTGACT -3' having a
XhoI/NdeI overhang; C-terminus, 5'-
dCGCGGATCCGAATTCTCAGTAGAAGCCAGAATCTTGAG -3' having a
BamHI/EcoRI overhang. The PCR product was
digested with NdeI and BamHI, cloned into the
same sites of pREP41 to generate the thiamine-repressible pREP41-hINT6
expression plasmid, and sequenced to ensure error-free DNA synthesis.
The construct was transformed into
int6 cells, and
transformants were selected on PM plates supplemented with 10 µg/ml thiamine.
Assay for Growth Inhibition in Presence of High KCl Concentration
Wild-type and
int6 strains were streaked on fresh
YEA plates and incubated at 32°C for two days. Cells recovered from
these plates were inoculated into YEA medium containing 1.2 M KCl and were grown in this high-salt medium for ~ 12 h at 32°C.
The cells were washed and examined as described under "Caffeine
Sensitivity Assay".
-Glucanase Sensitivity Assay
-glucanase sensitivity assay was performed following
procedures described previously (Levin and Bishop, 1990
). Briefly,
5 × 107 cells of WT,
pmk1, or
int6 cells were harvested from midlogarithmic phase
cultures in YEA medium and were washed with and resuspended in a buffer
containing 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM 2-mercaptoethanol,
followed by treatment with 100 µg/ml
-glucanase (Zymolyase-20T,
ICN) in the same buffer at 32°C with vigorous shaking. Cell lysis was
monitored by measuring absorbance at 600 nm.
In Vivo Protein Synthesis
The method used for measurement of in vivo protein synthesis is
an adaptation of the method of Sachs and Deardorff (Sachs and
Deardorff, 1992
). Exponentially growing cultures of wild-type and
mutant
int6 strains in YEA medium at 32°C were
harvested, resuspended in fresh YEA medium to a cell density of
0.75 × 106 cells/ml, and allowed to grow. When the
cells reached the density of ~ 1 × 106
cells/ml, ~ 2.5 ml of each culture was treated with 100 µCi of [35S]methionine (1175 Ci/mmol), and cells were allowed to
grow with vigorous shaking. At the indicated times, an aliquot (0.8 ml) was withdrawn, mixed with an equal volume of 20% trichloroacetic acid
(TCA) containing 1.2 mg/ml unlabeled methionine, and the mixture heated
at 95°C for 20 min in glass tubes. After cooling in an ice-water
bath, the precipitated proteins were filtered through GF/C filters
(Whatman, Maidstone, United Kingdom), which were then washed
several times with 10% ice-cold TCA, followed by a final washing with
95% ethanol. The dried filters were then assayed for
35S-radioactivity by counting in Econoflour (Packard
Instrument, Meriden, CT) in a liquid scintillation spectrometer.
Polysome Profile Analysis
Exponentially growing cultures of the wild-type strain and the
int6 strains in YEA medium at 32°C were harvested,
resuspended in fresh YEA medium to a final cell density of 0.75 × 106 cells/ml, and allowed to grow. When the cells
reached the density of ~ 1 × 106
cells/ml, a 70-ml aliquot of each culture was treated with
cycloheximide (50 µg/ml), rapidly chilled in an ice water bath, and
then harvested. The cells were washed twice with LHB buffer (10 mM
Tris-HCl, pH 7.5, 100 mM NaCl, 30 mM MgCl2, and
50 µg/ml cycloheximide). The washed cells were then suspended in 0.5 ml of LHB buffer, lysed by vortexing with an equal volume of glass
beads, then treated with an additional 0.5 ml of LHB buffer. The
lysates were clarified by centrifugation at 12,000 × g
for 15 min, and equivalent amounts of
A254 absorbing material (~ 10 A254 units) were layered on 11 ml of 7 to 47% (wt/vol) sucrose gradients in TMN buffer (10 mM Tris-Acetate,
pH 7.0, 12 mM MgCl2, 50 mM
NH4Cl) and centrifuged at 40,000 rpm for 2.5 h at 4°C in a Beckman SW41 rotor (Beckman, Fullerton, CA). The
gradients were fractionated in an ISCO density gradient fractionator,
and the absorbance profile at 254 nm was analyzed in an ISCO (Lincoln,
NE) UA-5 absorbance monitor.
Association of Fission Yeast Int6 with 40S Ribosomal Particles
A 100-ml culture of fission yeast cells harboring N-terminally Myc tagged Int6 were grown to midlogarithmic phase in YEAU medium. Cells were harvested and lysates prepared as described under "Polysome Profile Analysis" (see above). Approximately 10 A254 units of the lysates were layered on 11-ml of 5-30% (wt/vol) sucrose gradients in TMN buffer (10 mM Tris-Acetate, pH 7.0, 12 mM MgCl2, 50 mM NH4Cl) and were centrifuged at 40,000 rpm for 2.5 h at 4°C in a Beckman SW41 rotor. In a parallel tube, a preformed 43S preinitiation complex (40S·eIF3·AUG·[35S]Met-tRNAf·eIF2·GTP) formed with purified mammalian initiation components was also analyzed to define the position of sedimenting 40S particles. Fractions (500 µl) were collected from the bottom of each tube, and were treated with trichloroacetic acid (16% final concentration). The precipitated proteins in each fraction were resuspended in 50 µl of SDS-gel loading buffer, then boiled, and a 10 µl aliquot was analyzed by SDS-PAGE (10% gel) followed by immunoblotting using appropriate antibodies. In the gradient tube containing the 43S preinitiation complex, an aliquot of each fraction was counted in Aquasol (Packard Instrument, Meriden, CT) in a liquid scintillation spectrometer to determine the position of the 43S preinitiation complex.
Other Methods
eIF3 was purified from rabbit reticulocyte lysates as described
by Chaudhuri et al. (1997a)
. The purified eIF3
preparation contained the p48 polypeptide (INT6 protein) as judged by
immunoblot analysis using antihuman INT6 antibodies as
probe. The 43S preinitiation complex containing bound
[35S]Met-tRNAf was
prepared as described by Chaudhuri et al. (1997b)
as
follows. A reaction mixture (225 µl), containing 20 mM Tris-HCl, pH
7.5, 100 mM KCl, 5 mM 2-mercaptoethanol (TKM buffer), 15 µg of bovine
serum albumin, 40 pmol of
[35S]Met-tRNAf (17,500 cpm/pmol), 18 µM GTP, and 5 µg of purified rabbit reticulocyte
eIF2, was incubated for 4 min at 37°C to form the
[35S]Met-tRNAf.eIF2.GTP
ternary complex. The reaction mixture was then supplemented with 1.8 A254 units of purified 40S ribosomal subunits, 0.6 µg of purified eIF1A, 5 µg of purified eIF3, 0.1 A254 unit of AUG, and
MgCl2 (1 mM final concentration). After incubation at 37°C for 4 min, the reaction mixture was chilled in an
ice-water bath, and the MgCl2 concentration was
raised to 5 mM, then analyzed by 5-30% sucrose gradients in TKM
buffer containing 5 mM MgCl2 as described
(Chaudhuri et al., 1997b
). Rabbit polyclonal antihuman INT6
antibodies are a kind gift from Dr. Pierre Jalinot of Laboratoire de
Biologie Moléculaire et Cellulaire, Lyons, France. The
antibodies were raised against the C-terminal 20 amino acids of the
protein (Desbois et al., 1996
).
| |
RESULTS |
|---|
|
|
|---|
Molecular Cloning of Fission Yeast int6+
Comparison of the predicted amino acid sequence of each of the 10 mammalian eIF3 subunits with the derived protein sequences in S.
pombe and S. cerevisiae genomic databases showed
that only five of the mammalian eIF3 subunits have corresponding
homologues in the budding yeast, S. cerevisiae. In
contrast, except p35, all other subunits of mammalian eIF3 including
INT6 (p48) have structural homologues in the fission yeast, S.
pombe (Table 1). The
int6+ gene was found on a cosmid clone (No.
646) that was previously mapped on chromosome II of S.
pombe genome (Mizukami et al., 1993
). The Int6
protein is highly conserved among species throughout the length of the
protein. Int6 from S. pombe, C. elegans,
Drosophila, mouse, and human were aligned for maximum
homology by Jotun Hein method (Figure 1).
S. pombe Int6 is 43% identical and 59% similar to its
mammalian counterparts. The fission yeast Int6, however, is ~ 15% longer than its higher eukaryotic homologues due to the presence
of extra amino acids at the extreme N-terminus as well as near the
C-terminus. Following appropriate enzymatic digestion of the cosmid No.
646, the entire int6+ gene, flanked by
surrounding genomic sequence, was identified in a 3.5-kb
SpeI-XhoI fragment. This fragment was
inserted into the appropriate restriction sites of pBluescript SK (-)
to generate pINT6. Analysis of the nucleotide sequence of the 3.5-kb
SpeI-XhoI fragment indicated that the
gene has a 58-bp long intron 34-bp downstream of the start ATG. The
initiation ATG codon at + 1 is preceded by a translational stop codon
TGA at position
15 and fairly satisfies the criteria for consensus of
translational start sites
3GAUAUGG+4 (the
start codon is italicized) (Kozak, 1999
).
|
|
Deletion of int6+
The int6+ gene was replaced with the
fission yeast ura4+ gene as described under
MATERIALS AND METHODS. The replacement (Figure 2A) would allow expression of, at most,
the first one and the last two amino acids of the Int6 protein and thus
would not cause any phenotypes due to the remaining part of the
int6+ gene. After transformation of
wild-type diploid cells with a plasmid (designated p
INT6) that
carried the ura4+ gene in place of the
int6+ gene, stable Ura+
transformants were isolated. Genomic DNAs of several transformants were
subjected to Southern blot analysis to screen for heterozygous diploids
with one wild-type int6+ gene and one
disrupted (h+/h
leu1-32/leu1-32
ura4-d18/ura4-d18 int6+::ura4+/+
ade6-216/210). The heterozygous diploid was then sporulated for
tetrad analysis. Of the 13 tetrads, eight yielded all four viable
spores in which the Ura+ marker segregated into 2:2;
indicating int6+ gene is not essential for
viability. To further confirm the disruption of the
int6+ locus, Southern and Northern analyses
were carried out following standard protocols. The SalI
restriction digest followed by hybridization of the probe (shown in
Figure 2A) would identify a 1.9-kb DNA fragment in wild-type
int6+ locus, whereas it would identify a
4.7-kb fragment from the disrupted locus. As anticipated above, a
single 1.9-kb fragment was identified in the wild-type diploid (Figure
2B, lane 1), whereas a 4.7-kb fragment in addition to the 1.9-kb
fragment was observed in the heterozygous diploid (lane 2). Analysis of
four segregants from a tetrad of the heterozygous diploid identified
the 4.7-kb DNA fragment in two of the Ura+ segregants
(lanes 3 and 5), whereas in the other two segregants that were
ura4
, the 1.9-kb band was detected (lanes
4 and 6). Northern analysis of the four segregants further confirmed
the disruption of the int6+ locus. The
int6+ transcript was detected in the
wild-type diploid, the heterozygous diploid as well as in the two
ura4
segregants (Figure 2C, lanes 1, 2, 4 and 6). In contrast, no int6+ transcript was
detected in the two Ura+ segregants (lanes 3 and 5),
although approximately similar amounts of total yeast RNA (20 µg)
were examined (Figure 2C, lower panel). These results indicated that 1)
the int6+ gene was successfully replaced by
the ura4+ gene, and 2) the resulting
disrupted strains that expressed no int6+
gene were viable. The int6+-disrupted
haploid, henceforth, will be referred to as
int6.
|
Although the int6+ gene is not essential for
growth and viability,
int6 cells grew more slowly
than a wild-type strain. At 32°C, an optimal growth temperature for
fission yeast, the generation times of a wild-type and
int6 cells in YEA medium were 2.0 ± 0.2 h
and 2.56 ± 0.2 h, respectively (Figure
3A). The growth of
int6
strain was particularly impaired in S. pombe-liquid
minimal medium (PMA). In this medium, while the wild-type strain grew at a rate similar to that in YEA liquid medium, the generation time of
int6 strain in PMA was greater than 3.5 h. The
slow growth phenotype of
int6 could be rescued by
introduction of the wild-type int6+ gene or
to a lesser extent by the human Int6 gene provided from an
extrachromosomally replicating plasmid (Figure 3B).
|
We also constructed strains that express Int6 tagged with
Myc-epitope or GFP. In the parental plasmid, pINT6, appropriate restriction sites were generated into which Myc-epitope or GFP were
inserted. The resulting plasmids were used to replace the disrupted
int6+ gene with
int6+ tagged with Myc-epitoope or GFP
(Figure 2A). The ura
transformants that had lost the
ura4+ gene due to the replacement were
collected and further examined for the structure of the
int6+ gene. Using Southern and Northern
blotting as well as PCR, we confirmed that the replacement was
successful and that it produced strains expressing tagged Int6 protein,
but were otherwise identical to the parental strain (data not shown).
These strains did not show any phenotypes conferred by
int6 (see below), indicating that Int6 tagged with
Myc-epitope or GFP are biologically active.
Association of Int6 with 40S Ribosomal Subunits
Eukaryotic translation initiation factor 3 (eIF3), purified
from mammalian cell lysates, was reported to consist of 10 major polypeptides (Hershey et al., 1996
). One of these
polypeptides, p48 was shown to be INT6 based on cDNA sequence analysis
(Asano et al., 1997
). Consistent with this observation, we
also found that purified mammalian eIF3 ((Benne and Hershey, 1976
;
Chaudhuri et al., 1999
) contained INT6 polypeptide (Figure
4A, inset). However, it should be noted
that the level of INT6 in this preparation was not stoichiometric to
the other subunits of eIF3 (see Discussion). Characterization of
mammalian eIF3 has shown that in crude mammalian cell-free extracts,
eIF3 is found exclusively bound to 40S particles (Smith and Henshaw,
1975
; Thompson et al., 1977
). In vitro studies using
purified initiation factors have also shown that eIF3 binds to 40S
subunits in the absence of all other initiation components to form the
40S.eIF3 complex that is stable to sucrose gradient centrifugation
(Benne and Hershey, 1976
; Chaudhuri et al., 1999
). The
initiator Met-tRNAf (as
Met-tRNAf.eIF2.GTP ternary complex) then binds to
the 40S.eIF3 particle to form the 40S preinitiation complex (40S.eIF3.
Met-tRNAf.eIF2.GTP), which subsequently
recognizes the AUG codon of the mRNA to form the 40S initiation complex
(40S.eIF3.mRNA.Met-tRNAf.eIF2.GTP). These
properties of mammalian eIF3 prompted us to examine the association of
Int6 with 40S particles in fission yeast cells. We reasoned that if
fission yeast Int6, like its mammalian counterpart, is a subunit of
eIF3, it should remain bound to the 40S particles under conditions
where mammalian eIF3 containing INT6 as one of its subunits remains
bound to 40S particles.
|
Cell-free extracts of a strain of S. pombe expressing
N-terminally Myc-tagged Int6 were subjected to sucrose gradient
centrifugation, and the gradient fractions were assayed for Int6 by
Western blot analysis. A 43S preinitiation complex (40S.eIF3.
Met-tRNAf.eIF2.GTP), formed by incubating 40S
ribosomal subunits with purified mammalian eIF3 and
[35S]Met-tRNAf.eIF2.GTP
ternary complex, was also analyzed in a parallel gradient tube (Figure
4A). Under these conditions,
[35S]Met-tRNAf bound to
40S ribosomes sedimented with the 40S particles and thus defined the
position of 40S ribosomal subunits. Western blot analysis of each
gradient fraction showed that Myc-tagged fission yeast Int6 and
mammalian Int6 sedimented at a position where the 43S preinitiation
complex also sedimented (Figure 4B, upper panel). It should be noted
that, in agreement with the results published previously (Chaudhuri
et al., 1999
), when the gradient fractions from the 43S
preinitiation complex were analyzed by Western blotting using total
anti-mammalian eIF3 antibodies (Chaudhuri et al., 1997a
) as
probes, all the mammalian eIF3 subunits cosedimented with the 43S
preinitiation complex (data not shown). Western blot analysis of
gradient fractions using antimammalian INT6 antibodies showed that INT6
also sedimented with the 43S preinitiation complex (Figure 4A, lower
panel). Further confirmation that fission yeast Int6 sedimented with
the 40S particles came from the observation that the Int6 containing
fractions contained 18S rRNA, a known constituent of 40S ribosomal
subunits (Figure 4B, lower panel). It should be noted that a portion of
fission yeast Int6 sedimented in fractions lighter than 40S particles.
The possibility exists that N-terminally tagged Int6 has a weaker
association with the other subunits of eIF3. Alternatively, association
of fission yeast Int6 with the other eIF3 subunits is inherently weaker
than its mammalian counterpart.
Int6 Is Not Essential for Translation Initiation
The presence of INT6 in highly purified eIF3 preparations prompted
us to examine the effect of deletion of the
int6+ gene on translation of mRNA in
S. pombe cells. For this purpose, exponentially growing
cultures of
int6 and a wild-type strain were pulsed with
[35S]methionine, and the rate of protein
synthesis was measured over a 30-min time period. The rate of protein
synthesis, measured by incorporation of
[35S]methionine into polypeptide chains in
int6 cells, was ~ 30-40% slower than the rate of
wild-type cells (Figure 5, panel A). This slower rate of methionine incorporation into cellular proteins in
int6 cells is in keeping with the slower growth rate of
int6 cells as compared with the wild-type strain.
|
To investigate whether the 30-40% decrease in the incorporation of
[35S]methionine was due to slight defects in
the initiation phase of protein synthesis, we examined the polyribosome
profile of exponentially growing cultures of
int6 and
control wild-type cells. It is now well established that, when
initiation of translation is slowed or blocked, ribosomes already bound
to mRNAs complete translation but, after their release from mRNAs, do
not reinitiate the translation process. This leads to a diminution of
the size of polysomes and accumulation of 80S ribosomes. When extracts prepared from exponentially growing cultures of
int6 and
wild-type control cells were analyzed by sucrose gradient
centrifugation, the polyribosome content of both strains showed similar
profiles (Figure 5, panel B). However, a slight decrease in the
polysome content and a slight increase in free 80S ribosomes were
observed for
int6 cells. These results may indicate a
small effect of Int6 protein in initiation of translation but rule out
that Int6 is essential for the initiation process in global protein synthesis.
Int6 Is a Cytoplasmic Protein
Using a strain expressing Int6 tagged with GFP, we determined the
cellular localization of the protein. The majority of Int6-GFP was
found in cytoplasm. This localization and the intensity of the signal
seemed to be homogenous when an asynchronous culture was examined
(Figure 6), suggesting that Int6 does not
change its level and localization in a manner depending on progression of the cell cycle.
|
int6 Is Hypersensitive to Caffeine
We tested the
int6 strain for sensitivity to a
variety of stress conditions such as treatment with UV light, caffeine,
thiabendazole, and incubation at 36°C or 20°C. Among these
conditions it was observed that
int6 is hypersensitive to
caffeine. In the YEA medium containing 10 mM caffeine, a wild-type
fission yeast strain grew slowly (Figure
7B). It was also apparent that most of
the cells have multiple septa (Figure
8C). The phenotype induced by the drug
would suggest that the drug might have an inhibitory effect on
maintenance of integrity of cell wall/membrane, or on cytokinesis. The
caffeine-induced phenotype was much more pronounced in the
int6 strain. The
int6 cells were unable to
form colonies on YEA plates containing 10 mM caffeine (Figure 7B).
Microscopic observation revealed that these cells were elongated and
lysed (Figures 7A, 8D and 8F). Because
int6 cells lysed
in the caffeine containing medium, we speculated that it could become
resistant to the drug if the medium contained an osmotic stabilizer
such as sorbitol. Indeed, if sorbitol was added to the medium,
int6 strain could form colonies in the presence of 10 mM
caffeine at a rate similar to that of the wild-type strain (Figure 7B).
Although the drug could have multiple cellular targets and cause
various phenotypes, the suppression by sorbitol would indicate that the hypersensitivity to the drug is most likely due to a defect in cell
wall/membrane caused by lack of Int6 protein.
|
|
A similar phenotype, i.e., cell elongation and lysis with multiple
septation in the presence of caffeine, has previously been reported for
MAPK cascade mutants and the function of the MAPK cascade in
maintenance of cell wall integrity has been proposed (Loewith et
al., 2000
). It has also been shown that these deletion strains are
sensitive to high concentration (1.2 M) of KCl in the medium. We
observed that
int6 cells were likewise sensitive to 1.2 M
KCl concentration in the medium. Whereas a wild-type strain could form
colonies on YEA plates containing 1.2 M KCl, the
int6
strain failed to do so (our unpublished results).
It has been reported that the mutants of the MAP kinase cascade form a
defective cell wall. Treatment with a cell wall-digesting enzyme,
-glucanase, results in cell lysis more dramatically in the mutants
than wild-type strains (Toda et al., 1996
; Sengar et
al., 1997
)]. The observed similarity between
int6
and the mutants of the MAP kinase cascade prompted us to test if
int6 exhibits a similar defect in cell wall integrity. As
shown in Figure 9A, deletion of the MAP
kinase gene (
pmk1) exhibited a high sensitivity to
-glucanase, whereas
int6 as well as a wild-type strain
were resistant to the enzyme treatment. These results may suggest that
the underlying mechanism of caffeine sensitivity conferred by
int6+ deletion may not be the same as for
the MAP kinase cascade mutants.
|
int6 Cells Fail to Recover from Saturated Growth
We also observed that the
int6 cells were unable to
recover from growth saturation. When they were transferred from an
actively growing state to fresh YEA medium, they formed colonies at a
slightly reduced rate (Figure 9B) compared with wild-type cells. In
contrast, when the
int6 cells were grown to a saturated
state and transferred to fresh YEA medium, a major fraction of the
cells were unable to form colonies (Figure 9B). Microscopic observation
revealed that the
int6 cells transferred from a saturated
state were rounded, a phenotype similar to that of starved cells (data
not shown). Due to presumed defects in maintenance of cell
wall/membrane integrity, the
int6 cells may be defective
in their ability to uptake nutrients necessary for recovery from a
saturated state.
Negative Effect of a Truncated Int6
In most cases, tumor-causing integration of MMTV genome in the
mouse Int6 locus produces different forms of C-terminally truncated INT6 protein. It was therefore hypothesized that overexpression of
these C-terminally truncated forms of INT6 driven by viral LTR causes
tumors in mice (Marchetti et al., 1995
). We examined whether
overexpression of a C-terminally truncated Int6 in fission yeast causes
any aberrant phenotype. For this purpose, we transformed a wild-type
strain with pREP41-C
50 INT6 plasmid that would allow overexpression
of a truncated Int6 protein lacking the C-terminal 50 amino acids
(designated C
50). When the transformants were grown in the presence
of 5 mM caffeine in PM medium, the cells showed a highly elongated
shape (Figure 10). Transformants with a
control vector or a plasmid that overexpresses the full-length int6+ gene did not show any apparent
phenotypes under the same conditions (Figure 10). It should be noted
that overexpression of C
50 causes a phenotype which is slightly
different from that of
int6. First, the cells expressing
C
50 exhibited cell elongation at a lower concentration of the drug.
Second, the elongated cells in the medium containing caffeine did not
lyse. Overexpression of C
50 appeared to affect the function of Int6
partially (see DISCUSSION). When C
50 was expressed from a single
copy gene integrated in the genome, it did not cause the phenotype (our
unpublished results).
|
Defect in Meiosis
In the course of strain construction, we noticed that cross
between
int6 and
int6 produced incomplete
tetrads frequently. As shown in Figure
11, 30-40% of asci of the
int6 homozygous cross contained less than four spores.
The defect was suppressed to a large extent when
int6 was
crossed to the wild-type strain.
|
| |
DICUSSION |
|---|
|
|
|---|
Fission Yeast int6+ Gene
In this study we have characterized a fission yeast gene
(int6+) that is 43% identical to the
mammalian INT6 gene. The complementation of deletion of
int6+ (
int6) by the human
Int6 ORF strongly suggests that they are functionally homologous.
Our interest in the Int6 protein stems from our effort to understand
the process of eukaryotic translation initiation and the central role
the multi-subunit initiation factor eIF3 plays in this process. Asano
et al. (1997)
reported INT6 as one of the 9-10 polypeptide
subunits comprising purified mammalian eIF3. Although in recent years,
the molecular genetic techniques in the budding yeast S. cerevisiae have been very useful to understand the function of
translation initiation factors in vivo, the genome of budding yeast
does not encode any genes related to INT6 (Table 1). The fission yeast
model system thus offers a unique opportunity to study the functions of
Int6 protein by genetic approaches. Assuming that Int6 plays a role
with eIF3, fission yeast appears to share a common mechanism for
translation initiation and its regulation in mammalian cells.
Association of Int6 with 40S Subunits
The question naturally arises is whether Int6 is a subunit of
fission yeast eIF3. To answer this question, it is necessary to isolate
and characterize eIF3 from fission yeast. This has not yet been
achieved. However, an important property of mammalian eIF3 is its
association with 40S subunits in cell-free extracts (Smith and Henshaw,
1975
; Thompson et al., 1977
). Therefore, if Int6 associates
with eIF3, it would remain bound to 40S particles. This work as well as
work from Norbury's laboratory has demonstrated that in cell-free
extracts of fission yeast, Int6 cosediments with the 40S particles.
More directly, fission yeast Int6 can be coimmunoprecipitated with a
major component of eIF3, Sum1 (Dr. Chris Norbury, Imperial
Cancer Research Fund, University of Oxford, Oxford, United Kingdom;
personal communication). These observations suggest that the fission
yeast Int6 is either associated with the core subunits of fission yeast
eIF3 by protein-protein interaction or the polypeptide is a bona-fide
subunit of eIF3. It should however, be noted that when we purified eIF3
from rabbit reticulocyte lysates, INT6 was found not to be
stoichiometric with the other subunits of eIF3 (Figure 4A). Therefore,
the possibility also exists that INT6 associates only with a subset of
rabbit eIF3.
Role of int6+ in Translation Initiation
We show that fission yeast cells lacking Int6 (
int6)
support protein synthesis well exhibiting polysome-ribosome profiles similar to wild-type cells. If Int6 played an essential role in initiation of global protein synthesis, its absence in yeast cells would have caused extensive breakdown of polysomes with simultaneous increase in free 80S ribosomes as was observed in S. cerevisiae cells depleted of any essential translation initiation
factor (Maiti and Maitra, 1997
). These observations argue against the idea that Int6 is essential for initiation of global protein synthesis. It should, however, be emphasized that
int6 strain
showed ~ 30-40% slower rate of
[35S]methionine incorporation as compared with
a wild-type strain. In view of our observation that the
int6+ gene is required for maintenance of
the integrity of cell wall/membrane, the possibility exists that the
lower rate of [35S]methionine incorporation
into
int6 yeast cells is a reflection of poorer uptake of
amino acids into
int6 yeast cells as compared with
int6+ cells. Alternatively, it remains
possible that Int6 is required either for translation of a small subset
of mRNAs or for optimal efficiency of the rate of initiation of
translation of all mRNAs. Analysis of phenotypes conferred by
int6 has indicated that
int6 exhibits a
defect in the integrity of cell wall/membrane. The
int6
phenotype would support a model in which fission yeast Int6 regulates
translation initiation of a subset of proteins that are required for
maintenance of the integrity of cell wall/membrane.
Caffeine Hypersensitivity and Other Phenotypes of
int6
One of the apparent phenotypes conferred by
int6 is
the hypersensitivity to caffeine. Although the drug probably targets multiple cellular components and causes various phenotypes, it has been
reported that the primary effect of caffeine on the fission yeast cell
cycle is an inhibition of cytokinesis (Kumada et al., 1996
).
Consistent with this previous study, we have observed an inhibitory
effect of the drug on cytokinesis in the wild-type strain. The
caffeine-induced phenotype is much more prominent in the
int6 strain. The hypersensitivity is suppressed by
addition of sorbitol to the media. The suppression strongly implies
that
int6 loses its viability due to osmotic stress
caused by the drug. Other negative effects that could be caused by the
drug would not directly result in the hypersensitivity.
int6 also confers a slow growth rate, sensitivity to KCl,
inability to recover from a saturated state and a defect in meiosis. We
speculate that
int6 may form a defective cell
wall/membrane which causes the phenotypes in the multiple biological processes.
It has recently been reported that the fission yeast MAP kinase cascade
plays a role in the maintenance of cell wall/membrane (Loewith et
al., 2000
; Sugiura et al., 1999
; Toda et
al., 1996
). Three kinases, namely Mkh1, Pek1/Skh1, and Pmk1/Spm1,
form a sequential signaling cascade (Loewith et al., 2000
;
Sugiura et al., 1999
; Toda et al., 1996
).
Deletion of any one of these genes causes phenotypes similar to those
of
int6. First, deletion causes cell elongation in
presence of caffeine (Loewith et al., 2000
). Second, it
causes inhibition of growth in media containing KCl (Loewith et
al., 2000
). Finally, deletion of pmk1+
causes a defect in recovery from a saturated state (Toda et
al., 1996
). On the other hand, while the mutants in the MAP kinase cascade form cell wall that is sensitive to treatment with
-glucanase, cell wall of
int6 is resistant to this
treatment. Likewise, the mutants in the MAP kinase cascade are not
defective in meiosis. These results would suggest a partial overlap in
the function of Int6 and the MAP kinase cascade. Further study would
shed light on the functional link between the MAP kinase cascade and
the Int6 protein.
Effect of a Truncated int6 Protein
Integration of MMTV in the mouse Int6 locus results in expression
of a truncated form of the INT6 protein (Marchetti et al., 1995
). At present, it is not clear how a truncated INT6 protein induces
tumor formation in the mouse mammary epithelial tissue. MMTV may simply
disrupt the biological activity of the affected Int6 gene causing a
reduction in the dose of the normal gene product. Alternatively, a
truncated form of INT6 may have a dominant negative or active effect
leading to hyperplasia in the mouse mammary gland. In this study, we
have tested if a truncated int6+ gene has a
negative effect in fission yeast. For this purpose, we have expressed
several versions of truncated Int6 proteins in the wild-type strain.
One such construct, which overexpresses a truncated Int6 protein
lacking the C-terminal 50 amino acids (designated C
50), causes a
phenotype. In presence of caffeine, wild-type cells expressing
C
50-Int6 protein exhibit a highly elongated cell shape.
Interestingly, overexpression of C
50 can cause the phenotype in a
medium containing 5 mM caffeine, whereas
int6 strain
expressed the phenotype at a higher concentration of the drug,10 mM. In
addition, C
50 does not cause other phenotypes observed in
int6. When C
50 is overexpressed, it may replace the
wild-type Int6 and abrogate the function.
Based on the assumption that Int6 may play a role with eIF3 in
regulation of translation initiation of a subset of proteins, we would
interpret the discrepancy between
int6 and C
50 as
follows: While eIF3 without Int6 fails to initiate translation of all
proteins in the subset, eIF3 with C
50 can regulate translation
initiation of a limited number of proteins in the subset. The
difference in protein composition may lead to the discrepancy in
expression of the phenotype. It should also be noted that
overexpression of the human Int6 can suppress the slow growth of
int6, but not the hypersensitivity to caffeine. Thus, the
human Int6 in fission yeast is partially functional. A lower level of
expression of C
50 did not cause any phenotype, suggesting it is not
dominant negative.
Implication in Tumor Biology
The Int6 gene is a common integration site for the mouse mammary
tumor virus (MMTV). A human homologue of Int6 is located on chromosome
region 8q22-q23. Examination of this allele revealed loss of
heterozygosity (LOH) in 11 of 39 (28%) of the tumor samples. Because
single-strand conformation and hybrid mismatch analysis of the
remaining allele in these tumor DNAs failed to detect any mutations, it
has been concluded that the target gene for LOH must be closely linked
to Int6 (Miyazaki et al., 1997
). Thus, it is likely that
mutations in the human Int6 also cause tumors.
In this study we have shown that the fission yeast
int6+ is required for maintenance of the
integrity of cell wall/membrane. Assuming that the human INT6 functions
in a similar biological process, we hypothesize that mutations in the
mammalian Int6 gene cause an abnormal membrane structure, which might
result in defective endocytosis. Ligand binding followed by its
internalization is often used as a signal, which regulates cell growth.
The Int6-induced tumor cells may not be able to correctly process such
a signal, which negatively regulates cell division. In higher
eukaryotes, a number of genes required for endocytosis has been
characterized as tumor suppressor genes or oncogenes (Floyd and De
Camilli, 1998
). It should be noted that the fission yeast
int6 cells fail to recover from a saturated state and
exhibit a smaller, round cell shape, a characteristic phenotype of
starved cells. This may imply that
int6 cell is defective
in endocytosis and cannot uptake components necessary for recovery from
a saturated state.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to Pierre Jalinot of Laboratoire de Biologie Moléculaire et Cellulaire, France, for providing us with rabbit polyclonal anti-human INT6 antibodies. The authors thank Dr. Chris Norbury for communicating results before publication and Dr. Takashi Toda for strains. This work was supported by Grant GM-15399 from the National Institutes of Health and by Cancer Core Support Grant P30CA13330 from the National Cancer Institute.
| |
FOOTNOTES |
|---|
Corresponding authors. E-mail
addresses: U. Maitra; maitra{at}aecom.yu.edu and T. Matsumoto;
tmatsumo{at}aecom.yu.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y.-S. Lee, S.-L. Choi, T.-H. Kim, J.-A Lee, H. K. Kim, H. Kim, D.-J. Jang, J. J. Lee, S. Lee, G. S. Sin, et al. Transcriptome analysis and identification of regulators for long-term plasticity in Aplysia kurodai PNAS, November 25, 2008; 105(47): 18602 - 18607. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. L. Jenkins, J. Mata, R. F. Crane, B. Thomas, A. Akoulitchev, J. Bahler, and C. J. Norbury Activation of AP-1-Dependent Transcription by a Truncated Translation Initiation Factor Eukaryot. Cell, November 1, 2005; 4(11): 1840 - 1850. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Buttitta, C. Martella, F. Barassi, L. Felicioni, S. Salvatore, S. Rosini, T. D'Antuono, A. Chella, F. Mucilli, R. Sacco, et al. Int6 Expression Can Predict Survival in Early-Stage Non-Small Cell Lung Cancer Patients Clin. Cancer Res., May 1, 2005; 11(9): 3198 - 3204. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Mandell, K. J. Goodrich, J. Bahler, and T. R. Cech Expression of a RecQ Helicase Homolog Affects Progression through Crisis in Fission Yeast Lacking Telomerase J. Biol. Chem., February 18, 2005; 280(7): 5249 - 5257. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-H. Kim, B.-H. Kim, A. Yahalom, D. A. Chamovitz, and A. G. von Arnim Translational Regulation via 5' mRNA Leader Sequences Revealed by Mutational Analysis of the Arabidopsis Translation Initiation Factor Subunit eIF3h PLANT CELL, December 1, 2004; 16(12): 3341 - 3356. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Matsumoto, A. Bandyopadhyay, D. J. Kwiatkowski, U. Maitra, and T. Matsumoto Role of the Tsc1-Tsc2 Complex in Signaling and Transport Across the Cell Membrane in the Fission Yeast Schizosaccharomyces pombe Genetics, July 1, 2002; 161(3): 1053 - 1063. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Dunand-Sauthier, C. Walker, C. Wilkinson, C. Gordon, R. Crane, C. Norbury, and T. Humphrey Sum1, a Component of the Fission Yeast eIF3 Translation Initiation Complex, Is Rapidly Relocalized During Environmental Stress and Interacts with Components of the 26S Proteasome Mol. Biol. Cell, May 1, 2002; 13(5): 1626 - 1640. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Morris-Desbois, S. Rety, M. Ferro, J. Garin, and P. Jalinot The Human Protein HSPC021 Interacts with Int-6 and Is Associated with Eukaryotic Translation Initiation Factor 3 J. Biol. Chem., November 30, 2001; 276(49): 45988 - 45995. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Burks, P. P. Bezerra, H. Le, D. R. Gallie, and K. S. Browning Plant Initiation Factor 3 Subunit Composition Resembles Mammalian Initiation Factor 3 and Has a Novel Subunit J. Biol. Chem., January 12, 2001; 276(3): 2122 - 2131. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shalev, L. Valasek, C. A. Pise-Masison, M. Radonovich, L. Phan, J. Clayton, H. He, J. N. Brady, A. G. Hinnebusch, and K. Asano Saccharomyces cerevisiae Protein Pci8p and Human Protein eIF3e/Int-6 Interact with the eIF3 Core Complex by Binding to Cognate eIF3b Subunits J. Biol. Chem., September 7, 2001; 276(37): 34948 - 34957. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bandyopadhyay, V. Lakshmanan, T. Matsumoto, E. C. Chang, and U. Maitra Moe1 and spInt6, the Fission Yeast Homologues of Mammalian Translation Initiation Factor 3 Subunits p66 (eIF3d) and p48 (eIF3e), Respectively, Are Required for Stable Association of eIF3 Subunits J. Biol. Chem., January 11, 2002; 277(3): 2360 - 2367. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||