![]() |
|
|
Vol. 11, Issue 2, 579-592, February 2000
Department of Anatomy and Structural Biology, Albert Einstein College of Medicine, Bronx, New York 10461
Submitted June 21, 1999; Revised October 5, 1999; Accepted November 15, 1999| |
ABSTRACT |
|---|
|
|
|---|
The plasma membrane ATPase, encoded by PMA1, is delivered to the cell surface via the secretory pathway. Previously, we characterized a temperature-sensitive pma1 mutant in which newly synthesized Pma1-7 is not delivered to the plasma membrane but is mislocalized instead to the vacuole at 37°C. Several vps mutants, which are defective in vacuolar protein sorting, suppress targeting-defective pma1 by allowing mutant Pma1 to move once again to the plasma membrane. In this study, we have analyzed trafficking in the endosomal system by monitoring the movement of Pma1-7 in vps36, vps1, and vps8 mutants. Upon induction of expression, mutant Pma1 accumulates in the prevacuolar compartment in vps36 cells. After chase, a fraction of newly synthesized Pma1-7 is delivered to the plasma membrane. In both vps1 and vps8 cells, newly synthesized mutant Pma1 appears in small punctate structures before arrival at the cell surface. Nevertheless, biosynthetic membrane traffic appears to follow different routes in vps8 and vps1: the vacuolar protein-sorting receptor Vps10p is stable in vps8 but not in vps1. Furthermore, a defect in endocytic delivery to the vacuole was revealed in vps8 (and vps36) but not vps1 by endocytosis of the bulk membrane marker FM 4-64. Moreover, in vps8 cells, there is defective down-regulation from the cell surface of the mating receptor Ste3, consistent with persistent receptor recycling from an endosomal compartment to the plasma membrane. These data support a model in which mutant Pma1 is diverted from the Golgi to the surface in vps1 cells. We hypothesize that in vps8 and vps36, in contrast to vps1, mutant Pma1 moves to the surface via endosomal intermediates, implicating an endosome-to-surface traffic pathway.
| |
INTRODUCTION |
|---|
|
|
|---|
In mammalian cells, entry of newly synthesized hydrolases into the
lysosomal pathway is mediated by a sorting receptor at the
trans-Golgi complex (Kornfeld and Mellman, 1989
).
Analogously, in Saccharomyces cerevisiae, Vps10 is a sorting
receptor that recycles between the trans-Golgi and the
endosome, recognizing a signal within soluble hydrolases and thereby
effecting their delivery to the vacuole (Marcusson et al.,
1994
; Cooper and Stevens, 1996
). Genetic screens to identify yeast
mutants defective in delivery of the vacuolar marker carboxypeptidase Y
(CPY) have resulted in >40 VPS genes required for proper
vacuolar protein sorting, revealing the complexity of the vacuole
biosynthetic pathway (Rothman and Stevens, 1986
; Robinson et
al., 1988
). Because biosynthetic traffic to the vacuole or
lysosome intersects with endocytic traffic at the endosome, a subset of
the vps mutants also displays defects in endocytosis (Davis
et al., 1993
; Munn and Riezman, 1994
; Singer-Kruger et
al., 1994
).
The general organization of the endocytic pathway has been
especially well characterized in mammalian cells. Specifically, extracellular molecules and plasma membrane proteins travel through the
endocytic pathway to the lysosome via two sequential intermediates, early and late endosomes. Similarly, in yeast, two populations of
endosomes have been defined morphologically as well as biochemically (Singer-Kruger et al., 1993
; Hicke et al., 1997
;
Mulholland et al., 1999
). Nevertheless, a molecular
understanding of endosome function remains far from complete (Gruenberg
and Maxfield, 1995
; Mellman, 1996
; Riezman et al., 1997
). In
mammalian cells, a recycling pathway is well established by which
certain internalized proteins are delivered back to the plasma membrane
(Gruenberg and Maxfield, 1995
; Mellman, 1996
). In contrast, in yeast,
the existence of a direct traffic pathway from the endosome to the cell
surface has not been established to date, although a number of recent studies suggest such a pathway (Harsay and Bretscher, 1995
; Yuan et al., 1997
; Ziman et al., 1998
). Indeed, two
populations of Golgi-derived secretory vesicles have been isolated from
yeast; the finding that preventing endocytosis results in the
accumulation of only one of these populations is consistent with the
idea that one of these classes of vesicles may derive from endocytic
recycling (Harsay and Bretscher, 1995
).
We were prompted to examine whether an endosome-to-surface
traffic pathway exists in yeast by studies of PMA1, which
encodes the plasma membrane ATPase. Normally, Pma1 reaches the cell
surface via the secretory pathway (Brada and Schekman, 1988
; Chang and Slayman, 1991
). However, in the temperature-sensitive pma1-7
mutant, newly synthesized Pma1 is defective for targeting to the plasma membrane at 37°C and instead is delivered to the vacuole via the endosome (Chang and Fink, 1995
; Luo and Chang, 1997
). Although the
molecular basis for vacuolar delivery of Pma1-7 is unknown, we have
considered the possibility that there is a post-endoplasmic reticulum
quality control mechanism that recognizes and targets mutant Pma1 into
the endosomal/vacuolar system (Chang and Fink, 1995
; Hong et
al., 1996
; Li et al., 1999
). Several vps
mutants, which are defective in vacuolar protein sorting, have been
identified that cause rerouting of mutant Pma1 to the plasma membrane
(Luo and Chang, 1997
). By disrupting the recycling of a Golgi-based quality control receptor, these vps mutants might allow
Pma1-7 to travel directly from the Golgi to the cell surface. With this in mind, we have compared trafficking pathways of mutant Pma1 in
vps1, vps8, and vps36. Remarkably, the
data suggest that in vps8 and vps36 cells, Pma1-7
moves to the plasma membrane only after it has entered the endosomal system.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Media and Strains
Standard yeast media and genetic manipulations were as described
(Sherman et al., 1986
). Yeast transformations were performed by the lithium acetate method (Gietz et al., 1992
). Strains
used in this study are listed in Table 1. All strains
except those marked with asterisks are isogenic with L3852.
vps8-
1::LEU2 and vps36-
1 were
isolated as suppressors of pma1-7 after insertional mutagenesis (Luo and Chang, 1997
). ACY76 was generated in a one-step gene replacement by transformation of L3852 with pPS83, a
HIS3-marked VPS8 disruption construct
(Horazdovsky et al., 1996
) provided by B. Horazdovsky (Texas
Southwestern Medical Center, Dallas, TX). ACY33 was generated in a
one-step gene replacement by transformation of L3852 with pKJH2, a
LEU2-marked VPS27 disruption construct (Piper
et al., 1995
) provided by T. Stevens (University of Oregon, Eugene). WLY65 was generated in a one-step gene replacement by transformation of L3852 with pBS-YPT51-LYS2 (Singer-Kruger et al., 1994
) provided by B. Singer-Kruger (University of Stuttgart, Germany). WLX20-5D is an ascospore from a cross between WLX16-1A and
WLX4-2A (MATa lys2
201 leu2-3,112 ura3-52 ade2
vps27-
1::LEU2). Integration of MET-HA-PMA1
and MET-HA-pma1-7 at ura3-52 was accomplished by
transforming yeast with pWL10 and pWL9 linearized with NcoI. ACY72 was constructed by pop-in, pop-out gene replacement of
STE3 by transformation of ACX66-2D (MAT
his3
200
leu2-3,112 ura3-52 ade2 trp1
63 GAL+) with
pSL1904 (provided by N. Davis, Wayne State University, Detroit, MI),
resulting in replacement of the STE3 promoter with a
GAL1,10 promoter. ACY81 was constructed by
transformation of ACY72 with pPS83, a vps8::HIS3
disruption construct. ACY84 and ACY85 were constructed by
transformation of ACY72 and ACY81 with pAS173, a
pep4::hisG-URA3-hisG disruption construct (Chang
and Fink, 1995
), to disrupt PEP4.
|
Molecular Biology
Plasmids with HA-tagged pma1-7 and PMA1
under the control of the MET25 promoter were constructed as
follows. With the use of XhoI (polylinker) and
BstEII sites, a 1.7-kilobase (kb) fragment from the 5'
region was removed from pAC7 and pAC4 bearing 4.5-kb HindIII-HindIII pma1-7 and
PMA1 inserts, respectively (Chang and Fink, 1995
). The
fragment was replaced with a 750-base pair (bp) fragment from pFT4
(provided by C. Slayman, Yale University, New Haven, CT), which has a
HindIII site introduced at
27 bp from the start codon,
generating pWL1 and pWL2. A 4.2-kb
HindIII-HindIII fragment bearing the
PMA1 coding sequence was excised from pWL1 and pWL2 and
placed after the MET25 promoter of FB1521 (Mumberg et
al., 1994
). The 4.6-kb fragments containing MET-pma1-7
and MET-PMA1 were excised with the use of
SacI-XhoI polylinker sites and placed into
pRS306, a URA3-marked YIp, generating pWL5 and pWL6,
respectively. To introduce an HA epitope, the plasmid pXZ28 (containing
PMA1 with an HA epitope introduced after the second amino
acid; provided by J. Haber, Brandeis University, Waltham, MA) was used
as a template for PCR. A fragment of 0.8 kb was amplified with the use
of the oligonucleotide TCCCCCGGGAGCTAGTTAAAGAAAATC to introduce a
SmaI site at
67 bp from the start codon and the oligonucleotide CCTTCACCTCTCTTAACA. After cutting with SmaI
and BstEII, the PCR fragment was used to replace the
corresponding fragments in pWL5 and pWL6 to generate pWL9 and pWL10, respectively.
Protein Induction
To detect newly synthesized Pma1, plasmids were used in which HA-tagged mutant or wild-type Pma1 was placed under the control of the MET25 promoter. Cells were grown under repressing conditions in minimal medium containing 600 µM methionine. To induce synthesis of Pma1, cells were washed once with water and resuspended in methionine-free medium. At the same time, cells were shifted to 37°C. Synthesis of HA-tagged Pma1 was shut off by adding 2 mM methionine alone or in the presence of 100 µg/ml cycloheximide.
To study Ste3, cells were grown to midlog phase at 30°C in synthetic complete minus uracil medium with 2% galactose. Glucose (3%) was added to stop synthesis of Ste3. For detection of Ste3 by Western blot, anti-Ste3 mAb (provided by G. Sprague, University of Oregon) was used. For Ste3 detection by indirect immunofluorescence, cells were transformed with a GAL1-STE3 construct in which a c-myc epitope is fused to the carboxyl terminus of STE3 (pSL2015; provided by N. Davis, Wayne State University).
Indirect Immunofluorescence, Cell Fractionation, Western Blotting, and Metabolic Labeling
For indirect immunofluorescence, cells were spheroplasted with
oxalyticase (Enzogenetics, Corvallis, OR) and permeabilized with
methanol and acetone, as described (Rose et al., 1990
).
Cells were stained with anti-HA (BABCO, Berkeley, CA) or anti-myc mAb (Santa Cruz Biotechnology, Santa Cruz, CA) followed by Cy3-conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA).
Pulse-chase experiments were visualized with the use of an Olympus
(Lake Success, NY) IX70 microscope, and the images were collected
digitally (with the same exposure for each time point within an
experiment) and adjusted at the same settings with Adobe Photoshop 4.0 (Adobe Systems, Mountain View, CA). All other fluorescent microscopy experiments were photographed with the use of a Zeiss Axiophot microscope (Carl Zeiss, Thornwood, NY).
Cell fractionation on Renografin (gift of L. Marsh, Albert
Einstein College of Medicine) density gradients was performed
essentially as described (Schandel and Jenness, 1994
; Jenness et
al., 1997
). Harvested samples were placed on ice in the presence
of 10 mM azide. Cell lysates were prepared by vortexing cells with
glass beads in the presence of a protease inhibitor cocktail including 1 mM PMSF (Chang and Slayman, 1991
). After centrifugation at 400 × g for 5 min to remove unbroken cells, lysate (0.5 ml) was
mixed with 0.5 ml of Renografin-76, placed at the bottom of a
centrifuge tube, and overlaid with 1 ml of 34, 30, 26, and 22%
Renografin solutions. For pulse-chase experiments, samples from
different time points were loaded on gradients after normalization to
lysate protein by the Bradford assay (Bio-Rad Laboratories, Hercules, CA). Gradients were centrifuged in an SW50.1 rotor overnight at 150,000 × g at 4°C. Fourteen fractions (350 µl)
were collected from the top of each gradient. To prevent Renografin
from interfering with subsequent Western blotting, membranes were
diluted with Tris-EDTA buffer and pelleted by centrifugation at
100,000 × g for 1 h. Intracellular membranes and
plasma membrane were consistently contained in fractions 6-7 and
10-11, respectively. Therefore, quantitation of newly synthesized Pma1
was performed by pooling fractions 1-8 and 9-14. Distribution of
mutant Pma1 after induction and chase was determined by Western
blotting and calculated after subtraction of the background signal
obtained at time 0.
For Western blotting of cell lysate, samples were prepared as described
previously (Chang and Slayman, 1991
) and normalized to lysate protein.
After separation by SDS-PAGE, proteins were transferred to
nitrocellulose. Anti-HA Western blotting was performed with the use of
mAb. Antibodies against Kex2, Pep12, and Gas1 were provided by S. Nothwehr (University of Missouri, Columbus), H. Pelham (Medical
Research Council Laboratories, Cambridge, UK), and T. Doering (Washington University, St. Louis, MO), respectively. Immune
complexes were visualized by chemiluminescence detection reagents (ECL
Western blotting detection system; Amersham, Arlington Heights, IL) or
125I-protein A (Amersham). Quantitation of
Western blots with the use of 125I-protein A was
performed with the use of a Molecular Dynamics (Sunnyvale, CA) phosphorimager.
Metabolic labeling was performed with the use of cultures grown to midlog phase in synthetic complete medium without methionine and cysteine. Cells were resuspended at 1 OD600/ml, labeled with Expre35S35S (New England Nuclear, Boston, MA) (2 mCi/25 OD600 cells) for 5 min at room temperature, and chased in the presence of 10 mM methionine and cysteine. At various times during the chase, aliquots were placed on ice in the presence of 10 mM Na azide. Lysates were prepared and resuspended in RIPA buffer (10 mM Tris, pH 7.5, 150 nM NaCl, 2 mM EDTA, 1% NP40, 1% deoxycholate, 0.1% SDS) for immunoprecipitation.
| |
RESULTS |
|---|
|
|
|---|
Inducible Synthesis of Mutant Pma1
To visualize movement of newly synthesized Pma1, we used
constructs in which wild-type PMA1 and mutant
pma1-7 were tagged with an HA epitope and placed under the
control of the MET25 promoter. Although a low level of
synthesis is detected under repressing conditions, the Western blot in
Figure 1 shows a large increase in
synthesis of Pma1 upon activation of the MET25 promoter (by removal of methionine from the medium). Quantitation reveals that the
level of wild-type Pma1 upon induction is approximately fivefold greater than that of mutant Pma1, probably because of concurrent degradation of the mutant protein. After stopping synthesis,
degradation of newly synthesized mutant Pma1 is readily apparent after
90 min, whereas wild-type Pma1 remains stable (Figure 1).
|
Previously, we demonstrated that degradation of mutant Pma1 occurs at
37°C upon trafficking of the newly synthesized protein to the vacuole
(Chang and Fink, 1995
; Luo and Chang, 1997
). To confirm that
epitope-tagged Pma1 behaves in the same manner, indirect immunofluorescence localization was performed in pep4 cells
defective in vacuolar protease activity. Synthesis of HA-tagged Pma1
was induced for 1 h at 37°C, and the cells were then stained
with anti-HA antibody. As shown in Figure
2, newly synthesized Pma1-7 is
accumulated at the vacuole (bottom left), which is recognized as pale
regions under phase contrast optics (bottom right). In contrast,
staining of cells expressing wild-type Pma1 is at the cell surface
(top).
|
Newly Synthesized Mutant Pma1 Reaches the Prevacuolar Compartment of vps36 Cells before Arrival at the Cell Surface
Mutant Pma1 is delivered to the cell surface in two
class E vps mutants, vps36 and vps27
(Luo and Chang, 1997
). Class E vps mutants are characterized
by defective trafficking from the endosome to the vacuole as well as
from the endosome back to the Golgi (Piper et al., 1995
). In
both vps36 and vps27 mutants, some proteins traversing endocytic and biosynthetic pathways are trapped in a novel
prevacuolar compartment that is visualized as a characteristic large
spot next to the vacuole; on the other hand, newly synthesized CPY is
missorted in these cells and travels directly from the Golgi to the
cell surface (Raymond et al., 1992
; Piper et al., 1995
). To determine the route by which mutant Pma1 travels to the
plasma membrane in the class E vps mutants, the localization of newly synthesized Pma1 was determined by staining with anti-HA antibody. As shown in Figure 3A (0',
top), no staining is seen in vps36
cells before induction
of mutant Pma1 synthesis. After a 90-min induction period, staining of
newly synthesized Pma1-7 appears predominantly in large perivacuolar
spots; little cell surface staining is apparent (Figure 3A, middle,
arrowheads). Previously, we established that this staining pattern is
characteristic of mutant Pma1 accumulating in the prevacuolar
compartment (Luo and Chang, 1997
). The same pattern of Pma1-7
accumulation was also seen in vps27
cells (data not
shown). These observations confirm that newly synthesized mutant Pma1
enters the endosomal system in class E vps mutants. In
contrast, wild-type Pma1 does not detectably accumulate in the
prevacuolar compartment or other intracellular compartments (Figure
4).
|
|
To determine whether mutant Pma1 can move to the cell surface from the
prevacuolar compartment, vps36
cells were reexamined after an additional 90-min chase period. Cycloheximide was included during the chase to ensure that no additional Pma1 synthesis could occur. As shown in Figure 3A (bottom), staining of the prevacuolar compartment declines after the chase. Much of the decrease is likely
due to degradation in the proteolytically active prevacuolar compartment (Cereghino et al., 1995
). In addition, staining
of the plasma membrane appears to increase slightly (Figure 3A, bottom, arrows). A similar pattern was observed in vps27
cells
(data not shown). Quantitation of newly synthesized Pma1-7 at the cell surface was performed by fractionation on Renografin density gradients, which efficiently separate plasma membranes from intracellular membranes (Jenness et al., 1997
) (see below). Figure 3B
shows the results of such an experiment in which the level of mutant Pma1 in intracellular and plasma membranes in vps36 cells
was quantitated after induction and chase and plotted in arbitrary units. In this experiment, the plasma membrane fraction contains 31%
of total Pma1-7 present during the induction period; after chase, the
plasma membrane fraction represents 41% of Pma1-7 remaining. In three
independent experiments, an ~9% fractional increase at the cell
surface was observed after chase. Thus, relocation of Pma1-7 from the
endosomal system to the cell surface appears to occur, albeit inefficiently.
Cell Surface Delivery of Newly Synthesized Mutant Pma1 in vps1 and vps8
To compare a possible endosome-to-surface route with a
Golgi-to-surface route, mutant Pma1 trafficking was followed in
vps1 cells. Vps1 is a dynamin-like protein required for
formation of endosome-bound vesicles from the Golgi, and all
endosome-directed traffic is diverted to the cell surface in
vps1 mutants (Nothwehr et al., 1995
). Figure
5 (left middle panel) shows mutant Pma1 localization in vps1
cells after a 90-min induction
period. Both bright punctate cytoplasmic staining and some surface
staining (arrows) are apparent. After 90 min of chase (left bottom
panel), the punctate staining has disappeared and there is exclusive
staining of the cell surface. These observations are consistent with
direct transport of newly synthesized mutant Pma1 from the Golgi to the plasma membrane.
|
vps8 mutation also allows Pma1-7 to travel to the plasma
membrane (Luo and Chang, 1997
). Because vps8 cells
accumulate the bulk membrane marker FM 4-64 in an endocytic
intermediate compartment distinct from the prevacuolar compartment (Luo
and Chang, 1997
) (see below), it was of interest to examine the pathway
to the cell surface taken by Pma1-7 in vps8. As shown in
Figure 5, after induction for 90 min, mutant Pma1 localizes to punctate
cytoplasmic structures (right middle panel). After a 90-min chase,
staining is predominantly at the plasma membrane, indicating that newly synthesized Pma1-7 moves to the cell surface (right bottom panel). Movement to the plasma membrane in both vps8 and
vps1 cells is unaffected by the presence of cycloheximide
(data not shown). Compared with vps36, cell surface delivery
of mutant Pma1 appears more efficient in vps8 and
vps1 (compare bottom panels of Figures 3A and 5).
Although the immunofluorescence localization pattern of Pma1-7 in
vps8
resembles that in vps1
cells, careful
comparison suggests slightly more surface staining after induction in
vps1 (Figure 5, left middle panel, arrows). To compare
further vps1 and vps8 mutants, cell fractionation
was performed on Renografin density gradients. Figure
6A shows the distribution of marker proteins after fractionation of wild-type cells on a Renografin gradient. The plasma membrane protein Gas1 is found predominantly in
fractions 10 and 11. Newly synthesized wild-type Pma1 is also localized
in these fractions. In contrast, Kex2 and Pep12, membrane proteins that
recycle between the Golgi and the endosome (Wilcox et al.,
1992
; Becherer et al., 1996
), are predominantly distributed in fractions 5-7. Figure 6B shows the fractionation pattern of Pma1-7
in vps1
and vps8
cells. After 90 min of
induction at 37°C in vps1
cells, the majority of newly
synthesized Pma1-7 cofractionates with plasma membrane in fractions 10 and 11. In contrast, in vps8
cells, a larger fraction of
newly synthesized Pma1-7 is distributed in intracellular membrane
fractions. Because there is distinct and consistent separation between
intracellular and plasma membranes on Renografin density gradients,
fractions 1-8 and 9-14 were pooled for analysis by quantitative
Western blotting. As shown in Figure 6C, after 90 min of induction,
>80% of mutant Pma1 has reached the cell surface in vps1,
whereas in vps8, Pma1-7 is mostly intracellular. After 90 min of chase, the fraction of mutant Pma1 at the cell surface is
increased in vps8
cells. These data reveal that Pma1-7 is
delivered to the plasma membrane with different kinetics in
vps1 and vps8.
|
Trafficking of Newly Synthesized Vps10 in vps1 and vps8 Mutants
The kinetic differences in cell surface arrival is consistent with
the possibility that Pma1-7 may take different routes to the plasma
membrane in vps1 and vps8. To examine this
possibility in greater detail, trafficking of Vps10 was compared in
vps1 and vps8 mutants. In wild-type cells, Vps10,
the CPY-sorting receptor, is a stable protein that recycles between the
trans-Golgi and the endosomes (Marcusson et al.,
1994
; Cooper and Stevens, 1996
). Previous reports have shown that
recycling of trans-Golgi membrane proteins, including Vps10,
is disrupted in vps1 mutants; Vps10 travels instead to the
plasma membrane, where it undergoes rapid internalization, delivery to
the vacuole, and degradation (Wilsbach and Payne, 1993
; Cereghino
et al., 1995
; Nothwehr et al., 1995
). Figure
7 shows analysis of newly synthesized
Vps10 by pulse labeling of cells with
[35S]methionine and
[35S]cysteine followed by chase for
various times. In vps1
cells, Vps10 undergoes proteolytic
cleavage at 2 h of chase (arrow), whereas it appears stable in
wild-type and vps8
cells. Similarly, vps1, but
not vps8, perturbed the stability of the
trans-Golgi membrane protein Kex2 (data not shown). These
data support the idea that biosynthetic membrane traffic follows
different routes in vps8 and vps1.
|
Endocytosis of the Bulk Membrane Marker FM 4-64
Of relevance to defining the trafficking route of Pma1-7 is the
report that there is defective endocytosis of the fluorescent membrane
marker FM 4-64 in vps8 (Luo and Chang, 1997
). To
characterize further the endocytic defect in vps8, a time
course of FM 4-64 endocytosis was examined. Figure
8A shows that FM 4-64 staining occurs predominantly at the plasma membrane when wild-type or vps8 cells are incubated with the dye at 0°C, as described
previously (Vida and Emr, 1995
). (The small bright fluorescent spots
that are also seen [Figure 8A, 0'] are likely endocytic structures formed during photography of the cells.) After warming the cells to
permit endocytosis to proceed, cell surface staining disappears at
similar rates in both wild-type and vps8 cells, indicating that internalization from the cell surface is not affected in vps8. At 20 min after warming, FM 4-64 is seen in the
cytoplasm as well as in the vacuolar membrane in wild-type and
vps8 cells. By 60 min after internalization, FM 4-64 has
been cleared from the cytoplasm and is exclusively at the vacuole
membrane in wild-type cells (Figure 8A, top right panel), whereas much
of the internalized dye remains in vesicular intermediates in the
cytoplasm of vps8
cells (Figure 8A, middle right panel).
|
In vps1 cells, FM 4-64 labels multiple vacuolar compartments
(Figure 8B), reflecting the fragmented vacuolar morphology of the cells
(Raymond et al., 1992
). Nevertheless, no defect in endocytic delivery to the vacuole was detected, in agreement with previous reports (Wilsbach and Payne, 1993
; Nothwehr et al., 1995
).
FM 4-64 endocytosis was also performed in double mutants in which
vps8 mutation was combined with a class E vps
mutation. After 1 h of internalization in vps27 cells,
accumulation of FM 4-64 in the prevacuolar compartment is seen as a
large bright spot next to the vacuole (Figure 8B) (Vida and Emr, 1995
).
However, in vps8 vps27 double mutants, the pattern of FM
4-64 accumulation largely resembles that seen in vps8 cells,
with much of the fluorescence signal in vesicular intermediates in the
cytoplasm (Figure 8B). The same result was obtained in vps8
vps36 double mutants (data not shown). In contrast, in cells in
which the class E vps mutation is combined with
vps1, there is FM 4-64 accumulation in the prevacuolar compartment but not at an early endocytic step (data not shown). These
data indicate that the endocytic defect seen in the vps8 mutant occurs before the prevacuolar compartment of class E
vps cells.
Consistent with delayed transport through an early endocytic
intermediate in vps8, a similar pattern of dye accumulation
was observed in ypt51
cells (Figure 8A, bottom panels).
Ypt51 is a small GTPase and homologue of mammalian Rab5, and previous
work has shown that ypt51 cells accumulate internalized
factor in an early endocytic intermediate (Sambrook et al.,
1989
; Singer-Kruger et al., 1994
, 1995
).
Endocytosis of the Mating Receptor Ste3
To analyze further the endocytic defect of vps8, the
behavior of the cell surface receptor Ste3 was examined. In wild-type cells, Ste3 undergoes constitutive endocytosis and vacuolar degradation (Davis et al., 1993
). To follow the fate of cell surface
Ste3 in the absence of new receptor synthesis, STE3 was
placed under the control of the GAL1 promoter. Figure
9A shows Western blot analysis of Ste3
stability at various times after glucose addition to repress
STE3 expression. In wild-type cells, Ste3 is rapidly degraded upon glucose addition. In contrast, in vps8, the
steady-state level of Ste3 (at time 0) is increased and the rate of
Ste3 degradation is decreased (Figure 9A). These results
are in agreement with the kinetic delay in delivery to the vacuole
observed by FM 4-64 endocytosis (Figure 8). The pep4
mutation stabilizes Ste3 in both wild-type and vps8 cells,
indicating that Ste3 degradation is due to vacuolar delivery (Figure
9A) (Davis et al., 1993
).
|
Indirect immunofluorescence was used to observe Ste3 endocytosis (Figure 9B). Within 5 min after glucose addition, the distribution of Ste3 in wild-type and vps8 cells appears similar (Figure 9B, top panels). At this time, Ste3 is seen predominantly at the plasma membrane, although some Ste3 is also found in small intracellular spots, likely reflecting endocytic intermediates. By 1 h after stopping further receptor synthesis, Ste3 staining in wild-type cells is markedly diminished; although some punctate staining is visible, staining at the cell surface is not readily apparent. In contrast to that in wild-type cells, plasma membrane Ste3 staining persists in vps8 cells, consistent with receptor recycling to the plasma membrane.
| |
DISCUSSION |
|---|
|
|
|---|
We have analyzed trafficking pathways in the endosomal
system by monitoring the movement of newly synthesized Pma1-7. In
several vps mutants, a fraction of Pma1-7 is rescued from
vacuolar degradation and delivered to the cell surface. We show that in
vps1 cells, newly synthesized mutant Pma1 can move to the
plasma membrane after appearing briefly in punctate intracellular
compartment(s) (Figure 5). Consistent with previous reports (Wilsbach
and Payne, 1993
; Nothwehr et al., 1995
), it seems likely
that mutant Pma1 in vps1 cells is routed directly to the
plasma membrane from the Golgi complex.
In class E vps mutants, newly synthesized Pma1-7 accumulates
first in the prevacuolar compartment (Figure 3). After chase in the
presence of cycloheximide to ensure that no further synthesis could
occur, a small fraction (~10%) of newly synthesized Pma1-7 was
observed to move to the plasma membrane. These data support a model in
which protein traffic can flow from the prevacuolar compartment to the
plasma membrane, albeit inefficiently. Because there is defective
retrograde transport from the prevacuolar compartment to the Golgi in
class E vps mutants (Piper et al., 1995
), it is unlikely that transport of mutant Pma1 to the cell surface occurs via a
Golgi intermediate. It is possible, however, that movement of Pma1-7 in
these cells from the prevacuolar compartment to the surface occurs via
an early endosomal intermediate (Figure
10) (see below).
|
Our data have relevance to understanding the mechanism by which
misfolded proteins are delivered to the vacuole. A model has been
proposed in which vacuolar delivery of misfolded proteins occurs by
receptor-mediated transport (Chang and Fink, 1995
; Hong et
al., 1996
; Li et al., 1999
). Our observation that
mutant Pma1 enters the endosomal system of class E vps
mutants argues that such a quality control receptor probably does not
recycle routinely through the prevacuolar compartment.
Mutant Pma1 is also routed to the cell surface in vps8
cells (Figure 6). Our immunofluorescence and cell fractionation
experiments do not have sufficient resolution to prove unequivocally
that Pma1-7 enters the endosomal system of vps8 mutants
before reaching the surface. Nevertheless, several observations prompt
us to hypothesize that mutant Pma1 moves to the plasma membrane from an
early endosomal compartment in vps8 cells (Figure 10).
First, cell surface arrival of mutant Pma1 occurs more slowly in
vps8 compared with vps1 (Figure 6). Second,
pulse-chase analysis shows that Vps10 undergoes rapid degradation in
vps1 cells but not in vps8 cells. These data are consistent with vps8 and vps1 mutations having
different effects on membrane traffic. Third, FM 4-64 endocytosis
experiments indicate defective transport through an early endocytic
compartment in vps8, in contrast to vps1 cells,
which have no apparent endocytic defect (Figure 8). Finally, although
plasma membrane internalization is not impaired (Figure 8),
down-regulation of Ste3 from the cell surface is impaired by
vps8 (Figure 9). These observations suggest persistent
receptor recycling to the surface from an endosomal compartment. (Note
that cell surface Ste3 is also increased in the class E vps
mutant ren1/vps2, in which there is a block in traffic from
the prevacuolar compartment to the vacuole [Davis et al.,
1993
].)
Enhanced endosome-to-surface trafficking in vps8
represents the simplest model that can account for all of the
observations we have reported. Previous work on Vps8p reveals that it
is a large membrane-associated protein containing a RING finger
zinc-binding motif (Chen and Stevens, 1996
; Horazdovsky et
al., 1996
). A role for Vps8 in the endosomal system is supported
by genetic interactions between VPS8 and YPT51
(Horazdovsky et al., 1996
) as well as between VPS8 and PEP5/END1 (Woolford et al.,
1998
). Nevertheless, we cannot formally rule out the possibility that
mutant Pma1 moves to the surface directly from the Golgi in
vps8 mutants. Similarly, we cannot exclude the possibility
that mutant Pma1 undergoes retrograde transport from the endosome to
the Golgi followed by delivery to the surface. (On the other hand,
because CPY is missorted in vps8
cells [Chen and
Stevens, 1996
; Horazdovsky et al., 1996
], recycling of
Vps10 back to the Golgi is likely impaired.)
Our hypothesis is summarized in Figure 10, in which proposed impaired step(s) in transport from the Golgi to the vacuole are labeled with the corresponding vps mutations. We propose that in vps8 cells, there is an accumulation within early endosomes of proteins entering either from the cell surface (Ste3) or from the biosynthetic pathway (Vps10 and mutant Pma1). As a consequence, there is increased transport to the cell surface. Because plasma membrane delivery of Pma1-7 in class E vps mutants appears less efficient than in vps8 cells, it is possible that movement to the surface from the prevacuolar or late endosome compartment occurs via an early endosome intermediate.
In mammalian cells, an endosome-to-surface traffic pathway is
taken constitutively by many internalized membrane proteins and lipids.
In some cell types, the pathway is specialized for recycling synaptic
vesicle components, antigen presentation, insulin-dependent control of
glucose transport, and transcytosis. Indeed, some newly synthesized
proteins are normally delivered to the plasma membrane via the endosome
(Futter et al., 1995
; Leitinger et al., 1995
). Recent observations suggest that there is possibly analogous
endosome-to-surface trafficking in yeast. Analysis of the chitin
synthase Chs3 has led to the proposal that its distribution between the
plasma membrane and the "chitosome," an endosomal compartment, is
regulated by recycling (Chuang and Schekman, 1996
; Ziman et
al., 1998
). Work on copper entry into the yeast secretory pathway
has suggested that copper loading of the surface enzyme ceruloplasmin
occurs within an endosomal compartment (Yuan et al., 1997
).
Thus, selected plasma membrane proteins may pass through endosomes to
fulfill specific processing requirements. Our finding that mutant Pma1 can move from the endosomal system to the plasma membrane represents a
first step toward characterizing an endosome-to-surface trafficking pathway in yeast. Future work should focus on elucidating the physiological significance of this pathway.
| |
ACKNOWLEDGMENTS |
|---|
We thank Jim Haber, Nick Davis, George Sprague, Hugh Pelham, Steve Nothwehr, Tamara Doering, Birgit Singer-Kruger, Carolyn Slayman, and Scott Emr for strains, plasmids, antibodies, and advice. Thanks to Peter Arvan for reading the manuscript. This work was supported by grant GM58212 from the National Institutes of Health.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: achang{at}aecom.yu.edu.
| |
REFERENCES |
|---|
|
|
|---|
-factor pheromone receptors.
Mol. Cell. Biol.
17, 6236-6245
-factor pheromone receptor.
Mol. Cell. Biol.
14, 7245-7255This article has been cited by other articles:
![]() |
A. M. Motley, G. P. Ward, and E. H. Hettema Dnm1p-dependent peroxisome fission requires Caf4p, Mdv1p and Fis1p J. Cell Sci., May 15, 2008; 121(10): 1633 - 1640. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rubio-Texeira and C. A. Kaiser Amino Acids Regulate Retrieval of the Yeast General Amino Acid Permease from the Vacuolar Targeting Pathway Mol. Biol. Cell, July 1, 2006; 17(7): 3031 - 3050. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Foote and S. F. Nothwehr The clathrin adaptor complex 1 directly binds to a sorting signal in Ste13p to reduce the rate of its trafficking to the late endosome of yeast J. Cell Biol., May 22, 2006; 173(4): 615 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wang and R. J. Deschenes Plasma Membrane Localization of Ras Requires Class C Vps Proteins and Functional Mitochondria in Saccharomyces cerevisiae Mol. Cell. Biol., April 15, 2006; 26(8): 3243 - 3255. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Paladino, T. Pocard, M. A. Catino, and C. Zurzolo GPI-anchored proteins are directly targeted to the apical surface in fully polarized MDCK cells J. Cell Biol., March 27, 2006; 172(7): 1023 - 1034. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu and A. Chang Quality control of a mutant plasma membrane ATPase: ubiquitylation prevents cell-surface stability J. Cell Sci., January 15, 2006; 119(2): 360 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hayashi, T. Fukuzawa, H. Sorimachi, and T. Maeda Constitutive Activation of the pH-Responsive Rim101 Pathway in Yeast Mutants Defective in Late Steps of the MVB/ESCRT Pathway Mol. Cell. Biol., November 1, 2005; 25(21): 9478 - 9490. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. S. Chang, G.-S. Han, G. M. Carman, and K. J. Blumer A WASp-binding type II phosphatidylinositol 4-kinase required for actin polymerization-driven endosome motility J. Cell Biol., October 10, 2005; 171(1): 133 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Gaigg, B. Timischl, L. Corbino, and R. Schneiter Synthesis of Sphingolipids with Very Long Chain Fatty Acids but Not Ergosterol Is Required for Routing of Newly Synthesized Plasma Membrane ATPase to the Cell Surface of Yeast J. Biol. Chem., June 10, 2005; 280(23): 22515 - 22522. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Krsmanovic, A. Pawelec, T. Sydor, and R. Kolling Control of Ste6 Recycling by Ubiquitination in the Early Endocytic Pathway in Yeast Mol. Biol. Cell, June 1, 2005; 16(6): 2809 - 2821. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. G. Perrone, C. M. Grant, and I. W. Dawes Genetic and Environmental Factors Influencing Glutathione Homeostasis in Saccharomyces cerevisiae Mol. Biol. Cell, January 1, 2005; 16(1): 218 - 230. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bugnicourt, M. Froissard, K. Sereti, H. D. Ulrich, R. Haguenauer-Tsapis, and J.-M. Galan Antagonistic Roles of ESCRT and Vps Class C/HOPS Complexes in the Recycling of Yeast Membrane Proteins Mol. Biol. Cell, September 1, 2004; 15(9): 4203 - 4214. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pizzirusso and A. Chang Ubiquitin-mediated Targeting of a Mutant Plasma Membrane ATPase, Pma1-7, to the Endosomal/Vacuolar System in Yeast Mol. Biol. Cell, May 1, 2004; 15(5): 2401 - 2409. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Wang and A. Chang Sphingoid base synthesis is required for oligomerization and cell surface stability of the yeast plasma membrane ATPase, Pma1 PNAS, October 1, 2002; 99(20): 12853 - 12858. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Burchett, P. Flanary, C. Aston, L. Jiang, K. H. Young, P. Uetz, S. Fields, and H. G. Dohlman Regulation of Stress Response Signaling by the N-terminal Dishevelled/EGL-10/Pleckstrin Domain of Sst2, a Regulator of G Protein Signaling in Saccharomyces cerevisiae J. Biol. Chem., June 14, 2002; 277(25): 22156 - 22167. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ferreira, A. B. Mason, M. Pypaert, K. E. Allen, and C. W. Slayman Quality Control in the Yeast Secretory Pathway. A MISFOLDED PMA1 H+-ATPase REVEALS TWO CHECKPOINTS J. Biol. Chem., May 31, 2002; 277(23): 21027 - 21040. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bagnat, A. Chang, and K. Simons Plasma Membrane Proton ATPase Pma1p Requires Raft Association for Surface Delivery in Yeast Mol. Biol. Cell, December 1, 2001; 12(12): 4129 - 4138. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Gong and A. Chang A mutant plasma membrane ATPase, Pma1-10, is defective in stability at the yeast cell surface PNAS, July 31, 2001; 98(16): 9104 - 9109. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Forsberg, M. Hammar, C. Andreasson, A. Moliner, and P. O. Ljungdahl Suppressors of ssy1 and ptr3 Null Mutations Define Novel Amino Acid Sensor-Independent Genes in Saccharomyces cerevisiae Genetics, July 1, 2001; 158(3): 973 - 988. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gurunathan, D. Chapman-Shimshoni, S. Trajkovic, and J. E. Gerst Yeast Exocytic v-SNAREs Confer Endocytosis Mol. Biol. Cell, October 1, 2000; 11(10): 3629 - 3643. [Abstract] [Full Text] |
||||
![]() |
H. Panek, E Conibear, J. Bryan, R. Colvin, C. Goshorn, and L. Robinson Identification of Rgp1p, a novel Golgi recycling factor, as a protein required for efficient localization of yeast casein kinase 1 to the plasma membrane J. Cell Sci., January 12, 2000; 113(24): 4545 - 4555. [Abstract] [PDF] |
||||
![]() |
N. Perzov, H. Nelson, and N. Nelson Altered Distribution of the Yeast Plasma Membrane H+-ATPase as a Feature of Vacuolar H+-ATPase Null Mutants J. Biol. Chem., December 15, 2000; 275(51): 40088 - 40095. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ferreira, A. B. Mason, and C. W. Slayman The Yeast Pma1 Proton Pump: a Model for Understanding the Biogenesis of Plasma Membrane Proteins J. Biol. Chem., August 3, 2001; 276(32): 29613 - 29616. [Full Text] [PDF] |
||||
![]() |
E. Harsay and R. Schekman A subset of yeast vacuolar protein sorting mutants is blocked in one branch of the exocytic pathway J. Cell Biol., January 21, 2002; 156(2): 271 - 286. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, X. Tang, J. Liu, S. Trautmann, D. Balasundaram, D. McCollum, and M. K. Balasubramanian The Multiprotein Exocyst Complex Is Essential for Cell Separation in Schizosaccharomyces pombe Mol. Biol. Cell, February 1, 2002; 13(2): 515 - 529. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||