![]() |
|
|
Vol. 11, Issue 3, 873-886, March 2000
Department of Molecular Biology, Lerner Research Institute, The Cleveland Clinic Foundation, Cleveland, Ohio 44195
Submitted August 18, 1999; Revised December 8, 1999; Accepted December 17, 1999| |
ABSTRACT |
|---|
|
|
|---|
Gene amplification in eukaryotes plays an important role in drug resistance, tumorigenesis, and evolution. The Schizosaccharomyces pombe sod2 gene provides a useful model system to analyze this process. sod2 is near the telomere of chromosome I and encodes a plasma membrane Na+(Li+)/H+ antiporter. When sod2 is amplified, S. pombe survives otherwise lethal concentrations of LiCl, and >90% of the amplified sod2 genes are found in 180- and 225-kilobase (kb) linear amplicons. The sequence of the novel joint of the 180-kb amplicon indicates that it is formed by recombination between homologous regions near the telomeres of the long arm of chromosome I and the short arm of chromosome II. The 225-kb amplicon, isolated three times more frequently than the 180-kb amplicon, is a palindrome derived from a region near the telomere of chromosome I. The center of symmetry of this palindrome contains an inverted repeat consisting of two identical 134-base pair sequences separated by a 290-base pair spacer. LiCl-resistant mutants arise 200-600 times more frequently in strains deficient for topoisomerases or DNA ligase activity than in wild-type strains, but the mutant cells contain the same amplicons. These data suggest that amplicon formation may begin with DNA lesions such as breaks. In the case of the 225-kb amplicon, the breaks may lead to a hairpin structure, which is then replicated to form a double-stranded linear amplicon, or to a cruciform structure, which is then resolved to yield the same amplicon.
| |
INTRODUCTION |
|---|
|
|
|---|
Genomic alterations, often deleterious, can also confer unique
advantages to a cell. Gene amplification, defined as a relative increase in copy number of a part of the genome smaller than a chromosome, provides a means to increase the amounts of certain proteins without changing the DNA sequence near the relevant genes (Wu
and Black, 1987
). Amplification plays important roles in drug resistance (Stark et al., 1989
), adaptive mutability
(alterations in the specificity or rate of mutation during stress), and
divergent evolution. Amplification also provides a selective advantage
to many tumors, which often contain amplified oncogenes (Bishop, 1987
).
Amplification of a gene provides additional targets for mutation
(Andersson et al., 1998
) and thus can be the first step in
the evolution of a new gene, because the extra copies are free to
provide new functions (Kimura and Ota, 1974
).
Two main classes of amplified structures (amplicons) have been
characterized. Tandem head-to-tail arrays predominate in prokaryotes. In examples from both Escherichia coli (Whoriskey
et al., 1987
) and phage T4 (Wu et al., 1991
),
short (<20 base pairs [bp]), imperfect, direct repeats flank the
duplicated region, suggesting that homologous recombination is a major
mechanism. In the eukaryote Leishmania, homologous
recombination between longer (541 bp) direct repeats flanking the
P-glycoprotein gene produces amplicons harboring tandem duplications.
Palindromic head-to-head amplification, which is widespread in many
eukaryotes, including Leishmania, Tetrahymena, yeast, and mammals, has been observed as both intrachromosomal and
extrachromosomal (linear and circular) amplified structures (Ford
et al., 1985
; Yao et al., 1985
; Walton et
al., 1986
; Hightower et al., 1988
; Ouellette et
al., 1991
).
Determining amplification mechanisms has been difficult in mammalian
cells, in large part because of limitations in analyzing the novel
joints formed. Novel joints are created when genomic sequences from
distinct locations in the wild-type genome become juxtaposed. The work
of several laboratories has made it clear that dicentric chromosomes
are often present early in amplification events in mammalian cells and
that they can be generated by either telomere-telomere fusions (Smith
et al., 1992
) or double-strand breaks, perhaps at fragile
sites (Windle et al., 1991
; Coquelle et al.,
1997
). The precise location of these breakage events is required to
determine the mechanism responsible for forming the amplification structures.
The fission yeast Schizosaccharomyces pombe provides an
excellent model system for studying gene amplification. Its simple genome comprises three chromosomes, ranging in size from 3.5 to 5.7 megabases. Fission yeast is permissive for gene amplification, and
spontaneous amplification has been observed at a frequency of
~10
6 per cell per generation
(Patterson et al., 1999
). The sod2 gene of
S. pombe encodes a
Na+/H+ antiporter that is
essential for Na+ export (Jia et al.,
1992
). Amplification of sod2 is the major mechanism by which
cells become resistant to high concentrations of LiCl. Preliminary
characterization of the predominant amplicons in LiCl-resistant cells
revealed that they are extrachromosomal and, strikingly, of only two
sizes, 225 or 180 kilobases (kb). The amplicons are linear, contain
telomeric sequences, and are stable only if LiCl selection is
maintained (Jia et al., 1992
; Patterson et al.,
1999
). Genetic studies have indicated that mutant strains defective in
the DNA-damage checkpoint, but not in the S-phase-completion
checkpoint, have an increased frequency of sod2
amplification (Patterson et al., 1999
). We now present a detailed structural characterization of the two predominant
sod2 amplicons and show that mutations likely to produce DNA
lesions also enhance amplicon formation. The new data suggest specific models for amplicon formation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Selection of Strains Resistant to LiCl
The three temperature-sensitive mutant strains were
h
, top2-191,
leu1-32; h
,
top1::swi3, top2-110,
leu1-32; the strain defective in ligase function was
h+, cdc17-K42. All were
obtained from the laboratory of Paul Nurse. Supplemented yeast
extract medium and Edinburgh minimal medium were described previously
(Moreno et al., 1991
; Jia et al., 1992
). Selections were performed as described previously (Patterson et al., 1999
). All the mutant strains but one had the same
sensitivity to LiCl as the wild-type strain, but the ligase-deficient
strain, cdc17, was more sensitive. Cells were grown in
liquid minimal medium prewarmed to a semirestrictive temperature (32 or
34°C) overnight and plated in 40 mM LiCl (16 mM for cdc17)
in minimal medium agar, pH 5. Plates were incubated at the permissive
temperature of 25°C for 5-7 d.
Isolation of Chromosomal DNA and Pulsed-Field Gel Electrophoresis
Agarose-embedded chromosomal DNA was isolated essentially as
described by Alfa et al. (1993)
. Cells from a 20-ml portion
of a dense culture (A595 ~ 4) were pelleted,
washed in H2O, and resuspended in ~0.3 ml of
buffer with lysing enzymes plus 0.4 ml of 1% agarose (Nusieve GTG
agarose, FMC Bioproducts, Rockland, ME). The mixture was placed into
plug molds (CHEF disposable plug molds, Bio-Rad, Richmond, CA). Before
restriction enzyme digestion, the agarose plugs were rinsed twice in TE
(10 mM Tris-HCl, pH 7.5, 1 mM EDTA) and equilibrated with restriction
enzyme digestion buffer (20-50 ml in 50-ml conical tubes). The plugs
were loaded onto an agarose gel (ultrapure DNA-grade agarose, Bio-Rad),
and electrophoresis was performed with a CHEF Mapper XA system
(Bio-Rad). The electrophoresis conditions used in Figure
1 were 1% agarose, 0.5× standard
Tris-borate electrophoresis buffer, 120° included angle, 6 V/cm,
14°C. The switch time was 60 s for the first 15 h and
90 s for the next 9 h.
|
Southern Hybridization
Probes were prepared with a random-primer-labeling kit
(Megaprime DNA-labeling system, Amersham, Arlington Heights, IL). To obtain amplicon DNAs, appropriate bands were cut from a pulsed-field gel, run as described above. The agarose was melted and diluted with
sterile water to ~1 ng/l, based on the amount of DNA (10-25 ng)
estimated with ethidium bromide. Hybridizations were carried out in
Church buffer (Church and Gilbert, 1984
) at 65°C and washed with
Church wash No. 2. Plasmids obtained from Neal Sugawara (laboratory of
J. Szostak, Department of Molecular Biology, Massachusetts General
Hospital, Boston, MA) contained S. pombe telomeres or telomere-adjacent regions (Sugawara, 1988
). The 800-bp TaqI
fragment of plasmid pSPT16 was used as a probe to determine whether
telomeric sequences were present in cosmids 566 and 977 (Mizukami
et al., 1993
). A probe for the telomere-adjacent region was
made from the entire plasmid pNSU64.
Cloning and Sequencing
Transformations of competent E. coli (DH5) were
performed with CaCl2. The 1.7- and 3.2-kb
EcoRI-BamHI restriction fragments from cosmid
1898 were ligated into pBluescript II KS (+/
) and transformed by
electroporation into Sure supercompetent E. coli (Stratagene, La Jolla, CA). Transformation of these plasmids, especially the 3.2-kb fragment, into DH5 cells produced no viable plasmid-containing clones. These regions were difficult to clone, possibly because of the presence of repeat sequences and secondary structures. However, we were able to recover clones of the 3.2-kb fragment when the plasmid was transformed into Sure cells. The sequence
of the 1.7-kb fragment was obtained by cutting it into the following
nonoverlapping fragments, which were subcloned into pBluescript and
sequenced: BamHI-XbaI,
XbaI-KpnI, KpnI-EcoRV, EcoRV-HindIII (pBluescript was cut with
HindIII-HincII), and
HindIII-EcoRI. These plasmids were transformed
into DH5 and sequenced from both ends with T7 and M13 reverse primers
with the use of an ABI model 377 version 3.0 sequencer.
Cloning of Amplicon Novel Joints
PCR was performed on DNA extracted from strains containing the
225-kb amplicon. The primers (5' to 3') were For 5 (GCTTTGCTATCATCGCCTAGC) and For 13 (ATACCTATACTTAGTTGCTAC), and the
conditions were 59°C (or 63°C) annealing, 45-s extension,
Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN).
The PCR products were cloned into pCR2.1 (Invitrogen, Carlsbad, CA).
The first 180-kb amplicon novel joint was cloned with the use of a
PCR-linker method. DNA from a strain carrying the 180-kb amplicon was
digested with EcoRI, and the enzyme was inactivated by
heating to 65°C for 15 min. The ~270-bp
PvuII-EcoRI fragment from Bluescript II KS
(+/
), purified from agarose with Qiaex II (Qiagen, Chatsworth, CA), was used as the linker. The ligation reaction included the following: 0.25 ng/l linker, 5 ng/l digested genomic DNA, and ~1 Weiss unit of
T4 DNA ligase (Boehringer Mannheim). Properly ligated novel joints were
recovered by PCR with the use of the pBluescript KS primer
(CGAGGTCGACGGTATCG), located within the linker and oriented toward the
EcoRI site, and with For 3.2A (AGTTCCGTTTCCTATCTGCG), present in the 6.5-kb novel EcoRI fragment, also oriented
toward the EcoRI site. After transformation into E. coli, two plasmids were isolated and sequenced. To obtain the two
additional 180-kb amplicon novel joints, the primer R-180
(TTATTTAATGCTGAATAAACCTTCT), specific for DNA on the
centromere-proximal side of the novel joint, was used with the primer
For 3.2A in a standard PCR reaction (63°C annealing temperature) with
the use of genomic DNA from two additional independent strains carrying
the 180-kb amplicon. (The products of the PCR reaction with primers
R-180 and For 3.2A were sequenced.) R-180 has only four mismatches
compared with the genomic sequence of the 3.2-kb region. To confirm the
specificity of this primer pair for the novel joint, rather than for
the unrearranged genomic sequence, the primer R-Gen
(TTATTTAATGCTGAACAGATCTTCA) was designed from the homologous sequence
within the 3.2-kb EcoRI-BamHI fragment of the
sod2 locus. When used with primer For 3.2A, primer R-180
amplified a 1.1-kb fragment from plasmids containing the novel joint,
and primer R-Gen amplified a 1.1-kb fragment from plasmids containing
the 3.2-kb fragment. No PCR product was obtained when the templates
were placed in the opposite primer mix.
Sequences have been submitted to GenBank. The 180-kb amplicon-break-region genomic sequence has the accession number AF192974. The 180-kb amplicon novel joints (see Figure 6) have accession numbers AF207957, AF207958, and AF207959 for A, B, and C, respectively. The 225-kb amplicon novel joint (see Figure 4) has the accession number AF207956.
| |
RESULTS |
|---|
|
|
|---|
Linear Extrachromosomal Amplicons Are the Predominant sod2 Amplification Product
Selection with LiCl of wild-type S. pombe cells yielded
20 independent resistant strains. Three different amplification
structures were observed by pulsed-field gel electrophoresis. As found
previously (Patterson et al., 1999
), the frequency of
resistance was ~10
6 per cell per
generation. Extrachromosomal amplicons were predominant, but an
intrachromosomal amplicon was observed in one case. Linear extrachromosomal amplicons of 225 or 180 kb have been reported (Patterson et al., 1999
). All 20 strains contained either
the 225-kb amplicon (15 of 20) or the 180-kb amplicon (5 of 20). No strain contained both the 225- and 180-kb amplicons. Three strains contained megabase-long extrachromosomal amplicons in addition to a
225- or 180-kb linear extrachromosomal amplicon. One of these amplicons
migrated differently relative to size markers depending on the switch
time during pulsed-field gel electrophoresis (our unpublished results),
suggesting a circular structure. One strain appeared to have
sod2 amplified intrachromosomally as well as extrachromosomally. In this strain, NotI fragment L (380 kb), which contains the endogenous sod2 gene, was absent and
was replaced by a new band of 610 kb (our unpublished results). We have
studied in detail the two most frequently observed extrachromosomal
linear amplicons.
The 225- and 180-kb Amplicons Both Contain Genomic DNA from the Telomere-proximal Third of NotI Fragment L
Figure 1A shows an overview of the region of chromosome I
contained in the linear amplicons and of cosmids covering the region. To determine the origin of the amplified DNA, a Southern blot of
NotI-digested wild-type genomic DNA was hybridized with
gel-purified, radiolabeled amplicon DNA. Probes from both amplicons
hybridized with the highest intensity to fragment L, but they also
hybridized to the other telomeric fragments (A, C, I, and M) (data for
the 225-kb amplicon are shown in Figure 1B; data for the 180-kb
amplicon are not shown). NotI fragment L (380 kb) represents
the end of the long arm of chromosome I and contains both the telomere
and sod2 (Fan et al., 1989
; Patterson et
al., 1999
). The amplicons contain telomeric DNA (Patterson
et al., 1999
), and both of the amplicon probes hybridized
with the five telomeric NotI fragments (chromosome III is
not cut by NotI) and the telomeric SfiI
fragments. We noted that both the amplicons were smaller than
NotI fragment L.
Cosmids from the Hoheisel library (Hoheisel et al., 1993
)
representing NotI fragment L plus cosmids from the Mizukami
library (Mizukami et al., 1993
) near the telomere were used.
The Mizukami library represents more of the telomeric end of
NotI fragment L. Cosmids from the latter library are shown
in Figure 1C. Southern hybridization of cosmids covering
NotI fragment L indicated that the 225-kb amplicon
hybridizes with the region covered by cosmids 566 (the cosmid closest
to the telomere), 977, 275, 1898, and 79, altogether ~120 kb of
fragment L. The 180-kb amplicon hybridized to cosmids 566, 977, 275, and 1898, a region of ~80 kb. These estimations are based on cosmid
insert sizes plus ~10 kb of telomere-adjacent sequences. Cosmid 566 does hybridize with telomere-adjacent sequences but does not hybridize
with true telomeric sequences (our unpublished results). Thus, the
insert of cosmid 566 extends into the telomere-adjacent region, but the
distance between the end of the insert and the end of the chromosome is
not known. The telomere-adjacent DNA has been estimated to be >19 kb
long (Sugawara, 1988
). We estimate that 100-130 kb of chromosome I DNA
is represented in the 225-kb amplicon and that 70-90 kb of chromosome
I DNA is represented in the 180-kb amplicon. These sizes are consistent
with amplicons that each contain two copies of the region.
To locate the end point of the genomic region contained in the 225-kb
amplicon, we performed Southern hybridization experiments with
restriction digests of cosmid 79 (Mizukami et al., 1993
). Only the telomere-proximal 8.4 kb (the 1.1-, 4.7-, and 2.6-kb EcoRI fragments) of the cosmid was present (Figure
2). Two fragments comigrated at 2.6 kb,
designated 2.5 and 2.6 in Figure 2A. The sequence of cosmid 1F8
(Hoheisel et al., 1993
; GenBank No. Z81312) (Figure 1A)
predicts a 3.0-kb EcoRI fragment. Inspection of the sequence
reveals a 500-bp direct repeat within this 3.0-kb fragment. We believe
that this duplication is an artifact of sequencing and is not present
in either the cosmid or the genomic sequence. A restriction map based
on our data is shown in Figure 2B, with a 2.6-kb fragment in place of
the 3.0-kb fragment. Use of PCR probes from each of the
EcoRI fragments in the area (Figure 2B, W, X, and Y) showed
that, as expected, sequences in the 2.5- and 2.4-kb fragments were not
in the 225-kb amplicon (our unpublished results) and that sequences
from the 2.6-kb fragment were present in the amplicon. Therefore, the
2.6-kb EcoRI fragment contains the boundary of the genomic
DNA duplicated in the 225-kb amplicon.
|
The Novel Joint of the 225-kb Amplicon Contains an Inverted Repeat
The 2.6-kb EcoRI fragment of cosmid 1F8 hybridizes with
novel restriction fragments of the 225-kb amplicon (Figure
3). We conclude that the 225-kb amplicon
extends into and stops within the sequence of this 2.6-kb
EcoRI fragment at a novel joint where DNA from one region of
the genome joins DNA from another region. The 2.6-kb fragment includes
two exact copies of a 134-bp sequence in an inverted orientation,
separated by a 290-bp spacer. Beyond the ends of the 134-bp elements,
their similarity declines rapidly. The inverted repeat is homologous to
the long terminal repeat (LTR) of Tf2 and Tf1-107
retrotransposons (GenBank Nos. L10324 and M38526) but contains only a
portion of the LTR sequence and is not an intact retrotransposon. We
used the genomic 2.6-kb EcoRI fragment to identify novel
fragments from the 225-kb amplicon. The sizes of these novel fragments
(Figure 3A) support the interpretation that the palindrome extends for
at least 4 kb on either side of the original inverted repeat. The
presence of two amplified SnaBI fragments (3.9 and 4.0 kb)
of approximately equal intensity indicates that the 290-bp spacer,
which contains a SnaBI site, has been conserved in the
amplicon. The wild-type restriction fragments appear to be conserved.
|
Sequence of the Novel Joint of the 225-kb Amplicon
PCR was used to clone the novel joint (Figure
4A). Primer For 5 binds on the telomeric
side of the inverted repeats and is oriented to prime DNA synthesis
toward them. Primer For 13 lies within the 290-bp spacer, which is
oriented in the same direction as primer For 5. These primers cannot
amplify a fragment from wild-type DNA, but they can amplify a fragment
from a sequence that is palindromic around the inverted repeats. As
expected, no PCR product was obtained when these two primers were used
with wild-type DNA, but a fragment of ~650 bp was produced when the DNA from a strain containing a 225-kb amplicon was used as a template (Figure 4B). The 650-bp For 5/For 13 PCR products from four independent amplicons were identical and contained the spacer, one repeat element,
and DNA upstream of the inverted repeat in an inverted orientation, as
expected for a palindromic novel sequence (Figure 4C; GenBank No.
AF207956).
|
The Novel Joint of the 180-kb Amplicon Is Not Formed at an Inverted Repeat
To locate the end of the genomic region in the 180-kb amplicon, we
performed Southern hybridization experiments with restriction digests of cosmid 1898 (Mizukami et al., 1993
). Only the
telomere-proximal 4.9 kb of this cosmid is present in the 180-kb
amplicon (Figure 5). The 4.9-kb genomic
sequence was submitted to GenBank (No. AF192974). Note that the 4.9- and 4.7-kb fragments are not resolved in this figure, but the 4.7-kb
fragment is a part of cosmid 79, which does not hybridize to the 180-kb
amplicon (Figure 1C). Additional experiments (our unpublished results)
narrow the end point region to within the 3.2-kb
BamHI-EcoRI fragment, which was therefore used
to probe a Southern transfer of genomic DNA from amplicon-containing
strains. One amplified novel fragment and two wild-type fragments were
observed per digest (Figure 6A). Notably,
the size of the EcoRI novel fragment is ~6.5 kb, whereas the wild-type fragments are 8 and 12-15 kb long. The native 8-kb fragment is from chromosome I, whereas the 12- to 15-kb fragment appears to be from chromosome II (our unpublished results). The restriction map of the amplicon is derived from the sizes of novel fragments compared with those of the chromosomal fragments (Figure 6B).
We conclude that the 180-kb amplicon is not a palindrome.
|
|
The 1.7- and 3.2-kb EcoRI-BamHI fragments in the region of the novel joint were subcloned from cosmid 1898 into pBluescript II KS and sequenced. The first 375 bp of cosmid 1898 are identical to the 3'-untranslated region of a cDNA plasmid containing the sod2 gene, the precise genome location of which was previously unknown. The sequence of cosmid 1898 begins ~284 bp downstream of the stop codon of sod2. A run of 30 contiguous adenosine residues, an unusual sequence in S. pombe DNA, begins at position 1361 of cosmid 1898. Retrotransposon sequences were found within this region of the 1.7-kb fragment; interestingly, this is the same portion of the LTR sequence that constituted the inverted repeat associated with the novel joint of the 225-kb amplicon. There are several large ORFs within the 4.9-kb sequence represented in Figure 1A. The first has high similarity to L-asparaginase (L-asp) (GenBank No. Y11944), which is near the telomere of the short arm of chromosome I (Bonthron, personal communication). Both ORFs are present in the expressed sequence tag database, indicating that they are expressed genes (GenBank Nos. AU013226 and AU009847).
The 180-kb Amplicon Is Formed as a Result of an Interchromosomal Event
The sequences of novel joints from three independent 180-kb amplicons were very similar. They have been submitted to GenBank (Nos. AF207957, AF207958, and AF207959). The sequence centromere-proximal to the novel joint shares approximately the same degree of similarity with the L-asp sequence as does the 4.9-kb EcoRI sequence from cosmid 1898. The sequence centromere-proximal to the novel joint is not present in the expressed sequence tag database. Alignment of the novel joints with the 4.9-kb EcoRI fragment of cosmid 1898 (Figure 6C) reveals a pattern of nucleotide changes consistent with a mechanism involving homologous recombination between the two sequences homologous to L-asp. Examination of these sequences reveals that the novel joints have occurred by bp 3534. The sequence of C between the stars (Figure 6C) was not obtained, but the lack of this sequence does not detract from the above conclusions. The observations are consistent with recombination occurring at one site within this region of cosmid 1898.
To determine the chromosomal origin of the sequence on the centromeric
side of the novel joint, the 320-bp EcoRV fragment from
plasmid 1.1D (corresponding to the terminal 320 bp of the 1.1-kb novel
joint sequence) was used to probe a pulsed-field gel electrophoresis
transfer containing NotI restriction fragments from
wild-type S. pombe DNA (Figure
7A). Fragments L (the
sod2-containing telomeric fragment from chromosome I) and M
(the telomeric fragment from the short arm of chromosome II) hybridized
with the probe. The result was confirmed with a smaller probe from the
centromere-proximal sequence of the novel joint, which hybridized only
to NotI fragment M (our unpublished results). We conclude
that the 180-kb amplicon is formed by homologous mitotic recombination
between the transcribed L-asp homologue
located ~5 kb away from the sod2 gene on the centromeric side (and ~70 kb from the telomere) and another
L-asp homologue located on the short arm of
chromosome II, ~110 kb from the telomere. The
L-asp homologue on chromosome II apparently
is oriented with the direction of transcription toward the telomere.
|
Topoisomerase and Ligase Mutations Increase the Frequency of sod2 Amplification
Mutations increasing the probability of DNA breakage in a cell may
affect the frequency of DNA amplification. Taking mutations in DNA
ligase and topoisomerase as examples, we determined sod2 amplification frequencies in haploid strains bearing
temperature-sensitive alleles of these genes at a semirestrictive
temperature (Nasmyth, 1979
) (Table 1). In
S. pombe, both top1 and top2 have type
I topoisomerase activity (Uemura and Yanagida, 1984
). Consequently, a
substantial decrease in topoisomerase I activity is observed only in
the top1 top2 double mutant. A top1 top2 strain
had a 200-fold increase in amplification frequency, and a
top2(mut) strain with a normal top1 gene had only
a 3-fold increase. A strain with a temperature-sensitive mutation in
DNA ligase (cdc17) exhibited a 600-fold increase in
amplification frequency at the semirestrictive temperature compared
with the wild-type strain. Both size classes of amplicon were observed
in the mutant strains at about the same ratio as in wild-type cells
(our unpublished results). In 10 ligase-deficient sod2-amplified strains, nine 225-kb amplicons and one 180-kb
amplicon were observed. In 12 top1 top2-deficient strains
amplified for sod2, nine 225-kb amplicons and three 180-kb
amplicons were observed.
|
| |
DISCUSSION |
|---|
|
|
|---|
Identification of the novel joint sequences for each class of amplicon characterized was essential for a molecular characterization of the amplicons. The novel joints and structure were different between the two amplicon classes. Each LiCl-resistant strain studied contained a sod2 linear extrachromosomal amplicon of 180 kb (25%) or 225 kb (75%). The 225-kb amplicon is a palindrome of a region bounded by an inverted repeat and a telomere. The 180-kb linear amplicon results from the fusion of two chromosome ends through a region of homology.
The novel joint of the 180-kb amplicon occurs within homologues of
L-asp located near the telomeres of the long arm of
chromosome I and the short arm of chromosome II, indicating
recombination between these two homologous regions (Figure 7B). Because
the amplified strains studied have intact chromosomes I and II and are
haploid, we conclude that this recombination event must occur after DNA
replication. The event must be mitotic because the cells do not enter
meiosis during selection. Additional cell cycles can generate multiple
copies of the amplicon. Similar recombination-based mechanisms of gene
amplification that use repeats of homologous regions have been proposed
(Edlund and Normark, 1981
; Whoriskey et al., 1987
; Wu
et al., 1991
; Grondin et al., 1993
). In E. coli and phage T4, head-to-tail arrays of 50-100 copies are
generated when the amplified DNA is flanked by short (<20 bp) direct
repeats (Whoriskey et al., 1987
; Wu and Black, 1987
). In
Leishmania, amplicons of the P-glycoprotein gene are
extrachromosomal circles containing two head-to-tail copies of the
region and are formed with the participation of 541-bp direct repeats
(Grondin et al., 1993
, 1996
). In the amplification of
sod2 in S. pombe, a long run of homology is
involved, similar to the situation in Leishmania. When the
full genomic sequence for this region of S. pombe becomes available, the length of the homologous region will be revealed.
The novel joint of the 225-kb amplicon occurs precisely at the end of
an exact inverted repeat, arguing for an essential role of the repeat
in amplicon formation. An aberrant replication model (Figure
8A) invokes a single-strand break in the
DNA downstream of both the inverted repeat and the replication fork,
allowing the inverted repeat to form a hairpin. After the unpaired
nucleotides are removed, the inverted repeat primes replication of an
additional DNA synthesis fragment, and DNA ligase seals the nick. A
large hairpin duplication of the left end of the chromosome results, and a telomere-deleted chromosome is a by-product. The hairpin segregates together with an intact chromosome I to generate a viable
cell with a small selective advantage. An additional cell cycle is
required to form the mature double-stranded amplicon. Additional cycles
yield cells with multiple copies of the amplicon and a correspondingly
increased growth advantage in selective medium.
|
Similar models have been presented for both Tetrahymena and
Leishmania (Ford et al., 1985
; Yasuda and Yao,
1991
; Butler et al., 1996
; Grondin et al., 1996
).
When the Leishmania P-glycoprotein locus is flanked by
inverted repeats, it forms an inverted duplication upon amplification
(Grondin et al., 1996
). White et al. (1988)
suggested that annealing of these repeats during a block in replication could serve as a primer for DNA polymerase. The newly synthesized strand could then serve as a template to generate a large inverted duplication. Others (Ouellette et al., 1991
; Cohen et
al., 1994
) have suggested that stalling of the replication fork
would allow the inverted repeats to anneal, enabling strand switching,
or "U-turn" replication. Our model differs in that formation of the hairpin does not require a single strand to invade duplex DNA. For our
model to produce both a palindromic amplicon and an intact chromosome,
a single-strand DNA break is required between the inverted repeat and
the centromere. A double-strand break, causing stalling of replication
and switching of both strands, is incompatible with maintaining an
intact chromosome.
An alternative recombination-resolvase model (Figure 8B) uses a
recombination event that leads to a large hairpin precursor of the
amplicon. This model, which is very similar to those proposed previously for Tetrahymena thermophila (Yasuda and Yao,
1991
; Butler et al., 1996
) and S. pombe
(Patterson et al., 1999
), invokes the formation of a
cruciform structure analogous to a Holliday structure (Holliday, 1964
;
Leach, 1994
). After resolvase cuts across the cruciform in a precise
manner (Figure 9), a hairpin can form
after DNA ligase seals the gap between the 3' and 5' ends of the
different DNA strands. A dicentric chromosome is also formed. If the
large hairpin segregates with an intact chromosome I, a cell resistant
to LiCl results. As in the model shown in Figure 8A, one more round of
replication is required to form the mature double-stranded amplicon and
additional rounds of replication can generate multiple copies of the
amplicon.
|
The sequence of the novel joint reveals that the junction formed
(Figure 9) is consistent with the expected products of S. pombe resolvase, which cuts Holliday junctions across the axis of
symmetry and prefers phosphodiester bonds 3' to thymidine residues, cutting 3' to the cruciform structure (Whitby and Dixon, 1997
; Oram
et al., 1998
). Resolvase cuts within 6 bp of the junction in
most cases. The locations within the cruciform structure at which
subsequent excision is required or not required for our model are
indicated in Figure 9. The areas lacking symmetry are also indicated;
the lack of symmetry prevents this cruciform from being a true Holliday
structure. The sequence of the novel joint of the 225-kb amplicon
suggests that the cut may have occurred either 2 or 4 bp away from the
cruciform if mismatch repair has occurred. Additional experiments to
study the effects of base pair changes in this region should reveal
whether resolvase plays a key role in forming the amplicon. For
example, the removal of thymidine residues from this region should
prevent amplification if resolvase is required.
Previous work has shown that mutations in the DNA-checkpoint pathway
increased the frequency of sod2 amplification (Patterson et al., 1999
). We now find that strains defective for ligase
or for both topoisomerase I and topoisomerase II activity also have greatly increased frequencies of amplification. Both types of mutation
increase the likelihood of DNA breakage. Topoisomerase is necessary to
untangle chromosomes, removing supercoiling and helping to maintain
chromatin organization (Uemura et al., 1987
). DNA ligase is
needed to seal single-strand DNA breaks. Together, these results make
it likely that DNA breaks facilitate gene amplification in S. pombe. DNA breaks are also known to increase the frequency of
mitotic recombination (Sipiczki et al., 1990
), and a
single-strand break has been invoked in our replication model. The
genetic data are consistent with both models for generating the 225-kb
amplicon and the recombination model for the 180-kb amplicon. The
aberrant replication model (Figure 8A) requires a single-strand break, and the recombination-resolvase model (Figure 8B) does not require DNA
breakage at all. However, mitotic recombination is increased by DNA
breakage and also by mutations in DNA ligase (Sipiczki et
al., 1990
). Analysis of amplification frequencies in strains deficient in mitotic recombination may help to rule out this class of
mechanisms for generating the 225-kb amplicon (see Gysler-Junker et al., 1991
).
We have presented the novel joint sequences for two different sod2 amplicon structures. In the first case, the sequence of the novel joint indicates that homologous recombination is responsible for generating the 180-kb amplicon. In the second case, the sequence of the novel joint indicates that inverted repeats play a key role in generating the 225-kb amplicon. Two different mechanisms, one involving aberrant replication and the other involving resolvase action on a cruciform structure, were presented as models of the mechanism of amplification by means of inverted repeats. All three models presented for generating the amplicons are expected to be stimulated by the presence of DNA breaks, as observed in our genetic data. Further studies, both molecular and genetic, should elucidate the mechanistic details of how the 225-kb palindromic sod2 amplicon is formed. We have made observations consistent with circular amplicons being formed in this system. In both wild-type and mutant strains, megabase-size extrachromosomal amplicons have been observed. In one case, the amplicon was observed to migrate differently when different pulse times were used, consistent with it being circular. These observations have not been investigated further. However, they add to the argument that amplification in S. pombe may parallel amplification in higher organisms. The conservation observed between amplification in S. pombe and other organisms suggests that detailed studies in fission yeast will be relevant to the analysis of amplification mechanisms in higher eukaryotes.
| |
ACKNOWLEDGMENTS |
|---|
We thank members of the Stark laboratory for helpful discussions, Kurt Runge, Helen Salz, and David Setzer for critical reading of the manuscript, the S. pombe sequencing center, the Sanger Center, David Botstein, and Tomo Matsumoto for cosmids, Paul Nurse for S. pombe strains, Neal Sugawara for plasmids containing S. pombe telomere and telomere-adjacent sequences, and David Bonthron for sharing unpublished information on the L-asp gene in S. pombe. This work was supported by National Institutes of Health grant GM 49345 to G.R.S.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: starkg{at}ccf.org.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Tanaka, Y. Cao, D. A. Bergstrom, C. Kooperberg, S. J. Tapscott, and M.-C. Yao Intrastrand Annealing Leads to the Formation of a Large DNA Palindrome and Determines the Boundaries of Genomic Amplification in Human Cancer Mol. Cell. Biol., March 15, 2007; 27(6): 1993 - 2002. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Hansen, P. T. Ibarra, and G. Thon Evolutionary-conserved telomere-linked helicase genes of fission yeast are repressed by silencing factors, RNAi components and the telomere-binding protein Taz1 Nucleic Acids Res., January 10, 2006; 34(1): 78 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Rattray, B. K. Shafer, B. Neelam, and J. N. Strathern A mechanism of palindromic gene amplification in Saccharomyces cerevisiae Genes & Dev., June 1, 2005; 19(11): 1390 - 1399. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K. Butler, D. Gillespie, and B. Steele Formation of Large Palindromic DNA by Homologous Recombination of Short Inverted Repeat Sequences in Saccharomyces cerevisiae Genetics, July 1, 2002; 161(3): 1065 - 1075. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tanaka, S. J. Tapscott, B. J. Trask, and M.-C. Yao Short inverted repeats initiate gene amplification through the formation of a large DNA palindrome in mammalian cells PNAS, June 25, 2002; 99(13): 8772 - 8777. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||