![]() |
|
|
Vol. 11, Issue 3, 983-998, March 2000

§
and
*Department of Molecular and Cell Biology, Howard Hughes Medical
Institute, University of California, Berkeley, Berkeley, California
94720; and
Department of Biology, Massachusetts
Institute of Technology, Cambridge, Massachusetts 02139
| |
ABSTRACT |
|---|
|
|
|---|
The Sec23p/Sec24p complex functions as a component of the
COPII coat in vesicle transport from the endoplasmic reticulum. Here we
characterize Saccharomyces cerevisiae
SEC24, which encodes a protein of 926 amino acids (YIL109C),
and a close homologue, ISS1 (YNL049C), which is 55%
identical to SEC24. SEC24 is essential for vesicular transport in vivo because depletion of Sec24p is lethal,
causing exaggeration of the endoplasmic reticulum and a block in the
maturation of carboxypeptidase Y. Overproduction of Sec24p suppressed
the temperature sensitivity of sec23-2, and overproduction of both Sec24p and Sec23p suppressed the temperature sensitivity of sec16-2. SEC24 gene
disruption could be complemented by overexpression of
ISS1, indicating functional redundancy between the two
homologous proteins. Deletion of ISS1 had no significant effect on growth or secretion; however, iss1
mutants
were found to be synthetically lethal with mutations in the v-SNARE
genes SEC22 and BET1. Moreover,
overexpression of ISS1 could suppress mutations in
SEC22. These genetic interactions suggest that Iss1p may
be specialized for the packaging or the function of COPII v-SNAREs.
Iss1p tagged with His6 at its C terminus copurified with
Sec23p. Pure Sec23p/Iss1p could replace Sec23p/Sec24p in the packaging
of a soluble cargo molecule (
-factor) and v-SNAREs (Sec22p and
Bet1p) into COPII vesicles. Abundant proteins in the purified vesicles
produced with Sec23p/Iss1p were indistinguishable from those in the
regular COPII vesicles produced with Sec23p/Sec24p.
| |
INTRODUCTION |
|---|
|
|
|---|
Vesicular transport from the endoplasmic reticulum (ER) to the
Golgi is the first step in the intracellular trafficking of proteins
destined for the Golgi apparatus, lysosomes (vacuoles), plasma
membrane, and extracellular space. Most, if not all, anterograde vesicular transport from the ER to the Golgi complex is carried out by
vesicles coated with a protein complex known as COPII. In vitro assays
have shown that the minimal components needed for formation of the
COPII coat are three cytosolic proteins: Sar1p, the Sec23p/Sec24p
complex, and the Sec13p/Sec31p complex (Barlowe et al.,
1994
). During vesicle formation, coat proteins are sequentially
recruited to the ER: first Sar1p, then Sec23p/Sec24p, and finally
Sec13p/Sec31p (Matsuoka et al., 1998
).
Sar1p is a small GTPase (21 kDa) of the Ras superfamily (Nakano and
Muramatsu, 1989
; Oka et al., 1991
). Sec12p, an integral membrane protein of the ER, facilitates exchange of GTP for GDP on
Sar1p and is thought to recruit Sar1p to the ER (Barlowe and Schekman,
1993
). The GTP-bound form of Sar1p is required for budding, and GTP
must be hydrolyzed to GDP before vesicles can fuse with the Golgi
(Barlowe et al., 1994
). A nonhydrolyzable GTP analogue, 5'-guanylyl imidodiphosphate (GMP-PNP), satisfies the nucleotide requirement for vesicle formation, but the vesicles produced with GMP-PNP cannot fuse with the Golgi membrane. Presumably, GTP hydrolysis by Sar1p is a prerequisite for the dissociation of coat proteins from
the vesicles to produce fusion-competent vesicles. Yoshihisa et
al. (1993)
found that Sec23p (85 kDa) stimulates the hydrolysis of
GTP by Sar1p. Sec24p (105 kDa) was discovered as a subunit of a protein
complex containing Sec23p (Hicke et al., 1992
). Although the
Sec24p subunit of this complex is required for in vitro vesicle formation, it has no significant effect on the GTPase-activation activity of Sec23p (Yoshihisa et al., 1993
). Sec13p is a
33-kDa protein containing six WD repeat motifs that make up most of the protein (Salama et al., 1993
; Saxena et al.,
1996
). Sec31p is a 150-kDa phosphoprotein that contains seven WD
repeats near the N terminus (Salama et al., 1997
).
Phosphorylation of this protein is important for vesicle formation.
Direct interactions among COPII components have been shown by
two-hybrid analysis and in vitro binding assays: the N terminus of
Sec24p binds to Sec23p (Gimeno et al., 1996
); Sec13p and the
N-terminal region of Sec31p interact with each other, possibly through
their WD repeat motifs (Shaywitz et al., 1997
); and Sec23p
and Sec24p interact with a central region of Sec31p (Shaywitz et
al., 1997
). Sec16p, a 240-kDa peripheral ER membrane protein, has
also been implicated in COPII coat assembly, because Sec16p is required
for vesicle formation in vivo and Sec16p binds to Sec23p, Sec24p, and
Sec31p (Espenshade et al., 1995
; Gimeno et al.,
1996
; Shaywitz et al., 1997
).
Cargo molecules are selectively packaged into COPII vesicles. Because
some cargo molecules are known to be concentrated into COPII vesicles
(Balch et al., 1994
), an active uptake mechanism must exist
for at least some proteins. Sar1p and Sec23p/Sec24p probably play a
central role in cargo recruitment. When Sar1p and Sec23p/Sec24p are
incubated with microsomes in the presence of GTP or GMP-PNP and in the
absence of Sec13p/Sec31p, a prebudding complex forms that contains
various cargo molecules, such as glycosylated pro-
-factor (gp
F),
amino acid permeases, Emp24p, and SNARE molecules in yeast (Kuehn
et al., 1998
) and vesicular stomatitis virus glycoprotein in
a mammalian system (Aridor et al., 1998
). Importantly,
resident ER proteins are excluded from these prebudding complexes,
indicating that at this stage at least some cargo sorting has already
taken place. The v-SNARE vesicle proteins Bet1p and Bos1p bind to
Sec23p/Sec24p as well as to Sar1p, indicating that sorting may be
achieved by direct interaction with these coat proteins (Springer and
Schekman, 1998
). Recent work in mammalian cells has identified two
sorting motifs within the cytoplasmic domains of transmembrane cargo
molecules: a di-acidic motif (Asp-X-Glu, where X represents any amino
acid) on the cytoplasmic tail of vesicular stomatitis virus
glycoprotein (Nishimura and Balch, 1997
), and a double phenylalanine
motif (Phe-Phe) on the cytoplasmic tail of p24 proteins (Fiedler
et al., 1996
; Dominguez et al., 1998
) and
ERGIC-53 (Kappeler et al., 1997
). These motifs are important
for the efficient exit of these cargo molecules out of the ER.
Moreover, peptides containing the latter motif were shown to bind to
the mammalian Sec23p/Sec24p complex (Kappeler et al., 1997
;
Dominguez et al., 1998
).
Despite the fact that Sec24p has long been recognized to play an essential role in the budding of COPII-coated vesicles, the structure and function of this protein have not yet been described in detail. Here we report the characterization of Sec24p and a homologue, Iss1p. We demonstrate that Sec24p and Iss1p can function interchangeably in vesicle formation from the ER.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains and Plasmids
Strains and plasmids used in this study are listed in Table
1 and Table
2, respectively, and their construction
is described below
|
|
Media
YPD is a complex medium with 1% Bacto yeast extract (Difco,
Detroit, MI) and 2% Bacto peptone (Difco) supplemented with glucose (2%, unless noted otherwise). YPGal is the same as YPD except that it
contains galactose (2%, unless noted otherwise) instead of glucose.
MVCA medium consists of 0.67% yeast nitrogen base without amino acids
(Difco), 0.5% vitamin assay casamino acid (Difco), and 5% carbon
source. MV-lowS medium contains 0.67% yeast nitrogen base without
amino acids and ammonium sulfate (Difco), 0.1 mM
(NH4)2SO4,
and 5% carbon source. MV-noS medium lacks
(NH4)2SO4 from MV-lowS medium. Nutrients corresponding to auxotrophic markers were supplemented to the MVCA, MV-lowS, and MV-noS media. Synthetic complete (SC) medium contains 0.67% yeast nitrogen base without amino
acids and 2% glucose as a carbon source (unless noted otherwise) as
well as various nutrients (Sherman, 1991
). SC dropout medium lacks one
or two nutrients from SC medium.
Purification and Amino Acid Sequencing of Sec24p
The Sec23p/Sec24p complex was purified as described (Hicke
et al., 1992
), precipitated with 5% trichloroacetate (TCA),
denatured in SDS-PAGE sample buffer, and separated by 7.5% SDS-PAGE.
After transfer to a nitrocellulose membrane, proteins were stained with Ponceau S. The protein band of Sec24p (105 kDa) was excised, destained with Tris-buffered saline, and washed thoroughly with distilled water.
Sec24p bound to nitrocellulose was digested with trypsin, and the
released peptides were purified with C18
reverse-phase HPLC. Several peaks were recovered and sequenced: P1,
IWQIFQ; P2, SVQ(D/F)ILATYK; P3, VGLLATTINTLLQNL; and P4, VTAQLLSCQDSTY.
Cloning of SEC24
Three sets of sense and antisense degenerate oligonucleotides were synthesized based on the amino acid sequences of tryptic peptides P1 (1 and rev-1) and P2 (2A, rev-2A, 2B, and rev-2B): 1, 5'-AT(A/T/C)TGGCA (A/G)AT(A/T/C)TT(T/C)CT-3'; rev-1, 5'-TG(A/G)AA(A/T/G)AT (T/C)TGCCA(A/G/T)AT-3'; 2A, 5'-AT(A/T/C)TT(A/G)GCNACNTA (T/C)AA-3'; rev-2A, 5'-TT(A/G)TANGTNGC(T/C)AA(A/T/G)AT-3'; 2B, 5'-AT(A/T/C)CTNGCNACNTA(T/C)AA-3'; rev-2B, 5'-TT(A/G)TANGTNGCNAG(A/T/G)AT-3'.
PCR was conducted with the primer pairs 1/rev-2A or rev-2B and rev-1/2A
or 2B with the use of genomic DNA from RSY255 as a template. Thirty
reaction cycles (each cycle was 0.5 min at 93°C, 1.5 min at 50°C,
and 3 min at 72°C) were carried out, followed by a 5-min incubation
at 72°C. A PCR product of 0.45 kilobase (kb) was obtained with
primers 1 and rev-2A. This product was also detected in a similar
reaction at a higher annealing temperature (53°C). This fragment was
subcloned into an SmaI site of pBluescript II KS(+)
(Stratagene, La Jolla, CA), giving pTYB121, and sequenced. An ORF was
shown to span the entire 453-base pair (bp) insert. This insert was
isolated, labeled with [
-32P]dCTP by means
of the random primer DNA-labeling system (Amersham, Arlington Heights,
IL), and used as a probe to screen yeast genomic libraries in YEp24 and
YCp50. Screening was carried out according to the protocol provided by
Amersham. We isolated four positive clones from YEp24 libraries
(pTYY111-pTYY114) and three from YCp50 libraries (pTYY211-pTYY213).
All seven clones shared a 0.5-kb EcoRI fragment, a 0.9-kb
PstI fragment, and a 3.0-kb NcoI fragment that
hybridized with the probe DNA. The EcoRI fragments from
pTYY113 (3.3 and 0.5 kb) were subcloned into an EcoRI site
of pBluescript II KS(+), and the NcoI fragment from pTYY212
(3.0 kb), converted to blunt ends by the Klenow enzyme, was introduced
into a SmaI site of pBluescript II KS(+). These plasmids
were used for sequencing.
Construction of Plasmids for Purification of YNL049C-encoded Protein (Iss1p)
A sequence coding for a stretch of six histidine residues was introduced in front of the termination codon of YNL049C (ISS1) as follows. The following four PCR primers were synthesized: TKPr1, 5'-CAGTAACCTCACTTAACCTATG-3'; TKPr2, 5'-TGTTAGTGATGGTGATGGTGATGTCTGTTGATACTAGTCTTCATAC-3'; TKPr3, 5'-ACAGACATCACCATCACCATCACTAACAATCAGTCTTTCTTTAATCTT-3'; and TKPr4, 5'-ATATGGCCATTTATCACGAATAC-3'.
His6 residues are encoded by the underlined sequence of TKPr3 and the sequence complementary to the underlined sequence of TKPr2. TKPr1 anneals to the antisense strand of the ISS1 ORF, ~650 nucleotides upstream from the termination codon. A part of TKPr2, TCTGTTGATACTAGTCTTCATAC, anneals to the sense strand of the 3' end of ISS1 ORF. A part of TKPr3, TAACAATCAGTCTTTCTTTAATCTT, anneals to the 3'-flanking region and termination codon of ISS1. TKPr4 anneals to the 3'-flanking region of ISS1, ~900 nucleotides downstream from the termination codon. TKPr2 and TKPr3 anneal to each other. The plasmid pRH200 carries the ISS1 gene on a ClaI-XbaI genomic DNA fragment. The first-stage PCR was carried out with TKPr1 and TKPr2 and with TKPr3 and TKPr4 with the use of pRH200 as a template. We obtained an ~650-bp fragment with TKPr1 and TKPr2 and an ~900-bp fragment with TKPr3 and TKPr4. We used these two fragments as templates in the second-stage PCR, in which TKPr1 and TKPr4 were used as primers. This second-stage PCR yielded an ~1.6-kb DNA encoding the C terminus of Iss1p that included His6 residues as well as a termination codon and the 3'-flanking region of ISS1.
The ClaI-XbaI fragment of pRH200 containing
ISS1 was ligated with pGEM4Z (Promega, Madison, WI) digested
with AccI and XbaI to generate pTKB1. The 1.4-kb
AccI-SnaI region of pTKB1 corresponding to the
3' end and 3'-flanking region of ISS1 was replaced by the 1.4-kb AccI-SnaI fragment of the above PCR
product encoding the His6-tagged C terminus of
Iss1p. This plasmid was named pTKB2. We sequenced the region of pTKB2
derived from the PCR product to ensure that no mutation had occurred as
a result of PCR. XbaI-HindIII fragments of pTKB1
and pTKB2 were introduced into the XbaI-HindIII site of YEp352 (2µ URA3) to obtain pTKY4 and pTKY6,
respectively. The PstI fragment (3.5 kb) of pTKY6 encoding
His6-tagged Iss1p was introduced into the
PstI site of p425GAL1 (2µ LEU2) to express the
ISS1 coding sequence from the GAL1 promoter
(Mumberg et al., 1994
). This plasmid, pTKY7, was used for
Iss1p purification.
The NcoI (blunted)-HindIII fragment (2.9 kb) of
pTYY121 (YEp351 containing SEC23) was introduced into
p426GAL1 (2µ URA3) digested with SpeI (blunted)
and HindIII so that SEC23 could be expressed under control of the GAL1 promoter (Mumberg et
al., 1994
). This plasmid was named pTKY9.
Purification of His6-tagged Iss1p
RSY620 was transformed with pTKY7 and pTKY9. The cells were
grown in SC-Ura-Leu (2% glucose) to early stationary phase and used to
inoculate 6 l of SC-Ura-Leu (2% raffinose) at an initial OD600 of 0.005. The cells were grown at 30°C
for 1 d until an OD600 of ~1.2 was
reached. At this time, 1/100 volume of 20% galactose was added
(final concentration of 0.2%) and incubation continued for 5 h,
to an OD600 of ~2.7, for overproduction of
Iss1p and Sec23p. The cells were harvested and washed twice with
distilled water. About 25 g of cells (wet weight) were obtained
from a 6-l culture. The cells were stored at
80°C until use.
The frozen cells were suspended with HSLB (0.75 M potassium acetate, 50 mM HEPES, 0.1 mM EGTA, 20% [wt/vol] glycerol; final pH was adjusted
to 7.0 with 5 M KOH) to a final volume of 70 ml. Immediately before
cell disruption, protease inhibitors and reducing agent were added to
the following final concentrations: 1.4 mM 2-mercaptoethanol, 1 µM
leupeptin, 1 µM pepstatin A, 1 mM
-aminocaproic acid, and 0.5 mM
PMSF. Cells were disrupted in a bead-beater chamber filled with a
half-volume of glass beads (0.5 mm diam, Biospec Products,
Bartlesville, OK) by five 1-min periods of agitation with 2-min
intervals for chilling. The lysate was recovered, and the glass beads
were washed once with 20 ml of HSLB supplemented with the protease
inhibitors and 2-mercaptoethanol. The total lysate (80 ml) was
centrifuged at 13,000 × g for 10 min, and the resulting supernatant was centrifuged at 40,000 rpm (~186,000 × g) for 75 min (45Ti rotor, Beckman, Palo Alto, CA) to obtain a high-speed supernatant fraction.
The supernatant (46 ml) was loaded onto a 10-ml nickel-nitriloacetic
acid (Ni-NTA) agarose column (Qiagen, Valencia, CA) equilibrated with
HSLB with the protease inhibitors and 2-mercaptoethanol. The column was
washed successively with 90 ml of B-II [0.75 M potassium acetate, 50 mM 2-(N-morpholino)ethanesulfonic acid, 0.1 mM EGTA, 20%
(wt/vol) glycerol, 40 mM imidazole (pH 6.3 adjusted with 5 M KOH)], 20 ml of B-III [0.75 M potassium acetate, 50 mM HEPES, 0.1 mM EGTA, 0.25 M sorbitol, 20% (wt/vol) glycerol, 40 mM imidazole (pH 7.0)], 35 ml
of B-IV100 (same as B-III except 100 mM imidazole), and finally 35 ml
of B-IV200 (same as B-III except 200 mM imidazole). B-II, B-III, and
B-IV100 contained the protease inhibitors. Sec23p/Iss1p was eluted from
the column with B-IV500 (same as B-III except 500 mM imidazole). In a
typical preparation, 1.5 mg of Sec23p/Iss1p was obtained from 25 g
of cells (wet weight). Fractions that contained Sec23p/Iss1p were frozen in liquid nitrogen and stored at
80°C.
Disruption of SEC24 and ISS1
pTYB131 is a pBluescript II SK(+) derivative harboring the
4.2-kb XhoI-HindIII fragment from pTYY113 with
the entire SEC24 gene. The BglII-SalI
fragment (1.6 kb) of pTYB131 was replaced by the 2.5-kb
BglII-SalI fragment of YEp13 containing the
LEU2 gene to yield pTYY303. A 3.7-kb
BamHI-HindIII fragment from pTYY303 containing a
partial SEC24 disrupted by LEU2 was introduced
into the diploid strain RSY612 to disrupt one of the chromosomal copies of SEC24. The resulting heterozygous disruption was named
RSY866. We confirmed the disruption by Southern blot analysis. Tetrad analysis was performed as described (Sherman et al., 1983
).
We deleted one of the chromosomal copies of ISS1 in the
diploid strain YPH501 (Sikorski and Hieter, 1989
) as follows. Two PCR
primers (TKPr12,
5'-CCTTCTTCCATTAATGATCGACAGCTGCAGTGAATAGCAGATTGTACTGAGAGTGCACC-3'; and TKPr13,
5'-GGTTAATAAAGATAAAGATTAAAGAAAGACTGATTGGCATAT-GATCCGTCGAGTTCAA-3') were used to amplify the HIS3 gene on pRS313 (Sikorski and
Hieter, 1989
). The underlined sequences of TKPr12 and TKPr13 anneal to the 5' and 3' regions of HIS3, respectively. YPH501 was
transformed with the amplified DNA fragment, and
His+ transformants were selected. The
transformants were sporulated and dissected to obtain a haploid cell
with a disruption of the ISS1 gene
(iss1-
1::HIS3).
A second disruption (iss1-
2::TRP1) that
replaced amino acids 116-622 of ISS1 with the
TRP1 marker was made by one-step disruption of the
chromosomal ISS1 gene. The disruption plasmid (pRH247) was
constructed as follows. A SpeI fragment of pRH200 was cloned into pRS306, creating pRH217. After deletion of the EcoRI
site from the polylinker, the 1.5-kb BglII-EcoRI
fragment of pRH217 was replaced with a 1-kb fragment containing the
TRP1 marker, creating pRH247.
A trp1 diploid, CKY19, was transformed with the 2.3-kb SpeI fragment of pRH247, yielding CKY498. Tetrad analysis of CKY498 gave 2:2 segregation of TRP1. Integration of TRP1 at the ISS1 locus was confirmed by Southern blotting
Construction of Yeast Strains for the Galactose Shut-Off Experiment
The SEC24 ORF was fused to the GAL1 promotor as follows. A 5'-terminal region of SEC24 was amplified and mutated by PCR to introduce an XbaI site in front of the initiation codon. No misincorporation was found by sequencing. The amplified fragment was subcloned into the HincII site of pBluescript II SK(+) to obtain pTYB133. We replaced the BamHI-SacI region of pTYB133 with a 3.0-kb BamHI-SacI fragment from pTYB131 to obtain the complete ORF (pTYB134). A 3.1-kb XbaI-HindIII fragment of pTYB134 was isolated and introduced downstream of the GAL1 promoter on pBM743 followed by a multicloning site. The resulting plasmid, pTYY214, was introduced into RSY866. After sporulation of the transformant, a haploid segregant was obtained in which SEC24 was expressed under the control of the GAL1 promoter. RSY875 is leu2-3,-112 his3-12,15 trp1-1 ura3-1 ade2-1 GAL2 sec24::LEU2 (pTYY214 [URA3 Gal1p-SEC24]).
Multicopy Suppression Analysis
The XhoI-HindIII fragment (4.2 kb) from pTYB131containing SEC24 was ligated into YEp352 (2µ URA3) digested with SalI and HindIII to obtain pTYY115. The HindIII fragment containing SEC23 was introduced into the HindIII site of YEp352 and pTYY115, giving pTYY122 and pTYY116, respectively. Various temperature-sensitive sec mutant strains were transformed with these plasmids.
Construction of ISS1-overexpressing Yeast Strains with SEC24 Disrupted
RSY866 (MATa/
SEC24/sec24::LEU2) was transformed with pTKY4 (2µ
URA3 ISS1). The resultant strain was sporulated, and the asci were dissected. Four strains derived from the same tetrad were
named TKY1 (MATa SEC24 [pTKY4 (URA3 ISS1)]),
TKY2 (MAT
SEC24 [pTKY4 (URA3 ISS1)]), TKY3
(MATa sec24::LEU2 [pTKY4 (URA3
ISS1)]), and TKY4 (MAT
sec24::LEU2
[pTKY4 (URA3 ISS1)]).
Similar strains were constructed with pTKY6 (2µ URA3
His6-tagged version of ISS1) instead of pTKY4 and named TKY5
(MATa SEC24 [pTKY6]), TKY6 (MAT
SEC24
[pTKY6]), TKY7 (MATa sec24::LEU2 [pTKY6]), and
TKY8 (MAT
sec24::LEU2 [pTKY6]).
We constructed the following plasmid and yeast strain to regulate the ISS1 expression level in the sec24-disrupted background. The BamHI-HindIII fragment (3.5 kb) of pTKY7 containing ISS1 was introduced into p426GAL1 (2µ URA3) digested with BamHI and HindIII. The resultant plasmid (pTKY11) was introduced into the diploid strain RSY866, in which one of the SEC24 genes had been disrupted by LEU2. The transformant was sporulated and dissected on a YPGal plate to allow the expression of ISS1. We obtained a haploid Leu+ and Ura+ strain, TKY22 (sec24::LEU2 [pTKY11 (URA3 Gal1p-ISS1)]), and a Ura+ strain, TKY23 (SEC24 [pTKY11 (URA3 Gal1p-ISS1)]).
Pulse-Chase Experiment
For pulse-chase analysis of carboxypeptidase Y (CPY) during
Sec24p depletion, RSY875 was grown in MV-lowS (galactose) with appropriate nutrients and then transferred to fresh MV-lowS (galactose) or MV-lowS (glucose) with the supplements. After 9, 12, and 15 h
of incubation, 3.0-OD600-unit cells were
collected, washed, and transferred to 5 ml of MV-noS (galactose) or
MV-noS (glucose). Cells were labeled with 9.3 MBq
Trans35S-label (ICN, Costa Mesa, CA) for 10 min
and then chased for 60 min. Aliquots (1.2 OD600
units of cells) were withdrawn before and after the chase, and lysates
were prepared with glass beads as described (Rothblatt and Schekman,
1989
). Radioactive proteins immunoprecipitated with anti-CPY antibody
were separated on SDS-PAGE and detected with a PhosphorImager
(Molecular Dynamics, Sunnyvale, CA).
We conducted a pulse-chase experiment for the iss1 null strain and the ISS1-overexpressing, sec24-disrupted strain as follows. The cells were grown in SC dropout medium to late log phase and then transferred to fresh SC dropout medium (initial OD600 = 0.15). After a 2.5-h incubation at 30°C, the cells were collected, washed three times with SC-Met dropout medium, and suspended in SC-Met dropout medium (OD600 = 0.3). After a 15-min incubation at 30°C, 35S-Promix (Amersham) was added (1.5 MBq for 0.3-OD600-unit cells). After a 7-min incubation at 30°C, methionine and cysteine were added (final concentration of each amino acid was 0.6 mg/ml) and incubation was continued at 30°C. Cells (0.3 OD600 unit) were taken from the solution 0, 5, 15, 30, and 60 min after the addition of methionine and cysteine. The cell suspension was mixed with an equal volume of 10 mM NaN3/10 mM NaF on ice, collected by centrifugation, and washed once with 10 mM NaN3/10 mM NaF. The cells were resuspended in lysis buffer (1% SDS, 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM PMSF) (100 µl for 0.3-OD600-unit cells) and disrupted with glass beads. Radioactive proteins immunoprecipitated with anti-CPY antibody or anti-Gas1p antibody were separated by SDS-PAGE and detected with a PhosphorImager (Molecular Dynamics).
Electron Microscopy
RSY875 grown in YPGal (5%) to OD600 = 0.15-0.6 was collected and suspended in sterile distilled water to
OD600 = 6. Fifty milliliters of YPD (5%) and
YPGal (5%) were inoculated with 0.1 ml of the RSY875 suspension. After
a 9-h incubation at 30°C, the cells were fixed with glutaraldehyde
followed by potassium permanganate, as described by Kaiser and Schekman
(1990)
. Briefly, 50% glutaraldehyde was added to cultures (final
concentration, 1%) for 10 min. Then the cells were centrifuged,
washed, and resuspended in 4% KMnO4 for 2-4 h
at 4°C. Fixed cells were collected, washed several times in water,
and incubated in 2% uranyl acetate for 12-16 h at 4°C. After
several rinses in water, the samples were dehydrated in an ethanol
series and embedded in Spurr's medium. Thin sections were stained with
lead citrate and viewed in a JEOL100 electron microscope (JEOL, Tokyo, Japan).
-Factor Halo Assay
A
sst2 strain, whose growth is arrested in the
presence of
-factor, was grown in YPD at 30°C to exponential phase
and suspended in YPD containing 1% agar to a final
OD600 of 3 × 10
4. A
YPD plate was overlaid with this suspension. To examine
-factor secretion, strains were grown to stationary phase in SC dropout medium
and spotted (0.01 OD600 unit/spot) on the
sst2-covered plate. The plate was incubated at 30°C for
2 d.
In Vitro ER Vesicle-budding Assay
GPY60 was grown at 30°C in YPD to exponential phase, and
microsomes were prepared as described (Wuestehube and Schekman, 1992
). Purified microsomes were adjusted to 40 OD280
(~8 mg protein/ml) in B88 (20 mM HEPES, pH 6.8, 250 mM sorbitol, 150 mM potassium acetate, 5 mM magnesium acetate). The preparation was
frozen in liquid nitrogen and stored at
80°C.
The microsome-based
-factor packaging assay was carried out as
follows based on the method described (Baker et al., 1988
; Rexach and Schekman, 1991
; Kuehn et al., 1996
).
[35S]Prepro-
-factor was posttranslationally
translocated into microsomes in the presence of 1× ATP regeneration
mix (Baker et al., 1988
) at 10°C for 30 min. Microsomes
(400 µg of protein) containing [35S]gp
F
were washed once with 1 ml of B88, resuspended in 50 µl of B88, mixed
with 50 µl of B88 containing 4.2 M urea (final concentration, 2.1 M),
and incubated at 0°C for 10 min. After addition of 1 ml of B88,
microsomes were collected by centrifugation and washed twice with 1 ml
of B88. Budding reactions were carried out in 50 µl of B88 containing
20 µg of urea-washed microsomes, 1× ATP regeneration mix, 0.1 mM
GMP-PNP, and appropriate amounts of Sar1p, Sec13p/Sec31p,
Sec23p/Sec24p, and Sec23p/Iss1p, whose concentrations are described in
RESULTS. The mixture was incubated at 20°C for 30 min, unless noted
otherwise, and chilled on ice for 5 min. Portions of the total reaction
and the medium-speed supernatant (MSS) (12,000 × g, 4 min) were collected. The amount of trypsin-resistant, concanavalin
A-precipitable [35S]gp
F in the MSS was
divided by the amount in the total fraction to determine the percentage
of
-factor packaged into the vesicles.
The large-scale budding reaction was carried out as follows to isolate the vesicles derived from the ER. For each reaction, microsomes containing 2 mg of proteins were used. Microsomes were incubated with 1× ATP regeneration mix in 1 ml of B88 for 30 min at 10°C. After being washed once with 1 ml of B88, they were incubated with 2.1 M urea in 300 µl of B88 for 10 min at 0°C. After addition of 1 ml of B88, microsomes were collected by centrifugation and washed twice with 1 ml of B88. A budding reaction was carried out at 20°C for 30 or 60 min in 1 ml of B88 containing 2 mg of microsomes, 1× ATP regeneration mix, 0.2 mM GMP-PNP, 65 µg of Sar1p, 120 µg of Sec13p/Sec31p, and 35 µg of either Sec23p/Sec24p or Sec23p/Iss1p. After 5 min on ice, a 50-µl aliquot reaction mixture was taken as total, and the remaining solution was centrifuged (14,000 × g, 4 min) to obtain a MSS fraction. A sucrose density gradient consisting of 0.3 ml of B88 containing 70% (wt/wt) sucrose and 2.5 ml of B88 containing 15% (wt/wt) sucrose was overlaid with 750 µl of the MSS. After centrifugation at 50,000 rpm (~250,000 × g) for 2 h (SW55, Beckman), the interface (~0.5 ml) between 15 and 70% sucrose was collected, and its sucrose concentration was adjusted to 55% (wt/wt) with the use of B88 containing 70% (wt/wt) sucrose. The final volume was ~0.8 ml, and 0.55 ml of this solution was placed on the bottom of a sucrose density gradient consisting of B88 containing 52.5, 50, 45, 40, 35, and 25% (wt/wt) sucrose (from the bottom to the top). The volume of each of the bottom three layers was 0.5 ml, and the volume of each of the top three layers was 1 ml. This gradient was centrifuged at 50,000 rpm (~250,000 × g) for 20 h (SW55, Beckman), and fractions (0.4 ml × 13) were collected from the top with a density gradient fractionator (ISCO, Lincoln, NE). Proteins in these fractions were concentrated by TCA precipitation.
Other Methods
Sarlp, Sec13p/Sec31p, and Sec23p/Sec24p were purified as
described previously (Barlowe et al., 1994
; Yeung et
al., 1995
; Salama et al., 1997
). DNA manipulation was
done according to Sambrook et al. (1989)
. Yeast cells were
transformed by the lithium acetate method (Ito et al.,
1983
). Protein concentrations were determined with the Bio-Rad
(Richmond, CA) protein assay kit with the use of BSA as a standard.
Silver staining was carried out as described (Bloom et al.,
1987
). Western blot analysis was performed with a nitrocellulose
membrane, and ECL (Amersham) was used for detection.
| |
RESULTS |
|---|
|
|
|---|
Cloning and Sequence Analysis of SEC24
We purified the Sec23p/Sec24p complex from crude yeast cytosol and
obtained peptide sequence information from tryptic fragments of Sec24p.
A part of the SEC24 gene was PCR amplified with the use of
degenerate primers designed according to the peptide sequence information. Finally, a DNA fragment containing the entire
SEC24 gene was obtained by screening a S. cerevisiae genomic DNA library with the use of the PCR fragment as
a hybridization probe. The identified ORF (YIL109C) encoded 926 amino
acid residues (Figure 1), including four
sequences corresponding to those obtained by sequencing of the tryptic
fragments. The predicted molecular mass of 103,614 Da agrees with the
estimated mass of purified Sec24p (~105 kDa). The coding sequence
does not appear to contain a hydrophobic signal sequence or
transmembrane domain, consistent with the observation that
Sec23p/Sec24p is a cytosolic protein (Hicke et al., 1992
). As a final verification of identity, we constructed a hybrid of the
trpE gene fused to the ORF YIL109C and showed that this
fusion protein expressed in Escherichia coli
could be recognized by anti-Sec24p (our unpublished data). These data
confirm that SEC24 is YIL109C.
|
We searched a nonredundant sequence database for similarity with the Sec24p sequence with the use of BLAST2 (http://www.ncbi.nlm.nih.gov/BLAST/) and found that human (DDBJ accession number D38555), Caenorhabditis elegans (SPTREMBL accession numbers Q19371 and Q23368), and Arabidopsis thaliana (EMBL accession number AL022537 [PID accession number e1287285]) have homologous proteins (our unpublished data).
Interestingly, a second ORF of S. cerevisiae, YNL049C, showed striking similarity with SEC24. YNL049C was first isolated in a two-hybrid interaction assay with the use of the central region of Sec16p as a bait construct and was named ISS1 (interactor with SEC sixteen) (our unpublished data). The protein sequence of Iss1p is 62% identical to that of Sec24p (Figure 1). This sequence similarity extends throughout the length of the protein and defines two variable regions in the N-terminal part of the proteins, a glutamine-rich domain (amino acids 17-143 in Sec24p, amino acids 17-67 in Iss1p) and a charged domain (amino acids 362-372 in Sec24p, amino acids 295-327 in Iss1p).
Sec24p Depletion is Lethal and Causes a Defect in CPY Maturation and Exaggeration of the ER
The SEC24 gene was disrupted with LEU2 in a
diploid strain. After sporulation, most tetrads contained two viable
and two dead spores (Figure 2). The
viable spores were all Leu
, indicating that
they retained wild-type SEC24. This was confirmed by
Southern blot analysis (our unpublished data). SEC24 is thus essential for cell viability.
|
To investigate the phenotype of a strain depleted of Sec24p, we
constructed haploid strain RSY875 that has a disrupted chromosomal SEC24 locus covered by a plasmid-borne copy of
SEC24 expressed from the GAL1 promoter. When
RSY875 cells were grown to early exponential phase in MVCA (galactose)
and then transferred to MVCA (glucose) to repress expression of Sec24p,
cell growth slowed after 8 h and ceased after ~14 h (Figure
3A).
|
Using the cells grown in the glucose or galactose medium for 9, 12, and 15 h, we conducted a pulse-chase experiment to monitor the maturation of CPY as an assay for the function of the early part of the secretory pathway. Newly synthesized pro-CPY is translocated into the ER, where it is glycosylated to become the p1 form (67 kDa), and then transported to the Golgi to be modified to the p2 form (69 kDa). Mature CPY (61 kDa) is produced by proteolytic cleavage after pro-CPY enters the vacuole. In RSY875 cells grown on galactose medium, the p1 form of pulse-labeled CPY was processed to the mature form within 60 min of the chase period (Figure 3B, lanes 2, 6, and 10). In contrast, cells that had grown in glucose for 9 h processed only a portion of CPY to the mature form, and after 12 or 15 h of growth in glucose medium most of the CPY remained as the p1 form (Figure 3B, lanes 4, 8, and 12). Thus, depletion of cellular Sec24p causes a block in ER-to-Golgi transport. In the glucose-grown cells, some CPY in a 60-kDa form was detected during the pulse period (Figure 3B, lanes 3, 7, and 11, arrowheads), and this form appeared to be converted to the p1 form after the chase. This 60-kDa form of CPY likely corresponds to prepro-CPY, an ER membrane translocation precursor. An accumulation of prepro-CPY may be a consequence of a prolonged ER-to-Golgi transport defect.
We examined the morphological consequences of Sec24p depletion by
electron microscopy of fixed cells. RSY875 was grown in YPGal and then
transferred to either YPGal or YPD for 9 h. Cells were fixed with
glutaraldehyde followed by 4% KMnO4, a fixation and stain that gives contrast to membrane-derived structures (Kaiser and Schekman, 1990
). Cells depleted of Sec24p by growth on glucose showed extensive ER proliferation: long sheets of ER could be seen in
the cytoplasm and concentrated at the cell periphery. In a few cases,
the ER sheets or tubules formed mesh-like structures (Figure
4A). The cells that contained Sec24p
because of growth in galactose appeared to have normal ER morphology
(Figure 4B). A control strain with a wild-type copy of SEC24
on its chromosome showed normal morphology in both glucose and
galactose media (our unpublished data). The morphological phenotype of
Sec24p depletion is similar to that seen in the class I ER-to-Golgi
sec mutants such as sec12 (Kaiser and Schekman,
1990
) and is in agreement with the in vitro observation that Sec24p is
required for COPII vesicle formation (Hicke et al., 1992
).
|
Genetic Interaction between SEC24 and Other ER-to-Golgi SEC Genes
We next investigated the effect of Sec24p overproduction on the
early sec mutants. Either pTYY122 (SEC23 on
YEp352 [2µ URA3]), pTYY115 (SEC24 on YEp352),
pTYY116 (SEC23 and SEC24 on YEp352), or
vector (YEp352) was introduced into a Sec+
strain as well as into the following sec mutants:
sec12-1, sec13-1, sec16-2,
sec17-1, sec18-1, sec19-1,
sec20-1, sec22-3, sec23-1, sec23-2, sec23-3, and sec23-4. The
growth of these transformants at 23 and 37°C was compared on plates.
Although the temperature-sensitive phenotypes of sec12-1,
sec13-1, sec17-1, sec18-1,
sec20-1, sec22-3, sec23-1,
sec23-3, and sec23-4 were not suppressed by these
plasmids (our unpublished data), sec23-2 and
sec16-2 were. Overproduction of Sec24p suppressed
sec23-2 (Figure 5A), and
overproduction of both Sec23p and Sec24p in the same cell suppressed
sec16-2 (Figure 5B). These genetic interactions are
consistent with the binding interactions among Sec24p, Sec23p, and
Sec16p that have been detected in vitro (Hicke et al., 1992
;
Gimeno et al., 1996
).
|
Overproduction of Sec23p was toxic to both sec12-1 and
sec13-1 (our unpublished data). Even the wild-type
cells could not tolerate the overproduction of Sec23p by a multicopy
plasmid with SEC23 under the control of the GAL1
promoter (Figure 5C). These phenomena are consistent with the fact that
excess Sec23p monomer inhibits vesicle formation in vitro (Yoshihisa
et al., 1993
). The introduction of SAR1 on
multicopy plasmid only partially mitigated the growth inhibition by
overexpression of SEC23 (our unpublished data).
A temperature-sensitive allele of SEC24, sec24-1,
was isolated from a collection of random temperature-sensitive S. cerevisiae mutants by screening for secretion defects at 37°C.
The sec24-1 mutant is unable to grow at temperatures
>27°C and accumulates the ER (p1) form of the secretory marker
protein CPY (Chitouras, Frand, and Kaiser, unpublished observations).
We crossed sec24-1 to different sec mutant
strains to test for possible synthetic lethal interactions. Because
Sec24p is required for COPII vesicle formation in vitro, we expected to
find strong synthetic lethal interactions between sec24-1
mutations and other vesicle-formation mutations (sec12-4,
sec13-1, sec16-2, and sec23-1), which
was the case (Table 3). In addition, we
detected significant synthetic lethal interactions between
sec24-1 and mutations in v-SNARE genes (sec22-3
and bet1-1) and other mutants defective in vesicle fusion (sec17-1 and sec18-1) (Table 3). Such
interactions with docking or fusion mutations were not observed for
sec12, sec13, sec16, or
sec23 mutations (Kaiser and Schekman, 1990
), suggesting that Sec24p may have a unique function among the COPII genes in the packaging of SNARE proteins, or in the docking or fusion of ER-derived vesicles with the Golgi apparatus (Peng et al., 1999
).
|
ISS1 Is Not Essential for Growth or Transport of CPY and Gas1p
Next, we examined the function of the SEC24
homologue ISS1. We used HIS3 to disrupt one copy
of the ISS1 gene in a diploid strain. On sporulation, the
heterozygous diploid yielded four spores from most tetrads. Two of the
spores were His+, and the other two were
His
. The presence of the
iss1-
1::HIS3 disruption in the
His+ strain was verified by PCR with the use of
primers to the 5'-noncoding region of ISS1 and
HIS3 coding sequences. The
iss1-
1::HIS3 haploids grew normally at 24, 30, and 37°C. Therefore, ISS1 is not essential for cell growth.
The rate of maturation of CPY and Gas1p in the
iss1-
1::HIS3 strain was examined by a
pulse-chase experiment. Gas1p is first modified in the ER to form a
105-kDa GPI-anchored precursor with N- and
O-linked core oligosaccharides. Then it is modified to a
125-kDa mature form in the Golgi and delivered to the plasma membrane.
After a 7-min pulse, TKY10 (ISS1) and TKY12
(iss1-
1::HIS3) were chased for up to 60 min.
The maturation rate of CPY in TKY12 was almost the same as that in
TKY10 (Figure 6A). Gas1p maturation was
slightly slower in TKY12 than in TKY10, but the effect was moderate
(Figure 6B). These data indicate that ISS1 is not essential for the transport of these proteins.
|
Suppression of SEC24 Mutations by ISS1
Because Iss1p is similar to Sec24p in both sequence and
protein-protein interactions, we tested whether Iss1p could substitute for Sec24p during ER-to-Golgi transport. An initial indication of
functional overlap came from the observation that the expression of
ISS1 from a high-copy-number (2µ) plasmid could restore
growth of sec24-1 at temperatures up to 36°C (our
unpublished data). We further tested the ability of ISS1
overexpression to suppress a chromosomal deletion of SEC24.
RSY866, a diploid strain heterozygous for a SEC24 gene
disruption (sec24::LEU2), was transformed with pTKY4 (2µ plasmid with ISS1 gene). Sporulation of this
diploid often yielded tetrads with four viable spores. In the tetrads with four viable spores, two of the spore clones were
Leu+ and the other two were
Leu
. The absence of the SEC24 gene
in Leu+ spore clones was confirmed by Western
blot analysis for Sec24p. Thus, sec24::LEU2 can be
suppressed by increased dosage of the ISS1 gene. We could
not obtain a sec24::LEU2 haploid strain with the
use of pRH200 (CEN ISS1) instead of pTKY4 (2 µm
ISS1) (our unpublished data).
We also found that ISS1 tagged with a
His6-encoding sequence can suppress
SEC24 disruption (Figure 7A),
indicating that the His6-tagged version of Iss1p
is functional in vivo. Immunoblot analysis showed that all
four strains derived from one tetrad produced
Iss1p-His6 as well as Sec23p and that Sec24p was
absent from the two Leu+ spores (Figure 7B). A
strain with the chromosomal disruption sec24::LEU2
suppressed by pTKY4 (2 µm ISS1) grew more slowly than the
wild-type strain at 37°C, but the growth was indistinguishable from
that of the wild-type strain at 24 and 30°C (Figure 7C).
|
The apparent indispensability of Iss1p overexpression in cells with the chromosomal disruption sec24::LEU2 was confirmed by a galactose shut-off experiment. TKY22 (sec24::LEU2 [pTKY11 (GAL1p-ISS1)]) grew well when Iss1p expression was induced by growth in the galactose medium, but the growth of this strain was severely inhibited when Iss1p expression was repressed by growth on glucose medium (Figure 7D).
We next examined whether protein secretion was fully restored in
strains with the chromosomal disruption
sec24::LEU2 suppressed by pTKY4 (2 µm
ISS1). A convenient test for secretion of
-factor is to
assay the extent of growth inhibition of a MATa
sst2
strain by a halo assay. Clear halos of equal
diameter formed around both a MAT
sec24::LEU2 (pTKY4 [2µ ISS1])
strain and the MAT
control strain, showing that the
secretion of
-factor was normal (Figure
8A).
|
We also examined the maturation kinetics of CPY and Gas1p in the sec24::LEU2 (pTKY4 [2µ ISS1]) strain by a pulse-chase experiment. Maturation of CPY occurred in the sec24::LEU2 (pTKY4 [2µ ISS1]) cells at almost the same rate as in SEC24 control cells (Figure 8B). Maturation of Gas1p occurred more slowly, but after a 60-min chase, >90% of Gas1p was converted to the mature form (Figure 8B). These data indicate that transport of CPY and Gas1p from the ER to the Golgi can be achieved in the Sec24p-depleted cells if there is sufficient Iss1p.
Genetic Interactions between ISS1 and v-SNARE Mutants
To learn more about the function of Iss1p in the secretory
pathway, we tested for synthetic lethal interactions between
iss1-
2::TRP1 and a panel of secretion mutants
(Table 3). Synthetic lethal interactions have been helpful for
detecting the step in the secretory pathway at which a gene product
acts, because synthetic lethal interactions usually occur only between
two genes that affect the same step of the pathway (Newman et
al., 1987
; Salminen and Novick, 1987
; Rothblatt et al.,
1989
; Kaiser and Schekman, 1990
; Gimeno et al.,
1996
). Surprisingly, iss1-
2::TRP1 did
not affect mutants defective in vesicle formation (sec12-4,
sec13-1, sec16-2, and sec23-1) or
vesicle fusion (sec17-1 and sec18-1) but showed strong synthetic lethal interactions with mutants defective in v-SNARE
proteins required for ER-to-Golgi transport (sec22-3 and bet1-1) (Table 3).
We also examined the corresponding effects of ISS1 overexpression on v-SNARE mutations. ISS1 on either a low- or high-copy-number plasmid was transformed into a variety of sec and bet mutant strains, and the transformants were tested for their temperature sensitivity. ISS1 overexpression suppressed the growth defect of both sec22 alleles tested (Figure 8C) but had no effect on the growth of any of the other mutants, with the exception of sec24-1. The ability of ISS1 overexpression to suppress sec22 is consistent with the synthetic lethality of iss1 sec22 double mutants. Thus, both ISS1 and SEC24 are implicated in vesicle docking or fusion by their genetic interactions.
Purification of Iss1p as a Complex with Sec23p
Iss1p was purified from RSY620 harboring pTKY7, which expresses a
His6-tagged version of the ISS1 gene
under the control of the GAL1 promoter, and pTKY9, which
expresses SEC23 under the control of the GAL1
promoter. A high-speed supernatant fraction prepared from the lysate
was loaded onto a Ni-NTA agarose column and eluted with a stepwise
gradient of imidazole-containing buffers. The peak fractions, eluted
with 500 mM imidazole, contained two proteins (Figure
9, lane 6), one of which (100 kDa) was
identified as His6-tagged Iss1p and the other of
which (85 kDa) was identified as Sec23p by Western blotting with either
His6 antibody or Sec23p antibody (our unpublished
data). The coelution of Iss1p with Sec23p indicated that these proteins
assemble into a complex (when a control extract from cells expressing
Iss1p without the His6 tag was used, Sec23p did
not bind to the column). An extract from 25 g (wet weight) of
cells yielded 1.5 mg of the Sec23p/Iss1p complex. We found that
glycerol was necessary to stabilize purified Sec23p/Iss1p; in buffers
that lacked glycerol, the purified complex lost ~80% of its activity
in 5 d at 4°C, whereas >80% of its activity remained under the
same conditions in the presence of 20% glycerol.
|
Sec23p/Iss1p Drives Formation of COPII-like Vesicles from the ER
The
-factor halo assay (Figure 8A) with
sec24-disrupted cells suggested that Iss1p could substitute
for Sec24p in
-factor trafficking in vivo and suggested that Iss1p
might also substitute for Sec24p in the incorporation of gp
F into
COPII vesicles in vitro (Barlowe et al., 1994
; Bednarek
et al., 1995
). We examined this activity with the use of
purified Sec23p/Iss1p and found that 20-25% of gp
F was captured in
vesicles budded from ER membranes incubated with Sar1p, Sec13p/Sec31p,
and Sec23p/Iss1p (without Sec23p/Sec24p) (Figure
10). The packaging of gp
F into
vesicles required added GTP or GMP-PNP; in the absence of these
nucleotides, <5% of gp
F was released into the vesicle fraction
(our unpublished data). The amount of gp
F packaged increased with
increasing concentrations of Sec23p/Iss1p (Figure 10A) and increasing
incubation times (Figure 10B). Together, these results indicate that
Sec23p/Iss1p, like Sec23p/Sec24p, drives the formation of
gp
F-containing vesicles from the ER.
|
To compare the cargo molecules in the vesicles produced with Sec24p and
Iss1p, we carried out the budding reaction on a large scale in the
presence of Sec23p complexes containing Sec24p or Iss1p and isolated
the vesicles on a sucrose density gradient. As shown in Figure
11A, Sec23p was present in the
fractions whose sucrose concentration was ~38% when the budding
reaction was carried out in the presence of Sec23p/Iss1p or
Sec23p/Sec24p. Sec23p was not found in these fractions when the budding
reaction was carried out in the absence of GMP-PNP (Figure 11A) or
without Sec23p/Iss1p and Sec23p/Sec24p (our unpublished data). Thus,
Sec23p/Iss1p produces vesicles from the ER in the presence of Sar1p,
Sec13p/Sec31p, and GMP-PNP, and the densities of these vesicles are
similar to those of regular COPII vesicles produced by Sec23p/Sec24p.
Like COPII vesicles, the vesicles produced with Iss1p contained SNARE molecules (Sec22p and Bet1p) and did not contain the ER-resident protein Sec61p (Figure 11B). Silver staining of the proteins showed that the vesicles produced with Iss1p contained Iss1p (100-kDa band) as
well as Sec31p, Sec23p, Sec13p, and Sar1p. The vesicles produced with
Sec24p contained Sec24p (105-kDa band) instead of Iss1p. Other abundant
proteins in the Iss1p-coated vesicles were indistinguishable from those
in the Sec24p-coated regular COPII vesicles (Figure 11C).
|
| |
DISCUSSION |
|---|
|
|
|---|
Sec24p Plays an Essential Role in COPII Vesicle Formation In Vivo
Here we have shown that Sec24p is indispensable for protein transport from the ER in vivo; deletion of the SEC24 gene is lethal, and depletion of Sec24p causes exaggeration of the ER as well as a defect in CPY exit from the ER (Figures 2-4). A homology search revealed that humans, C. elegans, and A. thaliana have SEC24 homologues. Thus, Sec24p probably performs a similar role in vesicle formation from the ER in all eukaryotes.
Gimeno et al. (1996)
showed that Sec24p and Sec23p bind to
adjacent regions of Sec16p: Sec23p binds to a C-terminal region and
Sec24p binds to a more central region of Sec16p. The finding that the
temperature sensitivity of sec16-2 is suppressed by the combined overproduction of Sec24p and Sec23p suggests that interaction between these proteins is important for budding events in vivo, although the requirement of Sec16p is not absolute in vitro (Matsuoka et al., 1998
). It is also known that Sec31p interacts with
Sec24p (Shaywitz et al., 1997
). Therefore, it is probable
that Sec24p serves as an essential structural unit of coat structure.
GTP hydrolysis by Sar1p renders the COPII coat unstable (Barlowe
et al., 1994
), and the GTPase activity of Sar1p is activated by Sec23p (Yoshihisa et al., 1993
). Accordingly, the timing
of GTP hydrolysis by Sar1p as activated by Sec23p may be regulated in
some way to prevent premature release of the coat subunits before
budding is complete. It is interesting to speculate that Sec24p may
participate in the regulation of Sar1p GTPase activation. Although
previous experiments indicated that Sec24p does not affect the
GTPase-activation activity of Sec23p in solution (Yoshihisa et
al., 1993
), in the context of an intact coat, e.g., one that includes Sec16p (Espenshade et al., 1995
), Sec24p may impede
the interaction of Sec23p with Sar1p until vesicle fission has been completed. Because overproduction of Sec23p impairs cell growth (Figure
5C) and excess Sec23p inhibits the budding reaction in vitro (Yoshihisa
et al., 1993
), it may be that an appropriate balance of
Sec24p and Sec23p is important for efficient budding.
Iss1p Replaces the Essential Role of Sec24p
The S. cerevisiae genomic sequence revealed a gene (ISS1) with striking similarity to SEC24 (Figure 1). We found that deletion of ISS1 does not have a significant effect on yeast growth or the maturation kinetics of CPY and Gas1p (Figure 6). We found that on overexpression, Iss1p can fulfill the essential function of Sec24p (Figure 7). Strains with a chromosomal disruption of SEC24 that were suppressed by overexpression of ISS1 grew slowly at 37°C, indicating that Iss1p itself or interactions between Iss1p and other proteins may be unstable at high temperature. Because disruption of SEC24 in an otherwise wild-type strain is lethal, the endogenous level of Iss1p expressed from the chromosomal gene must not be sufficient to carry out the essential function of Sec24p (Figures 2 and 3).
Genetic Interactions of SEC24 and ISS1
Tests for genetic suppression and synthetic lethality revealed a
possible connection between the functions of SEC24 and
ISS1 and SNARE proteins involved in COPII vesicle function.
First, the loss-of-function mutants iss1 and
sec24 were found to exacerbate mutations in the SNARE genes
SEC22 and BET1 (Table 3). Second, overexpression
of ISS1 partially suppressed mutations in SEC22 (Figure 8C). These genetic interactions of sec24 mutants
with vesicle-docking mutants were particularly surprising, because none
of the other mutants in COPII components shows interactions with
vesicle-docking mutants (Kaiser and Schekman, 1990
).
Four mechanisms can be postulated by which Sec24p and Iss1p could
affect vesicle docking or fusion. First, Sec24p and Iss1p may be
required for loading of the v-SNAREs Sec22p, Bet1p, and, possibly,
Bos1p into vesicles during vesicle formation. Consistent with this idea
is the observation that Bet1p and Bos1p are concentrated into
prebudding complexes by the COPII proteins Sar1p, Sec23p, and Sec24p
(Springer and Schekman 1998
). It is conceivable that Sec24p and Iss1p
similarly direct incorporation of docking factors into COPII-coated
vesicles by binding to their cytosolic domains. To date, attempts to
coprecipitate v-SNARE proteins with either Sec24p or Iss1p have been
unsuccessful. A second possibility is that Sec24p and Iss1p may be
required for the formation of retrograde transport vesicles that
recycle integral membrane docking factors to the ER. If formation of
these vesicles is blocked, Sec22p and other docking factors will be
depleted from the ER, ultimately causing a defect in vesicle docking.
Interestingly, mutants in coatomer components that block recycling
(sec21, sec26, and sec27) have
multiple genetic interactions with docking mutants similar to
iss1 and sec24 mutants (Newman and Ferro-Novick,
1987
; Duden et al., 1994
). If Iss1p and Sec24p in fact
participate in retrograde transport, it would be expected that mutants
in these proteins cause missorting of recycled cargo proteins. However,
we have been unable to detect a sorting defect in iss1
mutants. In particular, deletion of iss1 does not cause
missorting of Kar2p, an ER protein that undergoes recycling, and does
not affect the recycling of a KKXX-containing fusion protein (our
unpublished data). A third possibility is that Sec24p and Iss1p
participate in the fusion reaction itself. Recently, Peng et
al. (1999)
detected strong and specific interaction between Sec24p
and Sed5p, a t-SNARE that marks the docking site for COPII vesicles
targeted to the cis-Golgi compartment. It is possible that
Sec24p and Iss1p participate in the formation of complexes between
v-SNAREs and t-SNAREs. Finally, a role for Sec24p and Iss1p in vesicle
docking or fusion could reflect a requirement for these proteins in
regulated disassembly of the COPII coat, possibly stimulating GTP
hydrolysis on Sar1p. More detailed biochemical studies will be required
to resolve these possibilities.
Cargo Recruitment by Sec24p-coated Vesicles and Iss1p-coated Vesicles
Recently, it was shown that Sar1p and Sec23p/Sec24p cooperate to
recruit cargo molecules into ER-derived vesicles (Aridor et
al., 1998
; Kuehn et al., 1998
; Springer and Schekman,
1998
). This suggests a direct interaction between these coat proteins and cargo molecules or adaptor molecules that bind to the cargo molecules. Because Iss1p and Sec24p differ, we considered the possibility that Sec23p/Iss1p serves to recruit a subset of cargo molecules different from those recruited by Sec23p/Sec24p. We found
that purified Sec23p/Iss1p replaces Sec23p/Sec24p to drive vesicle
formation from the ER in vitro (Figures 10 and 11). However, we did not
see a clear difference in cargo composition between Sec24p- and
Iss1p-coated vesicles (Figures 10 and 11). Therefore, at least the
abundant cargo proteins as well as
-factor and SNAREs (Sec22p and
Bet1p) can be recruited into the vesicles by both Sec24p and Iss1p in
collaboration with the other COPII components. We cannot exclude the
possibility that Iss1p recruits a different subset of cargo molecules
whose amounts are too small to be detected by silver staining and that
are not essential to cell viability under the conditions we used.
Sec24p and Iss1p may display quantitative rather than qualitative
differences in the recognition of cargo molecules. In the titration
experiments and kinetic studies measuring the packaging of
-factor
precursor, we found that purified Sec23p/Iss1p was consistently less
active than Sec23p/Sec24p (Figure 10). Of course, Sec23p/Iss1p may
simply be inherently less active than Sec23p/Sec24p as a coat promoter.
However, in sec24 null mutant cells suppressed by
overexpression of ISS1, we found a measurable difference in the rates of maturation of CPY and Gas1p compared with wild-type cells
(Figure 8). This result is most consistent with qualitative differences
in cargo or cargo receptor recognition by Iss1p and Sec24p.
Pagano et al. (1999)
and Roberg et al. (1999)
reported the cloning and characterization of a more distant (23%
identical) homologue of Sec24p. Pagano et al. found that
this homologue (which they call Sec24C), when deleted, reduces the
secretion of a subset of prominent proteins detected in the cell
culture supernatant. Pagano et al. also report the cloning
and deletion of ISS1 (which they call Sec24B). Deletion of
this gene has no effect on the spectrum of proteins secreted into the
culture supernatant. Roberg et al. (1999)
discovered
SEC24C by a screen for mutations lethal in a
sec13-1 mutant strain. They call this gene LST1
and demonstrate that lst1 null cells are sensitive to low pH
because of a deficit in transport of the major plasma membrane ATPase,
Pma1p, out of the ER. Roberg et al. document a complex of
Lst1p and Sec23p and suggest that this dimer may perform a specialized
function in the packaging of Pma1p into COPII vesicles.
Together, our data and the recent reports suggest that Sec24p and its homologues may define the selectivity of cargo protein sorting. The signal that interacts with Sec24p, Iss1p (Sec24B), and Lst1p (Sec24C), and the binding pocket within these coat subunits, remain to be defined.
| |
ACKNOWLEDGMENTS |
|---|
We thank B. Lesch for the preparation of purified COPII components, A. Frand for isolation of the sec24-1 allele, A. Spang and S. Springer for comments on the manuscript, and members of the Schekman and Kaiser laboratories for helpful discussion. T.K. was supported by fellowships from the Human Frontier Science Program and the Ministry of Education, Science, Sports, and Culture of Japan. This work was supported by grants from the National Institutes of Health, the Human Frontier Science Program, and the Howard Hughes Research Foundation.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
schekman{at}uclink4.berkeley.edu.
Present addresses: Institute for Chemical
Research, Kyoto University, Kyoto, Japan;
§ Millennium Pharmaceuticals, Inc., Cambridge, MA 02139;
¶ Department of Chemistry, Graduate School of Science, Nagoya University, Nagoya, Japan.
| |
ABBREVIATIONS |
|---|
Abbreviations used:
CPY, carboxypeptidase Y;
ER, endoplasmic
reticulum;
GMP-PNP, 5'-guanylyl imidodiphosphate;
gp
F, glycosylated
pro-
-factor;
MSS, medium-speed supernatant;
Ni-NTA, nickel-nitriloacetic acid;
SC, synthetic complete;
TCA, trichloroacetate.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Sanchatjate and R. Schekman Chs5/6 Complex: A Multiprotein Complex That Interacts with and Conveys Chitin Synthase III from the Trans-Golgi Network to the Cell Surface Mol. Biol. Cell, October 1, 2006; 17(10): 4157 - 4166. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sato COPII Coat Assembly and Selective Export from the Endoplasmic Reticulum J. Biochem., December 1, 2004; 136(6): 755 - 760. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Ross, Y. N. Huang, J. N. Marchese, B. Williamson, K. Parker, S. Hattan, N. Khainovski, S. Pillai, S. Dey, S. Daniels, et al. Multiplexed Protein Quantitation in Saccharomyces cerevisiae Using Amine-reactive Isobaric Tagging Reagents Mol. Cell. Proteomics, December 1, 2004; 3(12): 1154 - 1169. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Fatal, L. Karhinen, E. Jokitalo, and M. Makarow Active and specific recruitment of a soluble cargo protein for endoplasmic reticulum exit in the absence of functional COPII component Sec24p J. Cell Sci., May 1, 2004; 117(9): 1665 - 1673. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Hahn and D. J. Thiele Activation of the Saccharomyces cerevisiae Heat Shock Transcription Factor Under Glucose Starvation Conditions by Snf1 Protein Kinase J. Biol. Chem., February 13, 2004; 279(7): 5169 - 5176. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wegmann, P. Hess, C. Baier, F. T. Wieland, and C. Reinhard Novel Isotypic {gamma}/{zeta} Subunits Reveal Three Coatomer Complexes in Mammals Mol. Cell. Biol., February 1, 2004; 24(3): 1070 - 1080. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Fatal, T. Suntio, and M. Makarow Selective Protein Exit from Yeast Endoplasmic Reticulum in Absence of Functional COPII Coat Component Sec13p Mol. Biol. Cell, December 1, 2002; 13(12): 4130 - 4140. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Nufer, S. Guldbrandsen, M. Degen, F. Kappeler, J.-P. Paccaud, K. Tani, and H.-P. Hauri Role of cytoplasmic C-terminal amino acids of membrane proteins in ER export J. Cell Sci., January 2, 2002; 115(3): 619 - 628. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Matsuoka, R. Schekman, L. Orci, and J. E. Heuser Surface structure of the COPII-coated vesicle PNAS, November 20, 2001; 98(24): 13705 - 13709. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ishihara, M. Hamasaki, S. Yokota, K. Suzuki, Y. Kamada, A. Kihara, T. Yoshimori, T. Noda, and Y. Ohsumi Autophagosome Requires Specific Early Sec Proteins for Its Formation and NSF/SNARE for Vacuolar Fusion Mol. Biol. Cell, November 1, 2001; 12(11): 3690 - 3702. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shimoni, T. Kurihara, M. Ravazzola, M. Amherdt, L. Orci, and R. Schekman Lst1p and Sec24p Cooperate in Sorting of the Plasma Membrane ATPase into COPII Vesicles in Saccharomyces cerevisiae J. Cell Biol., November 20, 2000; 151(5): 973 - 984. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||