![]() |
|
|
Vol. 11, Issue 4, 1213-1224, April 2000
and
*European Molecular Biology Laboratory, Cell Biology Program, 69012 Heidelberg, Germany; and
Division of Neurophysiology,
National Institute for Medical Research, London NW7 1AA, United
Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
Neurons transport newly synthesized membrane proteins along axons by microtubule-mediated fast axonal transport. Membrane proteins destined for different axonal subdomains are thought to be transported in different transport carriers. To analyze this differential transport in living neurons, we tagged the amyloid precursor protein (APP) and synaptophysin (p38) with green fluorescent protein (GFP) variants. The resulting fusion proteins, APP-yellow fluorescent protein (YFP), p38-enhanced GFP, and p38-enhanced cyan fluorescent protein, were expressed in hippocampal neurons, and the cells were imaged by video microscopy. APP-YFP was transported in elongated tubules that moved extremely fast (on average 4.5 µm/s) and over long distances. In contrast, p38-enhanced GFP-transporting structures were more vesicular and moved four times slower (0.9 µm/s) and over shorter distances only. Two-color video microscopy showed that the two proteins were sorted to different carriers that moved with different characteristics along axons of doubly transfected neurons. Antisense treatment using oligonucleotides against the kinesin heavy chain slowed down the long, continuous movement of APP-YFP tubules and increased frequency of directional changes. These results demonstrate for the first time directly the sorting and transport of two axonal membrane proteins into different carriers. Moreover, the extremely fast-moving tubules represent a previously unidentified type of axonal carrier.
| |
INTRODUCTION |
|---|
|
|
|---|
In neurons, newly synthesized proteins have to travel tremendous
distances to their final destinations. For proper function and
maintenance of both the elaborate dendritic tree and the sometimes extremely elongated axon, neurons need to have a fast and precise delivery system for newly synthesized proteins. In recent years, many
studies have led to the identification of a variety of motor proteins
and accessory molecules necessary for axonal transport. In fact, the
first molecular motor protein to be identified, kinesin, was isolated
from squid giant axons (Vale et al., 1985a
) and chick brain
(Brady, 1985
). Currently it is believed that there are a number
of different microtubule motor proteins, kinesin superfamily proteins
(KIFs), each of which is responsible for a specific set of cargo (for
review, see Hirokawa, 1997
; Hirokawa et al., 1998
). KIF1A,
for example, was shown to transport vesicles containing a subset of
synaptic vesicle proteins (Okada et al., 1995
; Yonekawa et al., 1998
), whereas KIF2 transported a distinct class of
vesicles (Noda et al., 1995
).
According to this concept at least two sorting steps would be needed:
different axonal membrane proteins first are segregated and packed into
different carriers, presumably at the level of the
trans-Golgi network. These carriers are then separated from those carriers destined for the somatodendritic domain and transported into the axon. Therefore, there might exist several different axonal
sorting signals, for the sorting into distinct carriers and for
subsequent axonal targeting. Interestingly, no conserved axonal sorting
signal has been described to date (Winckler and Mellman, 1999
).
The amyloid precursor protein (APP) is an ubiquitously expressed type I
transmembrane protein of unknown function. A small cleavage product of
APP, A
, is the principle constituent of the amyloid plaques in the
brains of Alzheimer's disease patients (for review, see Selkoe, 1999
).
In neurons, newly synthesized APP is targeted to the axon and
subsequently transcytosed to the somatodendritic domain (Simons
et al., 1995
; Yamazaki et al., 1995
). Radioactive
labeling studies suggested that APP is transported into the axon by
fast axonal transport (Koo et al., 1990
) dependent on
conventional kinesin (Amaratunga et al., 1993
; Ferreira
et al., 1993
; Buxbaum et al., 1998
). In the
amyloidogenic pathway, APP cleavage leads to the production of A
,
or, more abundantly, cleavage in the nonamyloidogenic pathway leads to
a soluble APP and a membrane-bound C-terminal fragment. Cleavage in the
amyloidogenic pathway is mediated by
- and
-secretase and in the
nonamyloidogenic pathway by
-secretase (summarized by Hardy, 1997
;
Selkoe, 1999
). Despite numerous efforts, the molecular identities of
the secretases have not yet been fully established. For a better
understanding of the mechanisms that govern APP processing in neurons,
it appears essential to precisely characterize the subcellular
localization of APP at any given stage of its short lifetime,
calculated to be 20-30 min, in PC12 cells and neurons (Weidemann
et al., 1989
; Storey et al., 1999
).
We therefore decided to follow the fate of newly synthesized APP
directly in living cultured hippocampal neurons and to characterize its
mode of transport. Hippocampal neurons have been used extensively as a
model system of transport and protein sorting (Craig and Banker, 1994
).
Moreover, the hippocampus is one of the predominantly affected regions
in Alzheimer's disease (Selkoe, 1999
). Therefore, hippocampal neuronal
cultures are a particularly useful and relevant system with which to
study APP trafficking and transport.
In the present study we expressed a fluorescent protein (FP)-tagged APP in hippocampal neurons and analyzed its transport by video microscopy. FP-tagged APP moves along axons in very fast-moving elongated tubules, which have not been described previously. We show by two-color video microscopy that these tubules are different from the transport carriers of another axonal membrane protein, synaptophysin (p38).
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies
For detection of APP we used monoclonal antibody 22C11 (Roche
Diagnostics, Mannheim, Germany); for detection of green fluorescent protein (GFP) we used a polyclonal antibody from Clontech Laboratories (Palo Alto, CA) and a polyclonal antibody raised against the C terminus
(D2; Wacker et al., 1997
), kindly provided by Dr. H.-H. Gerdes (Department of Neurobiology, University Heidelberg, Heidelberg, Germany). To stain dendrites we used a monoclonal anti-MAP2 antibody (Sigma, Deisenhofen, Germany).
Construction of Fusion Proteins
APP-Yellow Fluorescent Protein (YFP).
Standard
molecular cloning techniques were used throughout. YFP5 cDNA (Pepperkok
et al., 1999
) without the start codon was fused to the 3'end
of human APP695 cDNA omitting the stop codon. The introduction of the
restriction site, NotI, resulted in a linker sequence coding
for three alanines. YFP5 was amplified with PCR using primer
5'-GCGCGCGGCCGCGGGTAAAGGAGAAGAACTTTTC, introducing a
NotI site (underlined), and primer
5'-GCGCGGGCCCTAGAAGCTTTTGTATAGTTC, introducing
ApaI. The obtained fragment was subcloned using the TOPO-TA cloning kit (Invitrogen, Groningen, The Netherlands), and the
resulting plasmid, pCR-TOPO/YFP, was digested with NotI and
ApaI. The YFP fragment was purified and then subcloned in pcDNA3 (Invitrogen), yielding pcDNA3/YFP. APP was amplified from pSG5-hAPP695 (kindly provided by B. de Strooper, Center for Human Genetics, Leuven, Belgium) using primer
5'-GCGCGATATCG C C A C CATGCTGCCCGGTTTGGCACTGCTC,
introducing EcoRV (underlined) and a Kosak sequence
(dashed line), and primer
5'-GCGCGCGGCCGCGTTCTGCATCTGCTCAAAGAACTTG, introducing
NotI (underlined). The fragment was cloned in pCR-TOPO, digested with EcoRV and NotI, and subcloned in
pcDNA3/YFP to obtain pcDNA3/APP-YFP. Relevant parts including the
A
-domain, the transmembrane and cytoplasmic domains of APP, as well
as the transition site of the construct were sequenced.
p38-Enhanced GFP (EGFP) and p38-Enhanced Cyan Fluorescent Protein
(ECFP).
A plasmid encoding for a GFP-tagged p38 was constructed by
amplifying rat p38 cDNA (Leube et al., 1987
) using primer
5'-CTGCAAGCTTCGGACATGGACGTGGTG, introducing
HindIII (underlined) and primer
5'-GACCGTCGACCATCTGATTGGAGAAGG, introducing SalI
(underlined) and replacing the stop codon with a valine codon. The
purified fragment was HindIII and SalI digested and cloned in pEGFP-N3 (Clontech). The construct was sequenced, and a
point mutation was found, changing codon 185 from C to R, apparently
without observable effects, because a construct with a reversed
mutation behaved very similar (our unpublished results). Moreover, the
dynamics are very similar to another p38-GFP construct (Nakata et
al., 1998
).
Cell Culture and Transient Transfection
Cultures of embryonic day 18 rat embryonic hippocampal neurons
were prepared as described (de Hoop et al., 1998
). Neurons were transfected at days 6-8 in vitro, corresponding to stage 4 neurons (Dotti et al., 1988
). For transfection, a calcium
phosphate precipitation protocol was used (Köhrmann et
al., 1999
). Neurons grown on 15-mm coverslips were transferred to
3.5-cm dishes containing 2 ml of conditioned medium. Alternatively, the
medium of neurons grown on
poly-L-lysine-coated 3.5-cm dishes was
replaced with conditioned medium. Two to 3 µg of endotoxin-free
(EndoFree Maxi Prep; Qiagen, Hilden, Germany) plasmid DNA were
dissolved in 60 µl of 250 mM CaCl2. A 2×
concentration of BBS (280 mM NaCl, 1.5 mM
Na2HPO4, and 50 mM
N,N-bis[2-hydroxyethyl]-2-aminoethanesulfonic acid, pH
7.05) was added slowly, and the precipitate was allowed to form for 1 min. This solution was added to the cells, and the dishes were
incubated for 1-2 h at 37°C and 2.5% CO2.
Cells were then washed twice in HBS (135 mM NaCl, 20 mM HEPES, 4 mM
KCl, 1 mM Na2HPO4, 2 mM
CaCl2, 1 mM MgCl, and 10 mM glucose, pH 7.05) before the original growth medium was added. Double transfections were
done by preparing the transfection mix with the two plasmids, each at
the concentration used for single transfections. Analysis of
transfected cells was performed 24-28 h after the transfection. Typically 1-20% of neurons were transfected. Some neurons expressed very high amounts of exogenous proteins resulting in uniform green fluorescence. For microscopy only neurons that showed punctate fluorescence and no beading along neurites were chosen.
Immunodetection
Immunofluorescence was performed as described (Wacker et
al., 1997
). We found that APP-YFP fluorescence was not preserved after fixation in 4% paraformaldehyde. For
immunoblotting, neurons were grown on 3.5-cm dishes
covered with a sterile coverslip. After transfection, 2 mM sodium
butyrate was added to the medium (Stowell and Craig, 1999
). Sixteen to
20 h after transfection, media of three dishes were pooled, and
proteins were precipitated by adding 4 vol of acetone in the presence
of BSA as a carrier. After 2 h at
20°C, samples were
centrifuged, and the pellet was air dried and dissolved in running
buffer. Corresponding cells were lysed in 0.1% SDS and
methanol-chloroform extracted (Wessel and Flügge, 1984
). Lysates
and media were run on a 10% minigel (Bio-Rad, Hercules, CA) and
blotted onto nitrocellulose. Western blotting was performed as
described previously (Wacker et al., 1997
).
Rhodamine-Dextran Uptake
Endocytic organelles were labeled by incubation of neurons for 1-2 h in conditioned medium supplemented with 1 mg/ml rhodamine-dextran (Rh-dextran), molecular weight 70,000 (Sigma). Before microscopy, cells were washed in HBS and conditioned medium.
Antisense Treatment
Antisense experiments were done as previously described by
Ferreira et al. (1992)
. Oligonucleotides used were
GCCGGGTCCGCCATCTTTCTGGCAG, the inverse complement of the rat
nucleotides
11 to + 14 of conventional kinesin heavy chain (KHC), and
CTGCCAGAAAGATGGCGGACCCGGC, the corresponding sense oligonucleotide
(Ferreira et al., 1992
). Five to 6 h later transfection
oligos were added at a concentration of 0.5 µM. Twelve hours later
oligos were added at a concentration of 0.25 µM. Video microscopy was
performed 26-28 h after transfection. Treating cells with oligos at 50 µM (Ferreira et al., 1992
) led to similar results, except
that even more structures changed direction of movement (our
unpublished results).
Microscopy
Fixed cells were analyzed on a Zeiss (Thornwood, NY) Axiovert microscope equipped with a 40 or 63× objective using standard FITC and rhodamine filters. Images were collected with a Cohu (San Diego, CA) camera controlled by NIH Image software, combined, and processed using Photoshop (Adobe Systems, Mountain View, CA). Staining in neurites was selectively enhanced over cell bodies.
For live cell imaging of transfected neurons, coverslips were
transferred to aluminum slides (Bradke and Dotti, 1997
). Two video
microscopy setups were used. Initial experiments and antisense experiments were performed on a Zeiss Axiovert microscope with an
37°C-heated, 63×, numerical aperture 1.4 objective, a standard FITC
filter (BP485, FT510, LP520; Zeiss), a Blitz Optilas (Puchheim, Germany) shutter, a Cohu camera, and NIH image software (Bradke and
Dotti, 1997
). Time-lapse series for velocity determination as well as
analysis of double transfected neurons were done on a Leica (Nussloch,
Germany) DM IRBE equipped with a custom-made Plexiglas box for
air heating to 37°C, a 63× objective, a Hamamatsu C 4742 camera
(Hamamatsu Photonics, Herrsching, Germany), and OpenLab software
(Improvision, Boston, MA; Toomre et al., 1999
). To image YFP
and CFP separately, appropriate filter blocks were used (AHF
Analysentechnik, Tübingen, Germany). Excitation light was
attenuated with gray filters. Typically, time-lapse series were taken
without delay at exposure times between 300 and 800 ms per frame.
Tubular appearance attributable to movement during exposure time could
account only for a maximal length of 5 µm (calculated for 1-s
exposure time; average velocity, 5 µm/s), not for the 10-µm tubules
observed frequently with exposure times down to 300 ms. For dual-color
imaging the following setups were used. YFP and CFP were excited
separately with filters (AHF) on a filter wheel. For emission, a
custom-made dual beam splitter was used (AHF, blocking at 390/22,
436/10, and 515/10-15 nm). Exposure time for CFP was 110 ms and
for YFP was 1 s. GFP and Rh-dextran were excited with filters for
FITC and TRITC, respectively, and the emission was recorded using a
dual beam splitter for FITC and TRITC. Exposure times were 1 s for
GFP and 700 ms for Rh-dextran. Twenty pairs of images were recorded in
60 s. Neurons were very sensitive to CFP excitation; therefore,
only series of up to 20 images could be recorded before movement of all
organelles stopped.
Tracking
For particle tracking an NIH Image-based manual macro written by J. Rietdorf (European Molecular Biology Laboratory) was used. Stacks of time-lapse sequences were analyzed for movement of fluorescent structures. Only structures moving over more than three frames were evaluated. The pixel size was determined using a stage micrometer (Graticules, Tonbridge, United Kingdom), and the actual time the system needed for recording of a time-lapse series was measured. This allowed the time between subsequent frames and the distance that a tracked structure moved to be calculated. From the data, the maximal and average velocity and the displacement of fluorescent structures were calculated.
| |
RESULTS |
|---|
|
|
|---|
Construction of GFP Fusion Proteins
The aim of our study was to analyze the trafficking of APP in
living neurons and compare it with the trafficking of another axonal
membrane protein, the synaptic vesicle protein p38. Therefore, we
tagged the human APP695 at the C terminus with a spectral variant of
GFP, YFP5 (Pepperkok et al., 1999
). Two other fusion
proteins, consisting of p38 and EGFP (p38-EGFP) and p38 and another
spectral GFP variant, ECFP (p38-ECFP), were constructed. The YFP/CFP
mutants were chosen to allow simultaneous visualization of two
different proteins in a single cell (Ellenberg et al.,
1999
). The fusion proteins are schematized in Figure
1.
|
FP-tagged Fusion Proteins Are Expressed as Full-Length Proteins and Sorted to Axons in Hippocampal Neurons
Before analyzing the transport of the fusion proteins by video
microscopy, we ensured that the proteins were expressed as full-length
proteins and that they were correctly localized. This was especially
important in the case of APP-YFP, because the APP is subject to a
variety of potential proteolytic cleavages. For example, extensive
intracellular
- or
-secretase cleavage would generate an
FP-tagged cytoplasmic tail and transmembrane domain of APP
indistinguishable from intact protein by fluorescent microscopy. To
check for full-length expression, hippocampal neurons were transfected
with APP-YFP cDNA and analyzed by Western blot. Using a GFP-specific
antibody, a prominent band with the size of the fusion protein (130 kDa) was detected in cell lysates of transfected cells (Figure
2A, left). As expected for a
transmembrane protein, no signal was detected in the medium. Only a
minor degradation product is visible in the cell lysate of transfected
neurons (Figure 2A, arrow). To substantiate this finding, the blot was
stripped and reprobed with an APP-specific antibody (Figure 2A, right). The antibody detected full-length APP-YFP as well as endogenous rat
APP. If a significant amount of APP-YFP would be cleaved by
-secretase, one would expect more of the soluble APP fragment in the
medium of transfected cells compared with control cells. This is not
the case (Figure 2A, right). Similarly, cell lysates of neurons
transfected with p38-EGFP cDNA show only the full-length fusion protein
when probed with an antibody against GFP (Figure 2B). The minor lower
band reflects unspecific cross-reaction of the antibody (Figure 2B,
asterisk).
|
Because we wanted to study axonal transport, we next analyzed whether
the fusion proteins would be sorted to axons after transient transfection. Therefore, neurons cultured for 6-9 d were transfected with APP-YFP and p38-EGFP cDNA, respectively, and subjected to immunofluorescence using antibodies against GFP and MAP2, a marker for
dendrites. Microscopic analysis of both constructs showed that they
were sorted to axons as expected (Figure
3). In addition, a somatodendritic
staining was observed for both constructs. This has been found for a
variety of exogenously expressed axonal and apical proteins and could
be due to saturation of the axonal sorting machinery (reviewed by
Winckler and Mellman, 1999
). In the case of APP-YFP a somatodendritic
localization of at least some of the protein could be due to
transcytosis from the axon (Simons et al., 1995
; Yamazaki
et al., 1995
).
|
Taken together, these data suggest that APP-YFP and p38-EGFP are useful markers to study axonal transport in living hippocampal neurons.
APP-YFP Is Transported along Axons in Elongated, Fast-moving Tubules
To visualize the transport of APP-YFP in the axons of living
hippocampal neurons, we transfected cells with APP-YFP cDNA and analyzed the transport at 37°C by video microscopy. Typically, 24 h after transfection, expression of exogenous proteins could be
observed in 1-20% of neurons. Transfected cells that appeared healthy
by phase-contrast and GFP fluorescence were imaged by video microscopy.
Figure 4 (video) shows six consecutive
frames (0.9 s apart) of a time-lapse sequence collected from axons of transfected neurons. Long tubular structures were moving along the
axons, mainly anterogradely (Figure 4, arrows) but occasionally retrogradely (Figure 4, arrowheads). In addition to the moving tubules,
stationary or slow moving vesicles were present (Figure 4, asterisk).
The tubular appearance of the transport carriers was not due to an
artifact created by the movement of a structure during exposure time
(see MATERIALS AND METHODS) or due to overexpression, because tubules
were observed also in neurons expressing very low amounts of APP-YFP.
The tubules were of variable length and could be as long as 10 µm.
The length of a tubule was not correlated to its speed. Occasionally a
tubule could be seen to stop, without losing the tubular appearance,
then eventually shrinking to a vesicle before elongating again and
resuming movement (our unpublished results). The tubules are not
mitochondria, which also show a tubular appearance in axons (Morris and
Hollenbeck, 1995
), as shown by staining with rhodamine 123 (our
unpublished results). Only in very few cases did the APP-YFP tubules
change direction; in many cases they transversed the field of view
without stopping.
|
To quantitate these movements, axonal transport in a number of transfected neurons was recorded. Evaluation of 8 cells from three different experiments showed that of 156 clearly discernible structures 32% (50 particles, all vesicular) did not move or only moved over a short distance (<3 µm). Forty-eight percent (75) moved anterogradely over long distances, 97.3% (73) of which were long tubules and 2.7% (2) of which were vesicular. The remaining 20% (31) were moving retrogradely, 71% (22) of which were tubular, the others vesicular.
We next tracked all structures moving >3 µm and calculated their velocity. APP-YFP-containing transport carriers were moving anterogradely at an average velocity of 4.5 ± 1.5 µm/s with maximal velocities of up to 9 µm/s. Retrogradely APP-YFP-containing structures moved slower, on average 2.9 ± 1 µm/s. Transport carriers could be followed on average for 53 µm before leaving the field of view or plane of focus or, rarely observed, stopping.
p38-EGFP Is Transported in Different Carriers
Are other axonal membrane proteins also transported in elongated
tubules? To test this, neurons were transfected with p38-EGFP cDNA and
analyzed by video microscopy (Figure 5,
video). Fluorescent vesicles could be observed along the axons of
transfected cells. They showed two types of movement: bright
fluorescent vesicles without movement or moving over short distances
(Figure 5, arrowheads) and tubulovesicular structures, often less
bright, moving either anterogradely or retrogradely (Figure 5, arrows).
The overall appearance, however, was strikingly different compared with
the movement of APP-YFP carriers. No tubules or only short ones could be observed, and carriers rarely moved over long distances (Figure 5).
The dynamics of p38-EGFP-labeled organelles are reminiscent of those
of recycling endosomes recently described by Prekeris et
al., (1999)
. We therefore tested to what extent the
p38-EGFP-containing organelles could be labeled with an endosomal
marker. To this end, we labeled p38-EGFP-transfected neurons with
Rh-dextran and analyzed them by two-color video microscopy (Figure
6). Moving p38-EGFP-labeled
tubulovesicular structures were not costained with the endosomal
marker, suggesting that they are transport vesicles rather than
endosomes (Figure 6, arrowheads). Moving Rh-dextran-labeled organelles
were often devoid of p38-EGFP staining (Figure 6, arrows). However, we
sometimes observed moving structures containing both p38-EGFP and
Rh-dextran (our unpublished results). In addition to the moving
organelles, many immobile short tubulovesicular organelles containing
both markers were observed (Figure 6, asterisks). Taken together, these
data suggest that the organelles labeled by p38-EGFP are a mixture of
endocytic and exocytic vesicles.
|
|
To quantify the movement of p38-EGFP fluorescent transport
carriers, time-lapse microscopy of transfected neurons was analyzed as
for APP-YFP. From eight cells from three independent experiments, 165 clearly discernable fluorescent carriers were tracked. Fifty-six percent (92) of p38-EGFP-containing carriers were not moving or showed
brownian motion. These most likely corresponded to organelles of
endocytic origin. Forty-four percent (73) showed movement over >3
µm, without directional bias. The average velocity of anterogradely moving carriers was 0.9 ± 0.9 µm/s, more than four times slower than APP-YFP-containing carriers. Retrogradely moving carriers were
slightly faster, on average 1.2 ± 1.2 µm/s. p38-EGFP moving structures could be tracked on average only 6.6 µm, eight times shorter than APP-YFP-containing tubules. A comparable p38-GFP has been
shown to move in a similar manner in dorsal root ganglion neurons (Nakata et al., 1998
). Because all p38-EGFP-labeled
organelles, endosomes and transport vesicles, move with dynamics
strikingly different from those labeled with APP-YFP, these data
suggest that the two proteins are transported in different carriers. A velocity profile of APP-YFP- and p38-EGFP-containing carriers is
shown in Figure 7, and the findings are
summarized in Table 1.
|
|
In Doubly Transfected Neurons, APP-YFP and p38-ECFP Are Transported in Different Carriers
APP-YFP and p38-EGFP transport carriers move in a strikingly
different manner along axons, suggesting that they are sorted to
different transport carriers. To directly analyze the sorting and
differential transport of the two proteins in single axons, we
cotransfected neurons with both APP-YFP and p38-ECFP cDNAs. Most
transfected cells expressed both exogenous proteins, however, often in
differing amounts. Neurons expressing approximately similar amounts of
both proteins were chosen and analyzed by two-color video microscopy
(Figure 8). When frames of either the YFP
or CFP channel were displayed separately, they looked identical to the
single transfected neurons: APP-YFP moving in long tubules (Figure 8A,
left, video), p38-ECFP moving slower and in vesicular structures
(Figure 8A, middle, video). Display of the merged frames shows the
different movement of the two proteins along the same axon (Figure 8A,
right, video). The long tubules transporting APP-YFP did not contain
p38-ECFP (Figure 8B, arrows). Conversely, moving p38-ECFP-containing
structures did not appear to have APP-YFP (Figure 8B, triangle).
Occasionally, slow or nonmoving structures containing both proteins
were seen, which are possibly endosomes or multivesicular bodies
(Figure 8B, arrowheads), because slow-moving, nontubular APP-YFP
carriers can be labeled with Rh-transferrin (our unpublished results).
|
Taken together these data suggest that FP-tagged APP and p38 are sorted to and transported in carriers that differ in their morphology, their velocity, and their displacement. This implies that these carriers have a different molecular composition and are transported by the action of different motor proteins.
APP-YFP Transport Is Kinesin Dependent
Treatment of hippocampal neurons with antisense oligonucleotides
against KHC and subsequent immunofluorescence suggested a role for
kinesin in the fast axonal transport of APP (Ferreira et
al., 1993
; Yamazaki et al., 1995
). To test the effect
of kinesin on the transport of the APP-YFP tubules described here, we
treated transfected neurons with KHC antisense or sense
oligonucleotides. The transport of APP-YFP was then analyzed by video
microscopy (Figure 9, video). In
transfected neurons treated with sense oligonucleotides, the previously
observed pattern of movement was observed: tubules moving over long
distances and almost never changing their direction during recording of
30-70 frames (Figure 9, left, the track display of one structure is
shown). In contrast, APP-YFP tubules showed a different type of
movement when neurons were treated with antisense oligonucleotides: The
shape of the tubules was unchanged, but their velocity was reduced. In
addition, many of the observed moving structures changed their
direction of movement several times (exemplified in Figure 9, right,
where the tubule changed direction four times). Quantitation of 28 cells from four experiments showed that the velocity of APP-YFP tubules
in antisense-treated neurons was on average reduced to 60% of the
control velocity, and that 19 of 66 (29%) of the observed tubules
changed their direction at least once, compared with 3% in control
neurons. Interestingly, both anterograde and retrograde transport were affected, similar to observations in squid axons (Brady et
al., 1990
). These data demonstrate that the transport of APP-YFP
tubules is microtubule and kinesin dependent.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study we show that a fluorescently tagged APP, APP-YFP, is transported in extended, very fast-moving tubules along axons of cultured hippocampal neurons. In contrast, another axonal protein, p38, is sorted to and transported in different structures when expressed as an FP-tagged fusion protein. The two transport carriers were shown to be different by video microscopy and object tracking. Major differences were 1) morphology; whereas APP-YFP was transported in fast-moving tubules of up to 10 µm length, p38-EGFP was transported in tubulovesicular carriers; 2) velocity; APP-YFP tubules moved on average 4.5 µm/s, more than fourfold faster than structures containing p38-EGFP; and 3) mutual exclusion; fast-moving APP-YFP tubules contained no p38-ECFP when coexpressed in the same neuron and analyzed by two-color video microscopy.
The elongated, fast-moving tubules represent a previously
undescribed type of transport carrier for membrane proteins. Shorter and slower moving tubulovesicular post-Golgi structures have been described in neurons (Nakata et al., 1998
) and unpolarized
cells (Hirschberg et al., 1998
; Toomre et al.,
1999
). Axonal transport in different systems was reported to be between
1 and 3 µm/s on average, sometimes with maximal velocities of up to 5 µm/s (Allen et al., 1982
; Kreis et al., 1989
;
Bloom et al., 1993
; Lochner et al., 1998
; Nakata
et al., 1998
; Zakharenko and Popov, 1998
; Bridgman, 1999
).
The velocity measured for APP-YFP in our system is in the range of the
fast component of fast axonal transport in mammals in vivo, which has
been calculated to have a velocity of 410 mm/d (Ochs, 1972
),
corresponding to 4.7 µm/s.
The concept of separate transport carriers for subclasses of axonal
membrane proteins has been proposed by Hirokawa et al. (1998)
. We confirm this concept by comparing the transport
characteristics of two axonal membrane proteins and the direct
observation of their differential transport in a single hippocampal
neuron. To our knowledge this is the first report in which this sorting
and transport of two axonal proteins is visualized simultaneously. The
observed difference in velocities between the two types of carriers in
the same neuron is consistent with the idea that the transport is
mediated by different motor proteins (Hirokawa, 1998
).
Why Is There No Bias in the Transport of p38-EGFP?
In steady state, p38-EGFP is distributed along the axon.
Therefore, a net anterograde transport of newly synthesized protein would be expected, which is not observed in our system. Because both
endosomes and transport carriers show movement in both directions (Nakata et al., 1998
; Prekeris et al., 1999
), and
because p38-EGFP is present in both types of organelles (Nakata
et al., 1998
; this study), it is possible that a net
anterograde movement of p38-EGFP transport vesicles is masked.
Therefore, even a slight net anterograde movement that is not
detectable in our system could still account for the distribution of
p38-EGFP-labeled organelles along the axon, because there is
sufficient time for equilibration between transfection and microscopy.
What Defines the Structure of the APP-YFP Tubules?
The axon is packed with cytoskeletal elements, transport carriers
moving in both directions, mitochondria, and other organelles. Elongation of big vesicles might be a consequence of dragging this
vesicle through a dense network. Indeed, mitochondria in axons are also
very thin and elongated (Morris and Hollenbeck, 1995
). Moreover, we
occasionally observed APP-YFP tubules that rounded up shortly after
stopping (our unpublished results). APP-YFP-containing carriers could
be bigger than those containing p38-EGFP; therefore, they could be more
subjected to mechanical stress and be forced into a tubular shape.
Alternatively, the two carriers could be of different rigidity because
of differences in lipid and protein composition, therefore responding
differently to the mechanical forces they encounter when
squeezed through the dense axonal cytoplasm. When the GFP fusion
proteins were expressed in COS cells, we could detect tubules only in
the APP-YFP-transfected cells, not in p38-EGFP-transfected cells (our
unpublished results). This suggests that also in unpolarized cells they
are sorted into distinct carriers that differ in their composition.
How Is the Velocity Accomplished?
It has been suggested that in axons the size of an organelle
determines its velocity, smaller objects moving faster than bigger ones
(Vale et al., 1985b
). In our case we observed the opposite: long tubules containing APP-YFP moved much faster than the smaller tubulovesicular structures containing p38-EGFP. The fast movement might
reflect a joint effort of the molecular motors that are attached to the
tubules, leading to a higher velocity, as would be the case for single
or few motors only. The fact that many motors are attached to a tubule
might also explain why the movement is smooth and continuous over long
distances, in contrast to the typical saltatory movement observed for
axonal transport.
Reducing kinesin expression disturbs the transport of APP-YFP carriers.
Upon reduction of kinesin, a lower velocity as well as a frequent
change of direction were observed. Studies using squid axonal vesicles
suggested that there are plus end- as well as minus end-directed motor
proteins present and that the ratio between the two determines the
direction of movement (Muresan et al., 1996
). A similar
scenario could be envisioned for mammalian neurons: on
APP-YFP-containing tubules both plus end- and minus end-directed
motors are present; however, kinesin is dominating. This leads to
long-distance movement in one direction only. Treatment of neurons with
kinesin antisense oligonucleotides would interfere with this ratio,
driving it to a more equilibrated state. This would lead to the
frequent change of direction observed in antisense treated neurons. It
would be interesting to test the effects of the antisense treatment on
the transport of p38-EGFP. However, because of the small-distance
movement and the low velocities of p38-EGFP-containing structures, no
significant effect was measured using our setup (C. Kaether and C.G.
Dotti, unpublished results). Faster image acquisition together with
higher sensitivity would be needed to study this process.
Implications on APP Processing
Of principal interest in Alzheimer's disease research is to
determine the subcellular localization of APP processing and hence the
localization of the different secretases. Precise kinetic studies on
A
production in neurons are lacking. These are complicated by the
fact that they are highly polarized: processing in intracellular organelles could take place in the soma, in the dendrites, or in the
axon, or processing could take place at the plasma membranes of one or
more of these domains. Our studies help provide tools for a detailed
analysis of APP processing in neurons: correlation of the transport
kinetics using APP-YFP and video microscopy together with pulse-chase
labeling to monitor the processing state could help provide information
about the subcellular identity of the cleavage compartment in neurons.
| |
ACKNOWLEDGMENTS |
|---|
We thank B. Hellias for preparing hippocampal cultures, H.-H. Gerdes for kindly providing antiserum D2, B. de Strooper for APP695 cDNA, R. Pepperkok for YFP5 cDNA, and J. Rietdorf for writing the tracking macro. We also thank M. Hannah, M. Kiebler, D. Toomre, F. Ruberti, and E. Piddini for critically reading the manuscript. C.K. is a recipient of a fellowship from the Fritz-Thyssen-Stiftung.
| |
FOOTNOTES |
|---|
Online version of this article contains video material
for Figures 4, 5, 8, and 9. Online version available at
www.molbiolcell.org.
Corresponding author. E-mail address:
dotti{at}embl-heidelberg.de.
| |
ABBREVIATIONS |
|---|
Abbreviations used: APP, amyloid precursor protein; ECFP, enhanced cyan fluorescent protein; EGFP, enhanced GFP; FP, fluorescent protein; GFP, green fluorescent protein; KHC, kinesin heavy chain; KIF, kinesin superfamily protein; p38, synaptophysin; Rh-dextran, rhodamine-dextran; YFP, yellow fluorescent protein.
| |
REFERENCES |
|---|
|
|
|---|
-amyloid precursor protein: retrograde and transcytotic transport in cultured neurons.
J. Cell Biol.
129, 431-442This article has been cited by other articles:
![]() |
T. L. Falzone, G. B. Stokin, C. Lillo, E. M. Rodrigues, E. L. Westerman, D. S. Williams, and L. S. B. Goldstein Axonal Stress Kinase Activation and Tau Misbehavior Induced by Kinesin-1 Transport Defects J. Neurosci., May 6, 2009; 29(18): 5758 - 5767. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-S. Hoe, Z. Fu, A. Makarova, J.-Y. Lee, C. Lu, L. Feng, A. Pajoohesh-Ganji, Y. Matsuoka, B. T. Hyman, M. D. Ehlers, et al. The Effects of Amyloid Precursor Protein on Postsynaptic Composition and Activity J. Biol. Chem., March 27, 2009; 284(13): 8495 - 8506. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Muresan, N. H. Varvel, B. T. Lamb, and Z. Muresan The Cleavage Products of Amyloid-{beta} Precursor Protein Are Sorted to Distinct Carrier Vesicles That Are Independently Transported within Neurites J. Neurosci., March 18, 2009; 29(11): 3565 - 3578. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-S. Her and L. S. B. Goldstein Enhanced Sensitivity of Striatal Neurons to Axonal Transport Defects Induced by Mutant Huntingtin J. Neurosci., December 10, 2008; 28(50): 13662 - 13672. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Kelsch, C.-W. Lin, and C. Lois Sequential development of synapses in dendritic domains during adult neurogenesis PNAS, October 28, 2008; 105(43): 16803 - 16808. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Roy, M. J. Winton, M. M. Black, J. Q. Trojanowski, and V. M.-Y. Lee Cytoskeletal Requirements in Axonal Transport of Slow Component-b J. Neurosci., May 14, 2008; 28(20): 5248 - 5256. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. I. Muller, S. Klumpp, and R. Lipowsky Tug-of-war as a cooperative mechanism for bidirectional cargo transport by molecular motors PNAS, March 25, 2008; 105(12): 4609 - 4614. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Shrivastava-Ranjan, V. Faundez, G. Fang, H. Rees, J. J. Lah, A. I. Levey, and R. A. Kahn Mint3/X11{gamma} Is an ADP-Ribosylation Factor-dependent Adaptor that Regulates the Traffic of the Alzheimer's Precursor Protein from the Trans-Golgi Network Mol. Biol. Cell, January 1, 2008; 19(1): 51 - 64. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. De Vos, A. L. Chapman, M. E. Tennant, C. Manser, E. L. Tudor, K.-F. Lau, J. Brownlees, S. Ackerley, P. J. Shaw, D. M. McLoughlin, et al. Familial amyotrophic lateral sclerosis-linked SOD1 mutants perturb fast axonal transport to reduce axonal mitochondria content Hum. Mol. Genet., November 15, 2007; 16(22): 2720 - 2728. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Muresan and V. Muresan The Amyloid-beta Precursor Protein Is Phosphorylated via Distinct Pathways during Differentiation, Mitosis, Stress, and Degeneration Mol. Biol. Cell, October 1, 2007; 18(10): 3835 - 3844. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Haghnia, V. Cavalli, S. B. Shah, K. Schimmelpfeng, R. Brusch, G. Yang, C. Herrera, A. Pilling, and L. S.B. Goldstein Dynactin Is Required for Coordinated Bidirectional Motility, but Not for Dynein Membrane Attachment Mol. Biol. Cell, June 1, 2007; 18(6): 2081 - 2089. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Goldsbury, E. Thies, S. Konzack, and E.-M. Mandelkow Quantification of Amyloid Precursor Protein and Tau for the Study of Axonal Traffic Pathways J. Neurosci., March 28, 2007; 27(13): 3357 - 3363. [Full Text] [PDF] |
||||
![]() |
S. Roy, M. J. Winton, M. M. Black, J. Q. Trojanowski, and V. M.-Y. Lee Rapid and Intermittent Cotransport of Slow Component-b Proteins J. Neurosci., March 21, 2007; 27(12): 3131 - 3138. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Sabo, R. A. Gomes, and A. K. McAllister Formation of Presynaptic Terminals at Predefined Sites along Axons. J. Neurosci., October 18, 2006; 26(42): 10813 - 10825. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Konecna, R. Frischknecht, J. Kinter, A. Ludwig, M. Steuble, V. Meskenaite, M. Indermuhle, M. Engel, C. Cen, J.-M. Mateos, et al. Calsyntenin-1 Docks Vesicular Cargo to Kinesin-1 Mol. Biol. Cell, August 1, 2006; 17(8): 3651 - 3663. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Ruthazer, J. Li, and H. T. Cline Stabilization of axon branch dynamics by synaptic maturation. J. Neurosci., March 29, 2006; 26(13): 3594 - 3603. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Meyer and S. J Smith Evidence from in vivo imaging that synaptogenesis guides the growth and branching of axonal arbors by two distinct mechanisms. J. Neurosci., March 29, 2006; 26(13): 3604 - 3614. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. McGuire, J. Rong, S.-H. Li, and X.-J. Li Interaction of Huntingtin-associated Protein-1 with Kinesin Light Chain: IMPLICATIONS IN INTRACELLULAR TRAFFICKING IN NEURONS J. Biol. Chem., February 10, 2006; 281(6): 3552 - 3559. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Alfalah, G. Wetzel, I. Fischer, R. Busche, E. E. Sterchi, K.-P. Zimmer, H.-P. Sallmann, and H. Y. Naim A Novel Type of Detergent-resistant Membranes May Contribute to an Early Protein Sorting Event in Epithelial Cells J. Biol. Chem., December 30, 2005; 280(52): 42636 - 42643. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Muresan and V. Muresan Coordinated transport of phosphorylated amyloid-{beta} precursor protein and c-Jun NH2-terminal kinase-interacting protein-1 J. Cell Biol., November 21, 2005; 171(4): 615 - 625. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Utton, W. J. Noble, J. E. Hill, B. H. Anderton, and D. P. Hanger Molecular motors implicated in the axonal transport of tau and {alpha}-synuclein J. Cell Sci., October 15, 2005; 118(20): 4645 - 4654. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Giau, J. Carrette, J. Bockaert, and V. Homburger Constitutive Secretion of Protease Nexin-1 by Glial Cells and Its Regulation by G-Protein-Coupled Receptors J. Neurosci., September 28, 2005; 25(39): 8995 - 9004. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kural, H. Kim, S. Syed, G. Goshima, V. I. Gelfand, and P. R. Selvin Kinesin and Dynein Move a Peroxisome in Vivo: A Tug-of-War or Coordinated Movement? Science, June 3, 2005; 308(5727): 1469 - 1472. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Lazarov, G. A. Morfini, E. B. Lee, M. H. Farah, A. Szodorai, S. R. DeBoer, V. E. Koliatsos, S. Kins, V. M.-Y. Lee, P. C. Wong, et al. Axonal Transport, Amyloid Precursor Protein, Kinesin-1, and the Processing Apparatus: Revisited J. Neurosci., March 2, 2005; 25(9): 2386 - 2395. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stagi, P. S. Dittrich, N. Frank, A. I. Iliev, P. Schwille, and H. Neumann Breakdown of Axonal Synaptic Vesicle Precursor Transport by Microglial Nitric Oxide J. Neurosci., January 12, 2005; 25(2): 352 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Smith, L. Pomeranz, S. P. Gross, and L. W. Enquist Local modulation of plus-end transport targets herpesvirus entry and egress in sensory axons PNAS, November 9, 2004; 101(45): 16034 - 16039. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rosso, F. Bollati, M. Bisbal, D. Peretti, T. Sumi, T. Nakamura, S. Quiroga, A. Ferreira, and A. Caceres LIMK1 Regulates Golgi Dynamics, Traffic of Golgi-derived Vesicles, and Process Extension in Primary Cultured Neurons Mol. Biol. Cell, July 1, 2004; 15(7): 3433 - 3449. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kanaani, M. J. Diacovo, A. E.-D. El-Husseini, D. S. Bredt, and S. Baekkeskov Palmitoylation controls trafficking of GAD65 from Golgi membranes to axon-specific endosomes and a Rab5a-dependent pathway to presynaptic clusters J. Cell Sci., April 15, 2004; 117(10): 2001 - 2013. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. V. Berghe, G. W. Hennig, and T. K. Smith Characteristics of intermittent mitochondrial transport in guinea pig enteric nerve fibers Am J Physiol Gastrointest Liver Physiol, April 1, 2004; 286(4): G671 - G682. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Muresan and V. Muresan A phosphorylated, carboxy-terminal fragment of {beta}-amyloid precursor protein localizes to the splicing factor compartment Hum. Mol. Genet., March 1, 2004; 13(5): 475 - 488. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Bannai, T. Inoue, T. Nakayama, M. Hattori, and K. Mikoshiba Kinesin dependent, rapid, bi-directional transport of ER sub-compartment in dendrites of hippocampal neurons J. Cell Sci., January 15, 2004; 117(2): 163 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pennuto, D. Bonanomi, F. Benfenati, and F. Valtorta Synaptophysin I Controls the Targeting of VAMP2/Synaptobrevin II to Synaptic Vesicles Mol. Biol. Cell, December 1, 2003; 14(12): 4909 - 4919. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakata and N. Hirokawa Microtubules provide directional cues for polarized axonal transport through interaction with kinesin motor head J. Cell Biol., September 15, 2003; 162(6): 1045 - 1055. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Hoekstra, O. Maier, J. M. van der Wouden, T. A. Slimane, and S. C. D. van IJzendoorn Membrane dynamics and cell polarity: the role of sphingolipids J. Lipid Res., May 1, 2003; 44(5): 869 - 877. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brown Axonal transport of membranous and nonmembranous cargoes: a unified perspective J. Cell Biol., March 17, 2003; 160(6): 817 - 821. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jullien, V. Guili, E. A. Derrington, J.-L. Darlix, L. F. Reichardt, and B. B. Rudkin Trafficking of TrkA-Green Fluorescent Protein Chimerae during Nerve Growth Factor-induced Differentiation J. Biol. Chem., February 28, 2003; 278(10): 8706 - 8716. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-R. Lee, H. Shin, J. Ko, J. Choi, H. Lee, and E. Kim Characterization of the Movement of the Kinesin Motor KIF1A in Living Cultured Neurons J. Biol. Chem., January 17, 2003; 278(4): 2624 - 2629. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Lazarov, M. Lee, D. A. Peterson, and S. S. Sisodia Evidence That Synaptically Released beta -Amyloid Accumulates as Extracellular Deposits in the Hippocampus of Transgenic Mice J. Neurosci., November 15, 2002; 22(22): 9785 - 9793. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Stamer, R. Vogel, E. Thies, E. Mandelkow, and E.-M. Mandelkow Tau blocks traffic of organelles, neurofilaments, and APP vesicles in neurons and enhances oxidative stress J. Cell Biol., March 18, 2002; 156(6): 1051 - 1063. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Scalettar, P. Rosa, E. Taverna, M. Francolini, T. Tsuboi, S. Terakawa, S. Koizumi, J. Roder, and A. Jeromin Neuronal calcium sensor-1 binds to regulated secretory organelles and functions in basal and stimulated exocytosis in PC12 cells J. Cell Sci., January 6, 2002; 115(11): 2399 - 2412. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Rodriguez, E. Piddini, T. Hasegawa, T. Miyagi, and C. G. Dotti Plasma Membrane Ganglioside Sialidase Regulates Axonal Growth and Regeneration in Hippocampal Neurons in Culture J. Neurosci., November 1, 2001; 21(21): 8387 - 8395. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, F. W. Herberg, M. M. Laue, C. Wullner, B. Hu, E. Petrasch-Parwez, and M. W. Kilimann Neurobeachin: A Protein Kinase A-Anchoring, beige/Chediak-Higashi Protein Homolog Implicated in Neuronal Membrane Traffic J. Neurosci., December 1, 2000; 20(23): 8551 - 8565. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Ruberti and C. G. Dotti Involvement of the Proximal C Terminus of the AMPA Receptor Subunit GluR1 in Dendritic Sorting J. Neurosci., June 1, 2000; 20(11): RC78 - RC78. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lalli and G. Schiavo Analysis of retrograde transport in motor neurons reveals common endocytic carriers for tetanus toxin and neurotrophin receptor p75NTR J. Cell Biol., January 21, 2002; 156(2): 233 - 240. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||