![]() |
|
|
Vol. 11, Issue 4, 1293-1304, April 2000



*Department of Embryology, Howard Hughes Medical Institute,
Carnegie Institution of Washington, Baltimore, Maryland 21210;
and
Department of Pharmacology and Department of Cellular
and Molecular Medicine, University of California, San Diego, La Jolla,
California 92093-0651.
| |
ABSTRACT |
|---|
|
|
|---|
In vitro studies suggest that the Barren protein may function as an activator of DNA topoisomerase II and/or as a component of the Xenopus condensin complex. To better understand the role of Barren in vivo, we generated conditional alleles of the structural gene for Barren (BRN1) in Saccharomyces cerevisiae. We show that Barren is an essential protein required for chromosome condensation in vivo and that it is likely to function as an intrinsic component of the yeast condensation machinery. Consistent with this view, we show that Barren performs an essential function during a period of the cell cycle when chromosome condensation is established and maintained. In contrast, Barren does not serve as an essential activator of DNA topoisomerase II in vivo. Finally, brn1 mutants display additional phenotypes such as stretched chromosomes, aberrant anaphase spindles, and the accumulation of cells with >2C DNA content, suggesting that Barren function influences multiple aspects of chromosome transmission and dynamics.
| |
INTRODUCTION |
|---|
|
|
|---|
Chromosomes undergo dramatic programmed changes in higher-order structure as a prerequisite to their proper segregation in mitosis. Replicated sister chromatids must remain attached to one another until anaphase, undergo significant condensation, and become disentangled from one another before complete segregation to opposite poles. Although many activities are required to ensure that these processes occur correctly, the characterization of key players remains at an early stage. A number of specialized components have been identified, either biochemically or genetically, and subsequently shown to be conserved among the different experimental systems. One of the more interesting but perplexing is the Barren protein.
Barren was originally discovered as a Drosophila
mutation that caused defects in the nuclear division of neuronal
precursor cells (Bhat et al., 1996
). Further examination of
the cellular phenotype of barren mutants revealed a
morphology similar to that exhibited by DNA topoisomerase II mutants of
Saccharomyces cerevisiae (Holm et al., 1985
).
Dividing cells frequently contain chromosomes that appear unable to
separate from one another during anaphase; instead, the anaphase
chromosomes are frequently stretched across the two daughter cells, and
cytokinesis initiates with the plasma membrane pinching in toward the
chromatin bridge. Because this stretched DNA phenotype did not appear
to result from global defects in chromosome condensation, a role for
Barren in topoisomerase II function was inferred from the observation
that Barren and topoisomerase II coimmunoprecipitate and interact in a
two-hybrid assay. Indeed, purified Barren influences the activity of
purified topoisomerase II in vitro, suggesting that Barren may regulate topoisomerase II activity in vivo (Bhat et al., 1996
).
Although this is an exciting possibility, the hypothesis has yet to be tested directly in vivo.
A different model for Barren function was proposed from work in the
Xenopus system based on the copurification of Barren with 13S condensin. This five-component complex, in which all of the proteins are conserved from Xenopus to yeast, was initially
isolated from mitotic extracts of Xenopus eggs and shown to
promote the condensation of chromatin in vitro (Hirano and Mitchison,
1994
; Hirano et al., 1997
). Two of the condensin subunits,
XCAP-C and XCAP-E, are members of the SMC (structural maintenance of
chromosomes) family of proteins (for recent reviews, see Jessberger
et al., 1998
; Strunnikov, 1998
; Yanagida, 1998
; Hirano,
1999
). In vivo, inactivation of the yeast SMC homologues of XCAP-C,
Smc2p and cut3, leads to defects in mitotic chromosome condensation
(Saka et al., 1994
; Strunnikov et al., 1995a
).
Because Barren is a condensin subunit in the Xenopus system,
it has been postulated to be required for chromosome condensation.
Assigning a function for Barren based on the Drosophila or
Xenopus studies is complicated by several factors. Because
it has not been possible in the Xenopus system to inactivate
individual subunits, their specific contribution to this in vitro
condensation activity has yet to be established. Although a role for
the SMC subunits in this activity is inferred from the condensation
defect of yeast smc mutants (Saka et al., 1994
;
Strunnikov et al., 1995a
), the in vivo role of individual
non-SMC subunits in chromosome condensation has not been addressed.
Thus, it remains an open question whether the non-SMC subunits mediate
condensin activity or are involved in auxiliary functions, such as
linking condensation with DNA topoisomerase II activity. At first, this
latter model might seem particularly appealing given both the in vitro
interaction between Drosophila Barren and DNA topoisomerase
II and the failure to observe a condensation defect in the
Drosophila barren mutants. However, studies in other systems
have not revealed interactions between the condensin components and DNA
topoisomerase II (Hirano and Mitchison, 1994
; Hirano et al.,
1997
; Strunnikov, personal communication). Given the apparent
discrepancy between the Drosophila and Xenopus
observations, it is critical to test the in vivo role of Barren in cell
cycle-dependent chromosome metabolism, particularly in chromosome
topology and condensation.
With the development of cytological tools in budding yeast and its extremely powerful genetics, Saccharomyces cerevisiae has become an excellent model system for studying the in vivo function of proteins, such as Barren, involved in cell cycle-dependent chromosome dynamics. The coupling of these methods with biochemical analysis of DNA metabolism and topology allows a uniquely broad spectrum of questions in mitosis to be addressed. Here we exploit these approaches to analyze the Barren homologue in budding yeast, addressing its in vivo function in eukaryotic chromosome metabolism.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains and Media
All strains used in this study have an S288c genetic background
and are listed in Table 1. Standard
genetic techniques were used in the construction and growth of these
strains (Sherman et al., 1986
). Cells were grown in YEPD
(rich medium) or SD (synthetic dextrose or selective) medium. YEPD is
1% yeast extract, 2% bactopeptone, 2% dextrose, with or without 2%
bacto-agar; SD medium is 0.67% yeast nitrogen base, 2% bacto-agar,
and 2% dextrose. For synthetic complete (SC) medium, 20 mg of uracil
and tryptophan and 60 mg of leucine were added to 1 l of SD
medium. 5-FOA plates were made as described previously (Ausubel
et al., 1999
).
|
Strains lacking mitochondrial DNA ([rho0]) were used for flow cytometry and were created by growing [rho+] strains in 25 µg/ml ethidium bromide in YEPD to stationary phase. These cells were plated for single colonies on YEPD and tested for their ability to grow on YEP plates containing 2% glycerol (a nonfermentable carbon source). In addition, fluorescence microscopy of DAPI-stained cells confirmed the absence of mitochondrial DNA in the [rho0] strains.
Plasmids
To construct plasmids pCH11720 (LEU2 CEN/ARS BRN1)
and pCH1719 (URA3 CEN/ARS BRN1), a 2.3-kilobase (kb)
fragment (containing the entire BRN1 gene, 5' and 3'
untranslated sequences, and flanking BamHI and
XbaI sites) was amplified by PCR with the use of primers prCH1140 (TTATGGCAGCACTGCATAATTCTCTTACTGCGCGGATCCTATGTGATGTTGATCACG) and prCH1148 (TAGCTCTAGAGATTTCGTAAGCCCGAAGGC). This fragment was ligated into the BamHI-XbaI sites of both
pCH1097 (LEU2 CEN/ARS) and pCH1099 (URA3
CEN/ARS), which are also known as pRS315 and pRS316 vectors,
respectively (Sikorski and Hieter, 1989
). Plasmids pCH1748
(brn1-9) and pCH1749 (brn1-16) are derived by
random in vitro mutagenesis from plasmid pCH1720; they were isolated in the screen for heat-sensitive brn1 alleles. To make plasmid
pCH1721 (BRN1.TRP1; TRP1 is inserted next to
BRN1), PCR was used to fuse the TRP1 allele with
a fragment from downstream of the BRN1 locus with flanking
EagI and SacII sites with the use of primers
prCH1195 (GAATCGGCCGAAAGCCTTCGGGCTTACGAA) and prCH1196
(TAGGCCGCGGTCTTGGTCGCACTAATCAAC). Next, this
EagI-SacII fragment was subcloned into the same
sites of plasmids pCH1720, pCH1748, and pCH1749 to create plasmids
pCH1721, pCH1725, and pCH1726.
Creation of Heat-sensitive brn1 Mutants
We first showed that BRN1 is essential by disrupting
one allele of BRN1 with TRP1 in diploid strain
CH1861. Although the control cross exhibited excellent spore viability,
11 of 12 tetrads from the diploid with the BRN1 disruption
exhibited 2:2 segregation for viability; all living spores were
Trp
, and the inviable spores gave rise to two
to eight cells. We next used the plasmid-shuffle technique (Boeke
et al., 1984
) to identify 16 heat-sensitive brn1
mutations. The BRN1 gene in plasmid pCH1720 was mutagenized
by PCR amplification in 12 independent reactions; each of these
reactions contained a 75% lower concentration of dATP than of the rest
of the nucleotides. The entire coding region was mutagenized with the
use of primers prCH1149 and prCH1150. The amplified DNA containing the
mutagenized BRN1 gene and a 6.0-kb BamHI-XbaI fragment of plasmid pCH1720 lacking
the BRN1 coding region were then cotransformed into strain
CH2518 to allow recombination during transformation (Muhlrad et
al., 1992
). The transformants were replica plated onto
5-FOA-containing plates to select for the loss of plasmid pCH1719
(BRN1 URA3) and were simultaneously screened for phenotypes
at 37 and 14°C. Among 10,000 transformants, ~10% contained
knockout mutations for brn1. Although we screened for cold
sensitivity at 14°C, no cold-sensitive mutants were recovered. Sixteen heat-sensitive mutants were recovered from transformants derived from 10 of the mutagenized pools of DNA. We confirmed that the
heat-sensitive mutations were brn1 mutations by isolating and purifying the mutant plasmids and then transforming them into a
brn1::TRP1 strain carrying a BRN1 URA3
plasmid (strain CH2518) (Robzyk and Kassir, 1992
). In each case,
eviction of the BRN1 plasmid led to temperature sensitivity.
To replace the normal chromosomal BRN1 allele with mutant brn1 alleles, the TRP1 gene was inserted just downstream of each plasmid-borne brn1 mutation, the brn1 genes plus flanking DNA were cut out of each plasmid with the use of BamHI and SacII, and the linear DNA was used to transfer the BRN1 gene into strain CH1580 (trp1 BRN1). After selecting the transformants for TRP1, integration was confirmed by PCR. In each case, the strain carrying the transferred brn1 gene was heat sensitive, as expected. Strains bearing integrated brn1 alleles were used for all physiological experiments.
Drug Sensitivity and Synthetic Lethality
To assess the drug sensitivity of strains, serial dilutions were spotted onto YEPD plates containing 0.02 or 0.04 M hydroxyurea, 0.005 or 0.017% methyl methane sulfonate, and 7.5 or 15 µg/ml benomyl. Sensitivity to UV light was evaluated by placing spots of cells on YEPD plates and then exposing them to 254-nm UV radiation doses from 0 to 200 J/m2 with the use of a Stratalinker 1800 (Stratagene, La Jolla, CA). For each test, the plates were incubated at 25°C for 2 d. Strains CH2523 (BRN1), CH2524 (brn1-9), and CH2525 (brn1-16) showed no unusual sensitivity to the DNA-damaging agents hydroxyurea, methyl methane sulfonate, and UV light or to the microtubule-depolymerizing drug benomyl (our unpublished results). Because previous reports have suggested that Brn1p may interact functionally with DNA topoisomerase II or SMC proteins, we performed crosses to determine whether brn1 mutations would exhibit synthetic lethality with mutations affecting these other proteins. Synthetic lethality was tested by crossing strain CH2529 (brn1-9) with strain CH325 (top2-4), 4aAS247 (smc1-2), or 2bAS283 (smc2-6). Brn1 mutations are not synthetic lethal with top2-4 (10 of 10 tetrads were 4:0 for viability), smc2-6 (7 of 7 tetrads were 4:0 for viability), or smc1-2 (5 of 7 tetrads were 4:0 for viability). These negative results are provided for completeness, but they provide little information about the function of Brn1p.
First-Cycle Arrest Experiments
Cell cycle progression was monitored at the restrictive
temperature in plate assays as described (Weinert and Hartwell, 1993
). Strains were grown to early log phase at 25°C. The cells were sonicated, diluted, and plated onto prewarmed YEPD plates and incubated
at 25 or 37°C. The number of cell divisions was monitored over time
by scoring the number of cell bodies (1, 2-4, 5-8, 9-16, and >17)
in 100 microcolonies for up to 16 h. When incubated at 25°C,
88-100% of the microcolonies from each tested strain contained >16
cells after 16 h.
Viability Experiments
We examined viability in cultures that were growing
exponentially at 25°C. To examine the effects of temperature on
asynchronously dividing cells, each culture was divided, one aliquot
was incubated at 25°C and one at 37°C, and the samples were checked
for viability at 3 and 6 h. To check for viability, the samples
were sonicated, diluted, and plated on YEPD plates that were incubated
at 25°C for 3 d. To examine the effects of temperature on cells
arrested in G1 or S phase, the exponentially growing cultures were
initially incubated for 3 h at 25°C in 5 µg/ml
-factor or
0.1 M hydroxyurea in YEPD (pH 4.0). Each culture was then divided, an
aliquot was incubated at 25 or 37°C for an additional 3 h, and
the cultures were checked for viability.
Execution Point Experiments
To determine the time at which Barren function is required in
the cell cycle, cultures growing exponentially at 25°C in YEPD (pH
4.0) were treated for 3 h with 5 µg/ml
-factor to arrest them
in G1. After the
-factor was washed away, the cells were resuspended
in YEPD and divided into three aliquots. Nothing was added to the first
aliquot, 0.1 M hydroxyurea was added to the second aliquot, and 10 µg/ml nocodazole was added to the third aliquot. Each aliquot was
divided into two portions, one of which was incubated at 25°C and the
other at 37°C for 3 h. Samples were then taken and checked for
viability as described above.
Cell Morphology and Indirect Immunofluorescence
Yeast nuclear DNA was visualized by DAPI staining of
formaldehyde-fixed cells. Asynchronous cultures (2.5 × 106 cells/ml) were grown in YEPD at 23°C,
shifted to 37°C for 3 h, and fixed in 3.6% formaldehyde (60 min, room temperature). Indirect immunofluorescence was done
essentially as described (Kilmartin et al., 1982
) with the
use of the YOL1/34 mAb against
-tubulin (Serotec, Indianapolis, IN)
and goat anti-rat FITC (Sigma, St. Louis, MO).
Catenation of Plasmids
Strains containing a 14-kb circular minichromosome (pDK243,
ARS1 CEN3 LEU2 [Koshland et al., 1985
]) were
pregrown in selective medium, diluted into YEPD, and then grown to
early log phase (3-4 × 106 cells/ml) at
the permissive temperature (approximately five divisions). Cells were
synchronized in G1 by adding 3 µM final
-factor, incubating at
23°C for 2.5 h, and preshifting to 37°C for 30 min (typically, >85% of cells showed a schmoo morphology). The cells were then released into prewarmed YEPD with 0.1 mg/ml pronase E in the presence of 20 µg/ml nocodazole. To keep the BRN1 cells arrested at
early M for 3 h at the nonpermissive temperature, an additional 10 µg/ml nocodazole was added 1 h after release. Plasmid DNA was
isolated from 10 ml of the
-factor- or nocodazole-arrested culture,
and half was separated on a 0.6% agarose gel in 1× Tris-acetate-EDTA, transferred to GeneScreen (Du Pont, Boston, MA), and probed with random-primer-labeled pBR322 by standard techniques.
Chromosome Breakage Assay
Cultures growing exponentially in YEPD at 25°C were divided,
and half was incubated at 25°C and half at 37°C for 5 h.
Chromosomal DNA was isolated with the use of the method described
(Spell and Holm, 1994
). Chromosomes were separated on a 1% agarose gel
in 0.5× Tris-borate-EDTA in a CHEF-DR pulsed-field gel apparatus (Bio-Rad, Richmond, CA). Electrophoresis was performed at 4°C with a
60-s switch time for 16.2 h and then a 90-s switch time for 9 h. Hybridization was performed on the dried, rehydrated gel, as
described (Spell and Holm, 1994
), with the use of a URA3 probe that was
prepared by random primer labeling.
FACS Analysis
To prepare the cells for flow cytometry, samples were sonicated,
diluted, and prepared for microfluorometric analysis by staining with
propidium iodide, as described (Hutter and Eipel, 1979
). A
Becton-Dickinson (Franklin Lakes, NJ) FACS was used to determine the
DNA content of the cells in each sample. A total of 10,000 cells of
each type were analyzed for their DNA content. For cultures treated
with drugs, the cells were grown in YEPD (pH 4.0) and treated with 5 µg/ml
-factor or 0.1 M hydroxyurea, as indicated in Figure 3.
Chromosome Condensation and Cohesion
BRN1, brn1, and smc2-8 cultures
(2.5-3 × 106 cells/ml) were arrested in G1
(3, 3, and 1 µM final
-factor, respectively) for 2.5 h at
23°C, preshifted to 37°C, and released into nocodazole, as
described above for the plasmid catenation assay. In all experiments, cells were fixed with 3.6% formaldehyde for 2 h and prepared for fluorescence in situ hybridization (FISH) analysis, as described (see
Guacci et al. [1994] for methods and probe details).
Digoxigenin (DIG)-labeled rDNA (chromosome XII) was used to visualize
the condensation of repetitive DNA sequences. Condensation of unique sequences was monitored as described previously by measuring distances between DIG-CEN16 proximal and distal probes signals, which are separated by 255 kb (probes 1 and 3, respectively, from Guacci et
al. [1994] and Strunnikov et al. [1995a]
). Nuclei
with a single signal (or more than two spots) were not included in our
analysis because of the difficulty of assigning one spot to two
overlapping signals or to hybridization of only one probe. It is
noteworthy, however, that BRN1 cells contained roughly twice
as many nuclei with a single spot than brn1-9 cells,
suggesting that our calculated average distance for condensed DNA is
somewhat overestimated, as is predicted from the distribution of the
histogram (see Figure 4D). Sister chromatid cohesion was analyzed with
the use of DIG-labeled CEN16 or CEN1 proximal probes, as described by
Guacci et al. (1994)
. Mouse anti-DIG antibodies were from
Sigma, and goat anti-mouse (FITC) and pig anti-goat (FITC) secondary
antibodies were from Jackson Immunoresearch (West Grove, PA). Nuclei
were counterstained with propidium iodide in antifade mounting medium
(ONCOR; Intergen, New York, NY) and visualized with the use of a Zeiss
(Thornwood, NY) epifluorescence microscope. Images were recorded
digitally with the use of a Princeton (Trenton, NJ) charge-coupled
device camera with Signal Analytics (Fairfax, VA) processing software, which allows image superimposition.
For the rDNA condensation maintenance experiment, cells were arrested
in G1 with the use of
-factor (as described above) and then released
into medium containing nocodazole for 2 h at the permissive
temperature (23°C). An aliquot was taken to assess the initial state
of rDNA condensation. The remainder of the culture was then shifted to
37°C for 1 h in the continued presence of nocodazole, after
which the cells were harvested. Condensation was assessed with the use
of DIG-labeled rDNA, as described above.
| |
RESULTS |
|---|
|
|
|---|
Heat-sensitive brn1 Mutations Were Produced in the Essential BRN1 Gene
To examine the in vivo role of Barren, we generated conditional
alleles in the structural gene for the budding yeast homologue Brn1p
(for details, see MATERIALS AND METHODS). We first showed that
BRN1 is essential by disrupting one allele in a diploid
cell; after sporulating the heterozygous diploid, all of the haploid progeny carrying the disrupted gene were inviable, giving rise to only
two to eight progeny cells. We next used the plasmid-shuffle technique
(Boeke et al., 1984
) to isolate 16 heat-sensitive
brn1 mutations. Stable heat-sensitive brn1
mutants were made by introducing 5 of the 16 brn1 mutations
into chromosomes in place of the normal BRN1 gene. We chose
two alleles (brn1-9 and brn1-16) for additional experimentation; these alleles caused no unusual drug sensitivity or
synthetic lethality with top2, smc1, or
smc2 mutations (see MATERIALS AND METHODS).
Brn1 Mutations Cause Arrest of Cell Division and Cell Cycle-dependent Loss of Viability
To examine the effects of the brn1 mutations on cell division, we investigated whether brn1 strains undergo an arrest of cell division in the first cycle after they are placed at the restrictive temperature. To allow comparison of this phenotype with other strains, we examined strains CH2523 (BRN1), CH2524 (brn1-9), CH2525 (brn1-16), CH325 (top2-4), 4aAS247 (smc1), and 2bAS283 (smc2) in the same experiments. Exponentially growing cultures at 25°C were sonicated and spread on prewarmed YEPD plates at 25 or 37°C, and the number of cells in each microcolony was counted over time. The top2 and smc1 strains exhibited a first-cycle arrest; none of the microcolonies contained more than 4 cell bodies even when incubated at 37°C for 9 h. The majority of brn1 and smc2 cells underwent arrest in the first division, but a small proportion of the cells exhibited a multicycle arrest; ~25% of the microcolonies contained more than 4 cells after 7.5 h of incubation at 37°C. Even the cells in these microcolonies ultimately arrested, however, because none of the microcolonies from these strains contained more than 16 cells after an overnight incubation at 37°C. Thus, although a minority of brn1 cells continue to divide, the majority of the cells cease dividing in the first generation after they are shifted to the restrictive temperature.
brn1 mutants also exhibit a loss of viability when incubated
at the restrictive temperature. When exponentially growing cultures are
shifted to the restrictive temperature, ~75% of the brn1
cells become inviable after 3 h (1.5 generation times) and ~95%
become inviable after 6 h (3 generation times) (Table
2). This result is quantitatively similar
to results observed with smc1 and smc2 mutants,
which maintain moderate viability after 1 generation time at the
restrictive temperature (Strunnikov et al., 1993
, 1995a
).
However, the result is noticeably different from what is observed with
top2 mutants, which lose viability much more rapidly at the
restrictive temperature (Holm et al., 1985
).
|
Loss of viability at the restrictive temperature could be caused by the
requirement for Brn1p at a specific time during the cell cycle, or it
could be caused by a more general requirement for Brn1p in cell
metabolism. If the former is true, then brn1 mutants should
remain viable at the restrictive temperature when they are prevented
from traversing the cell cycle; both smc2 and top2 mutants exhibit this phenotype. Exponentially growing
brn1, smc1, smc2, and top2
cultures were arrested in G1 phase of the cell cycle with
-factor or
in S phase with hydroxyurea. The cultures were divided into two
aliquots, and the cells were incubated at either the restrictive or the
permissive temperature for an additional 3 h. All cultures
maintained good viability (at least 84%) when cell cycle arrest was
maintained (Table 2). This result demonstrates that brn1
mutants must pass through the cell cycle to incur irreversible damage.
It also demonstrates that arrested G1- and S-phase cells do not require
ongoing Brn1p activity.
Brn1p Is Required between Early S Phase and Early M Phase
To determine the time in the cell cycle during which Brn1p is
required, we examined the viability of synchronously dividing populations of cells. Because brn1 mutants show only a
moderate loss of viability in the first generation time at the
restrictive temperature, we examined cell viability in two
"windows" of the cycle. In each case, exponentially growing cells
were treated with
-factor to arrest the cells in G1; the
-factor
was then removed, and the cells were shifted to the restrictive
temperature and allowed to begin cycling. In one sample, the cultures
were treated with hydroxyurea to stop the cell cycle at early S phase; in a second sample, the cells were instead treated with nocodazole to
allow them to pass through S phase and arrest at G2/M; a third sample
was not treated with drugs and served as a control. After 3 h at
the restrictive temperature, an aliquot of each sample was spread on
rich medium at the permissive temperature to evaluate the viability of
the cells. Because viability was assessed at the permissive
temperature, this regimen reveals when the irreversible lethal event
occurs during the cell cycle, regardless of when the actual death of
the cell occurs.
Our results suggest that Barren is required between the beginning of S
phase and the beginning of mitosis. When a synchronously dividing
brn1 strain is prevented from entering S phase with
hydroxyurea, the viability of the culture remains high, even though it
is incubated at the restrictive temperature for 3 h (Table
3). If the strain is instead allowed to
pass though S and G2 phases, the viability of the culture decreases to
the same extent whether it is treated with nocodazole or not. (The
efficacy of the nocodazole treatment was confirmed by observations of
cell morphology [our unpublished results].) This result is in sharp
contrast with the result observed with a top2 strain, which
maintains good viability as long as it is prevented from passing
through mitosis by treatment with either hydroxyurea or nocodazole.
These results suggest that the activity or assembly of Brn1p is
required between early S phase and early M phase.
|
Brn1 Mutants Arrest Heterogeneously and Exhibit Aberrant Mitotic Spindles
Although it appears that Brn1p is required to allow cells to
traverse the cell cycle successfully, brn1 mutants, like
top2 and smc2 mutants, do not show a classic
cell-division-cycle phenotype at the restrictive temperature.
BRN1 and brn1 cultures were grown exponentially
at 25°C and then shifted to 37°C for 3 h. As expected, the
BRN1 strain showed a distribution of cell morphologies,
representing cells at all normal stages of the cell cycle (Figure
1A). This distribution was also observed
with control BRN1 and brn1 cultures that were
retained at 25°C (our unpublished results). In comparison, the
brn1 strain at 37°C was somewhat depleted of cells with
small buds. In their place was an increased number of large-budded
cells, almost half of which appeared to be in early anaphase.
|
To characterize the morphology of the large-budded cells more thoroughly, cells from similarly grown cultures were fixed, prepared for indirect immunofluorescence of tubulin, and treated with DAPI to stain DNA. More than half of the large-budded BRN1 cells contained two well-separated nuclei (anaphase and telophase cells) with nuclear microtubules extending along the entire DNA mass (Figure 1, B and C). In contrast, roughly half of the large-budded brn1 cells possessed a dumbbell-shaped DNA mass that extended through the bud neck and was frequently distributed asymmetrically. The nuclear spindles in these cells were intensely stained, only partially extended (4-5 µm), and predominantly localized at or near the bud neck, although typically failing to traverse it. That the cells with stretched nuclei initiate a true anaphase was confirmed by a separate experiment in which hemagglutinin-tagged Pds1p, an inhibitor of the metaphase-to-anaphase transition, was observed to be depleted (our unpublished results). Surprisingly, 62% of brn1 cells with bilobed nuclei displayed aberrant spindle localization, with tubulin staining localized to only one of the two DNA masses. Together, these data suggest that brn1 cells undergo an aberrant anaphase.
Brn1 Mutants Do Not Accumulate Catenated Plasmids or Broken Chromosomes
Although brn1 mutants appear phenotypically distinct from top2 mutants both in the efficiency and morphology of their arrest and in the loss of viability at the restrictive temperature, the apparent interaction of Barren and DNA topoisomerase II in Drosophila prompted us to test brn1 mutants for two phenotypes that are defining characteristics of top2 mutants, catenation of circular plasmids and the production of broken chromosomes.
Because DNA topoisomerase II is the only cellular enzyme capable of
disentangling catenated circles of double-stranded DNA, circular
plasmids remain catenated after replication when top2 strains are incubated at the restrictive temperature (Koshland et
al., 1985
). If Barren is required for DNA topoisomerase II activity, as has been suggested in Drosophila, then
brn1 mutants might exhibit a similar accumulation of
catenated plasmids when they are incubated at the restrictive
temperature. Wild-type and mutant strains containing a 14-kb circular
minichromosome were synchronized in G1 in medium containing
-factor,
then released into nocodazole-containing medium at the nonpermissive
temperature. The topological state of purified minichromosomes was then
analyzed by agarose gel electrophoresis (Figure
2A). As expected, higher-molecular-weight catenated circles accumulate in nocodazole-treated top2
cells. In contrast, the brn1 mutants display no change in
plasmid topology at the restrictive temperature, indicating that
brn1 mutants effectively resolve the catenanes produced
during replication, even at the restrictive temperature.
|
When full-length chromosomes are segregated in the absence of DNA
topoisomerase II activity, approximately one-third of chromosomes larger than 300 kb suffer a distinctive pattern of breakage (Spell and
Holm, 1994
). If Barren is required for DNA topoisomerase II activity,
then brn1 mutants might be expected to exhibit the same kind
of chromosome breakage. To test this hypothesis, BRN1,
brn1-9, brn1-16, and top2-4 strains
were grown exponentially at 25°C, and the cultures were divided and
incubated for an additional 5 h at either 25 or 37°C. Although a
clear smear of broken chromosomes was visible in the lane with DNA from
the top2 culture grown at 37°C, no such smear was visible
in the lanes containing DNA from brn1 strains (Figure 2B).
Thus, it appears unlikely that Barren is required to activate DNA
topoisomerase II in vivo.
Brn1 Mutants Accumulate an Unusual Population of Cells with an Apparent >2C DNA Content at the Restrictive Temperature
To examine the state of the DNA in brn1 mutants at the
restrictive temperature, we used FACS analysis of cells lacking
mitochondrial DNA. Exponentially growing cultures at 25°C were
divided and placed at 25 or 37°C for various periods. Surprisingly,
there is a broadening and flattening of the G2 peak in brn1
cells incubated at the restrictive temperature, and many cells appear
to have a DNA content >2C (Figure 3A).
This phenomenon is not observed in the BRN1 control strain, and it is not observed in a variety of temperature-sensitive yeast strains incubated at the restrictive temperature. For example, both
late-nuclear-division mutants cdc5 and cdc15 and
many DNA-replication mutants (e.g., cdc44/rfc1 and
pol30) undergo cell cycle arrest with a uniform 2C DNA
content (Howell et al., 1994
; Amin and Holm, 1996
; Oh and
Holm, unpublished data). Notably, however, a suggestion of the same
unusual phenomenon occurs when an smc2 strain is incubated at the restrictive temperature; this phenotype becomes more pronounced after prolonged incubation times (our unpublished results; see also
Figure 3B). This FACS profile differs, however, from that produced by
top2 mutant cells, which suffer chromosome breakage and
nondisjunction, thereby producing cells with both <1C and >2C DNA
contents (Figure 3A) (Holm et al., 1989
). Thus, it appears that in both brn1 and smc2 mutants incubated at
the restrictive temperature, a significant fraction of cells display an
increase in DNA content.
|
To examine the timing of this phenomenon, we arrested exponentially
growing cells in G1 with
-factor, released them to the restrictive
temperature, and then examined them by FACS at various times. For the
brn1-16 strain, DNA replication was apparent 1 h after
release from
-factor, which is similar to what is observed with
BRN1 cells (Figure 3B). The initial appearance of >2C cells occurred 2 h after release, and the population of >2C cells was much more apparent 3 h after release from
-factor (Figure 3B). This cell type appears to be produced during the second cell cycle after release from
-factor, because its production was entirely prevented by treating the culture with either
-factor or hydroxyurea 1.5 h after release from the initial
-factor treatment (Figure 3C; our unpublished results). A similar phenomenon was seen with smc2 mutants, except that progress through the cell cycle
was somewhat slower with this strain. Thus, it appears that
brn1 and smc2 cells begin to exhibit this unusual
staining in the second cell cycle after a shift to the restrictive
temperature. One possibility is that this staining pattern reflects
aberrant excessive DNA replication (see DISCUSSION).
Brn1 Mutants Are Defective in Chromosome Condensation
The phenotypic similarities between brn1 and
smc2 mutants suggest that, like smc2 mutants,
brn1 mutants may have defects in chromosome condensation.
This predicted phenotype of brn1 mutants is also suggested
from the copurification of Xenopus Barren with the 13S
condensin complex (Hirano et al., 1997
). To test this hypothesis, exponentially growing brn1 and BRN1
cultures were arrested in G1 with
-factor, shifted to the
restrictive temperature, and then released into nocodazole to allow the
chromosomes to attain maximal condensation at the restrictive
temperature. Under this regimen, Brn1p should be inactivated during
both the establishment and the maintenance of condensation. Chromosome
condensation was monitored with the use of FISH with an rDNA probe
(Guacci et al., 1994
), revealing dramatic differences among
the strains. Chromosome XII in BRN1 strains condensed as
expected to a discrete linear array, but brn1 mutants
revealed a disorganized rDNA array (Figure 4, A and B). Similarly, an
smc2 mutant showed a clear defect in rDNA condensation when
subjected to this regimen (Figure 4B) (Strunnikov, personal
communication). Thus, Barren, like Smc2p, is involved in mitotic
chromosome condensation.
|
To determine whether Barren function is limited to an early stage in chromosome condensation (i.e., as for an assembly factor) or whether ongoing Barren activity is required to maintain mitotic chromosome structure, we inactivated Barren after chromosome condensation had occurred. BRN1 and brn1 cultures were arrested in early mitosis with the use of nocodazole at the permissive temperature to allow rDNA condensation. The cultures were then shifted to the restrictive temperature to inactivate Barren specifically in mitosis, and the state of the rDNA was monitored by FISH with the use of an rDNA probe. As expected, both BRN1 and brn1 chromosomes were condensed at the permissive temperature. In contrast, although the BRN1 chromosomes remained condensed at 37°C, rDNA condensation was disrupted in the brn1-9 strain (Figure 4C). These data indicate that ongoing Barren activity is required for the maintenance of chromosome condensation during mitosis.
To address whether the condensation defects in brn1 mutants
are limited to repetitive DNA, we examined chromosome condensation in
unique sequences on chromosome XVI. Exponentially growing
brn1 and BRN1 cultures were arrested with
-factor, shifted to the restrictive temperature, and then released
into nocodazole to block the cells in mitosis. Chromosome condensation
was examined by using FISH and measuring the distance between two
sequences that map 255 kb apart on chromosome XVI (Figure 4D). In
BRN1 nuclei, the average distance between CEN16 proximal and
distal probes was 0.75 ± 0.08 µm (experiment 1; Figure 4D) and
0.77 ± 0.09 µm (experiment 2; our unpublished results), which
are similar to values reported previously for condensed DNA (Strunnikov
et al., 1995a
). In contrast, in brn1-9 nuclei,
the average distance between probes was 1.07 ± 0.11 µm
(experiment 1) and 0.97 ± 0.11 µm (experiment 2); these values
are very similar to what is seen in uncondensed chromosomes in G1 cells
(1.0 ± 0.01 to 1.1 ± 0.1 µm; Strunnikov et
al., 1995a
). Thus, little or no chromosome condensation occurs on
unique DNA sequences in the absence of functional Barren protein.
Because a number of mutations that affect chromosome cohesion also
cause alterations in chromosome condensation (Guacci et al.,
1997
; Strunnikov, personal communication), we tested brn1 mutants arrested in mitosis for precocious separation of sister chromatids in the absence of microtubules. Although chromosome condensation was impaired under these conditions, sister chromatid cohesion appeared normal when analyzed with a CEN16 probe
(Figure 4E) and a CEN1 probe (our unpublished results).
Thus, an underlying defect in cohesion is unlikely to be the source of
the observed condensation defects. Instead, brn1 cells are
specifically impaired in their ability to establish and/or maintain
chromosome condensation at the restrictive temperature. Together, these
results strongly suggest that Barren plays an essential role in
chromosome condensation in yeast.
| |
DISCUSSION |
|---|
|
|
|---|
To begin to unravel the biological function of Barren in
eukaryotic cells, we used genetic, cytological, and molecular
biological methods to initiate studies of the Barren homologue in
budding yeast. The Barren product in budding yeast is essential for
viability and cell division. The analysis of heat-sensitive
brn1 mutants revealed that cells compromised in Barren
function exhibit partially elongated chromosome masses similar to the
anaphase defect observed for barren mutants in
Drosophila, which suggests a conserved function for Barren
in chromosome transmission between yeast and flies. This chromosome
phenotype is also very similar to the phenotype of smc2
mutants of budding yeast, cut3 and cut14 mutants
of Schizosaccharomyces pombe, and mix1 mutants of
Caenorhabditis elegans (Saka et al., 1994
;
Strunnikov et al., 1995a
; Lieb et al., 1998
). All
of these genes encode homologues of components of Xenopus
condensin, a complex essential for chromosome condensation in vitro.
Furthermore, we directly show that brn1 mutants are
defective in chromosome condensation in vivo, as has been demonstrated
for smc2, cut3, and cut14. Consistent
with this observation, Barren performs an essential function between
early S phase and early M phase, the period of the cell cycle during
which condensation is established and maintained. Together, our results
reveal that the Barren product of budding yeast is critical for mitotic
chromosome segregation and condensation.
The demonstration that yeast Barren functions in vivo in chromosome
condensation both corroborates and extends the previous analysis of the
role of Barren. In Xenopus, Barren copurifies with the
five-subunit condensin complex, and as such it was inferred to play an
important role in the condensation process (Hirano et al.,
1997
). Because the contribution of individual condensin subunits to the
in vitro condensation reaction was not addressed, however, the
physiological significance of Barren's association with condensin was
unclear. That yeast Barren is essential for viability and is required
for chromosome condensation in vivo suggests that it is an integral
component of condensin function. Although we do not know the molecular
function of Barren in the condensin complex, our genetic results
provide two important constraints. Because loss of Barren function
yields uncondensed chromosomes, Barren is likely to be critical to the
core function of condensin rather than to serve as a minor auxiliary
factor. Second, the absence of chromosome condensation when Barren
activity is compromised implies that the loss of Barren function
inactivates the cell's condensation machinery, i.e., Barren is not a
negative regulatory subunit of condensin. Recent work with the
Xenopus condensin complex has shown that, in vitro, the
condensin complex wraps DNA in a right-handed manner (Kimura and
Hirano, 1997
; Kimura et al., 1999
). That this reaction
requires phosphorylated Barren and/or XCAP-D2 and/or XCAP-G suggests
that some or all of these proteins play a role in the activation of
condensin (Kimura et al., 1998
). Consistent with this
suggestion, anti-Eg7 (XCAP-D2) antibodies were used to demonstrate a
role for this subunit in the in vitro condensation assay (Cubizolles
et al., 1998
). Additional experiments will be needed to
assess whether Barren functions as a regulatory switch or as a direct
mediator of altering chromosome topology.
In vivo, ongoing Barren activity is required to maintain mitotic chromosome structure. The most simple interpretation of this result is that Barren plays a structural role in higher-order chromosome organization. Alternatively, the maintenance of chromosome condensation could be a highly dynamic process involving a constant reestablishment of the condensed state. Regardless of the mechanism, it is clear that inactivation of Brn1p in early M causes an untimely loss of chromosome condensation, probably through inactivation of the cellular condensation machinery. Because chromosome condensation is a reversible process that is initiated in early M and reversed in late M/early G1, the regulation of condensin activity through Brn1p could provide an effective mechanism for both condensing and decondensing DNA.
An intriguing question is whether both repetitive and unique DNA
condense through similar mechanisms. Although previous work with
smc2 mutant cells failed to show a defect in rDNA
condensation (Strunnikov et al., 1995a
), this was most
likely due to a less stringent inactivation regimen (see Figure 4B). We
now show that both Smc2p and Brn1p are required for the condensation of
repetitive as well as unique DNA sequences. These data are consistent
with a model whereby chromosome compaction of both repetitive and
unique DNA sequences occurs through a common molecular machinery and thus through a conserved mechanism. Although defects in rDNA
condensation are more dramatic by FISH than those seen with unique DNA
probes, this difference may reflect the reiterative nature of the rDNA array and/or a change in the relative distribution of condensin proteins. Indeed, indirect immunofluorescence of Smc4p and Ycd2p, yeast
homologues of two additional condensin subunits, suggests that they are
enriched on the rDNA (Strunnikov, personal communication; Zheng and
Koshland, unpublished results).
It is noteworthy that condensation of both unique and repetitive DNA is
perturbed in the first mitosis after Brn1p inactivation. At this time,
topological links between sisters are resolved, as judged by the
absence of catenated circular minichromosomes and chromosome V breaks.
Thus, condensation does not appear to be obligatory in driving out DNA
tangles, as has been proposed previously (Wood and Earnshaw, 1990
).
Rather, anaphase itself may be sufficient to promote DNA untangling by
topoisomerase II (Holm et al., 1985
; Holm, 1994
). However, a
modest delay in anaphase is detectable in brn1 mutants at
the restrictive temperature (our unpublished results), suggesting that
the kinetics of chromosome untangling may be facilitated by
condensation, and this effect may be particularly important for the
larger chromosomes of higher eukaryotes.
Although a condensation defect is the earliest observable phenotype of
brn1 mutants, there is a later appearance of additional phenotypes, including an anaphase failure that is cytologically similar
to DNA topoisomerase II mutants. Although earlier in vitro analysis of
Drosophila Barren suggested that it might serve as an
activator of topoisomerase II function, our results suggest that yeast
Barren is probably not an essential activator of topoisomerase II in
vivo. Because topoisomerase II is the only enzyme known to disentangle
catenated circular plasmids, a failure by the mutant Barren protein to
activate topoisomerase II should have led to the accumulation of
catenanes. In brn1 mutants at the restrictive temperature,
however, catenanes are efficiently resolved and chromosomes are
segregated without breakage. Nonetheless, it remains possible that
Barren could serve to regulate topoisomerase II activity in a more
subtle manner. Barren may serve as an inhibitor of topoisomerase II
activity in vivo, as was observed in vitro when Barren was present at
high concentrations. Cytological evidence suggests that Barren and
topoisomerase II reside in close proximity in condensed and condensing
chromosomes (Bhat et al., 1996
). Perhaps when associated
with chromosomes they are members of a large multiprotein complex and
perform their functions simultaneously but independently.
An unexpected phenotype of cells defective for Barren function is an
accumulation of cells containing >2C DNA content. This phenotype may
be general for chromosome condensation mutants, because smc2
mutants also produce >2C cells. When Barren or Smc2p is inactivated at
the beginning of the cell cycle, chromosome condensation is perturbed
at the time of the first mitosis (Figure 4; our unpublished results).
In contrast, the appearance of cells with >2C DNA content occurs much
later (Figure 3). In fact, the appearance of >2C cells can be entirely
abolished if the brn1 cells are prevented from proceeding
through a second cell cycle with either
-factor or hydroxyurea
(Figure 3C; our unpublished results). It is unlikely that this
phenotype is caused by some aberrant binding of propidium iodide to the
uncondensed DNA, because a sharp 2C peak is observable in both mutants
in the first M phase. Instead, the >2C FACS profiles are reminiscent
of FACS profiles produced by a cdc6 mutant that displays
promiscuous initiation of DNA replication (Liang and Stillman, 1997
).
This observation brings up the interesting possibility that improper
condensation of the chromosomes in the first cell cycle subsequently
leads to inappropriate initiation of DNA replication. Because the
prereplication complex is formed at the M-to-G1 transition (Diffley
et al., 1994
), one possibility is that its normal assembly
is affected by the condensation state of the chromosomes.
A second unexpected phenotype of brn1 mutants is the absence
of spindle and chromosome colocalization. One possible explanation is
that decondensation results in intertwining that causes detachment of
chromosomes from the spindle when the cell enters anaphase. This
possibility seems unlikely, however, because topological links and
chromosome breaks do not accumulate in brn1 mutants. Furthermore, top2 mutants complete anaphase by breaking
chromosomes, suggesting that kinetochore-spindle
attachments resist a challenge from topologically linked DNA (Holm
et al., 1989
). A more attractive model is that Barren (or
the chromosome condensation it maintains) plays a novel role in
centromere structure and/or function. In support of this idea,
cytological observations of mitotic chromosomes suggest an unusual
condensed state of centromeric regions (Rattner and Lin, 1985
). In
addition, mutations in Cep3p, an established kinetochore
component, result in a similar displacement of the chromosomes from the
spindle, presumably resulting from a failure of the chromosomes to
maintain a stable attachment to the dynamic spindle (Strunnikov
et al., 1995b
). Furthermore, preliminary evidence suggests
that Brn1p genetically interacts with a subset of
kinetochore proteins (Lavoie and Koshland, unpublished
observation). It will be interesting to determine whether this putative
role for Barren at the centromere reflects a general role for condensin
proteins. However, neither smc2 mutations nor mutations
affecting the homologue of XCAP-G cause an accumulation of mid anaphase
nuclei (Lavoie and Koshland, unpublished observation). Thus, it is
tempting to speculate that specific cellular processes may be
differentially sensitive to defects in the functions of condensin
proteins. Additional study will be necessary to determine the precise
functional roles of these proteins, which play a pivotal role in the
condensation of chromosomes.
Note added in proof. In the accompanying paper by Ouspenski et al., brn1 mutants do not exhibit excess DNA replication during the time course of the FACS experiment. This disparity probably reflects the roughly twofold difference in doubling times of the strains used by the two laboratories.
| |
ACKNOWLEDGMENTS |
|---|
We are indebted to A. Strunnikov for providing the 1aAS330 (smc2-8) strain and for communication of unpublished results. We thank A. Philp and members of our laboratories for critical reading of the manuscript. B.D.L. and K.M.T. contributed equally to this work. This work was supported by grants GM36510 (to C.H.) and GM41718 (to D.K.) from the National Institutes of Health. B.D.L. is the recipient of a Centennial Fellowship from the Medical Research Council of Canada.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
cholm{at}ucsd.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. D. Resnick, K. J. Dej, Y. Xiang, R. S. Hawley, C. Ahn, and T. L. Orr-Weaver Mutations in the Chromosomal Passenger Complex and the Condensin Complex Differentially Affect Synaptonemal Complex Disassembly and Metaphase I Configuration in Drosophila Female Meiosis Genetics, March 1, 2009; 181(3): 875 - 887. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Waples, C. Chahwan, M. Ciechonska, and B. D. Lavoie Putting the Brake on FEAR: Tof2 Promotes the Biphasic Release of Cdc14 Phosphatase during Mitotic Exit Mol. Biol. Cell, January 1, 2009; 20(1): 245 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Haeusler, M. Pratt-Hyatt, P. D. Good, T. A. Gipson, and D. R. Engelke Clustering of yeast tRNA genes is mediated by specific association of condensin with tRNA gene transcription complexes Genes & Dev., August 15, 2008; 22(16): 2204 - 2214. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Lavoie pRb and condensin--local control of global chromosome structure Genes & Dev., April 15, 2008; 22(8): 964 - 969. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Yong-Gonzalez, B.-D. Wang, P. Butylin, I. Ouspenski, and A. Strunnikov Condensin function at centromere chromatin facilitates proper kinetochore tension and ensures correct mitotic segregation of sister chromatids Genes Cells, September 1, 2007; 12(9): 1075 - 1090. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C.J. Vas, C. A. Andrews, K. Kirkland Matesky, and D. J. Clarke In Vivo Analysis of Chromosome Condensation in Saccharomyces cerevisiae Mol. Biol. Cell, February 1, 2007; 18(2): 557 - 568. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. W. Lam, E. A. Peterson, M. Yeung, and B. D. Lavoie Condensin is required for chromosome arm cohesion during mitosis. Genes & Dev., November 1, 2006; 20(21): 2973 - 2984. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Cervantes, R. S. Coyne, X. Xi, and M.-C. Yao The Condensin Complex Is Essential for Amitotic Segregation of Bulk Chromosomes, but Not Nucleoli, in the Ciliate Tetrahymena thermophila Mol. Cell. Biol., June 15, 2006; 26(12): 4690 - 4700. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Cobbe, E. Savvidou, and M. M. S. Heck Diverse Mitotic and Interphase Functions of Condensins in Drosophila Genetics, February 1, 2006; 172(2): 991 - 1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Stray, N. J. Crisona, B. P. Belotserkovskii, J. E. Lindsley, and N. R. Cozzarelli The Saccharomyces cerevisiae Smc2/4 Condensin Compacts DNA into (+) Chiral Structures without Net Supercoiling J. Biol. Chem., October 14, 2005; 280(41): 34723 - 34734. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-D. Wang, D. Eyre, M. Basrai, M. Lichten, and A. Strunnikov Condensin Binding at Distinct and Specific Chromosomal Sites in the Saccharomyces cerevisiae Genome Mol. Cell. Biol., August 15, 2005; 25(16): 7216 - 7225. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Savvidou, N. Cobbe, S. Steffensen, S. Cotterill, and M. M. S. Heck Drosophila CAP-D2 is required for condensin complex stability and resolution of sister chromatids J. Cell Sci., June 1, 2005; 118(11): 2529 - 2543. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Moore, G. Stanvitch, M. B. Roth, and D. Rosen HCP-4/CENP-C Promotes the Prophase Timing of Centromere Resolution by Enabling the Centromere Association of HCP-6 in Caenorhabditis elegans Mol. Cell. Biol., April 1, 2005; 25(7): 2583 - 2592. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Machin, J. Torres-Rosell, A. Jarmuz, and L. Aragon Spindle-independent condensation-mediated segregation of yeast ribosomal DNA in late anaphase J. Cell Biol., January 17, 2005; 168(2): 209 - 219. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Watrin and V. Legagneux Contribution of hCAP-D2, a Non-SMC Subunit of Condensin I, to Chromosome and Chromosomal Protein Dynamics during Mitosis Mol. Cell. Biol., January 15, 2005; 25(2): 740 - 750. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D'Amours and A. Amon At the interface between signaling and executing anaphase--Cdc14 and the FEAR network Genes & Dev., November 1, 2004; 18(21): 2581 - 2595. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ono, Y. Fang, D. L. Spector, and T. Hirano Spatial and Temporal Regulation of Condensins I and II in Mitotic Chromosome Assembly in Human Cells Mol. Biol. Cell, July 1, 2004; 15(7): 3296 - 3308. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Takemoto, K. Kimura, S. Yokoyama, and F. Hanaoka Cell Cycle-dependent Phosphorylation, Nuclear Localization, and Activation of Human Condensin J. Biol. Chem., February 6, 2004; 279(6): 4551 - 4559. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Lavoie, E. Hogan, and D. Koshland In vivo requirements for rDNA chromosome condensation reveal two cell-cycle-regulated pathways for mitotic chromosome folding Genes & Dev., January 1, 2004; 18(1): 76 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-G. Yu and D. E. Koshland Meiotic condensin is required for proper chromosome compaction, SC assembly, and resolution of recombination-dependent chromosome linkages J. Cell Biol., December 8, 2003; 163(5): 937 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Coelho, J. Queiroz-Machado, and C. E. Sunkel Condensin-dependent localisation of topoisomerase II to an axial chromosomal structure is required for sister chromatid resolution during mitosis J. Cell Sci., December 1, 2003; 116(23): 4763 - 4776. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Watrin, F. Cubizolles, H. B. Osborne, K. Le Guellec, and V. Legagneux Expression and Functional Dynamics of the XCAP-D2 Condensin Subunit in Xenopus laevis Oocytes J. Biol. Chem., July 3, 2003; 278(28): 25708 - 25715. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Wignall, R. Deehan, T. J. Maresca, and R. Heald The condensin complex is required for proper spindle assembly and chromosome segregation in Xenopus egg extracts J. Cell Biol., June 23, 2003; 161(6): 1041 - 1051. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Trelles-Sticken, J. Loidl, and H. Scherthan Increased ploidy and KAR3 and SIR3 disruption alter the dynamics of meiotic chromosomes and telomeres J. Cell Sci., June 15, 2003; 116(12): 2431 - 2442. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Uzbekov, E. Timirbulatova, E. Watrin, F. Cubizolles, D. Ogereau, P. Gulak, V. Legagneux, V. Ju. Polyakov, K. Le Guellec, and I. Kireev Nucleolar association of pEg7 and XCAP-E, two members of Xenopus laevis condensin complex in interphase cells J. Cell Sci., May 1, 2003; 116(9): 1667 - 1678. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Cuvier and T. Hirano A role of topoisomerase II in linking DNA replication to chromosome condensation J. Cell Biol., March 3, 2003; 160(5): 645 - 655. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Cortes and N. Pastor Induction of endoreduplication by topoisomerase II catalytic inhibitors Mutagenesis, March 1, 2003; 18(2): 105 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mehta, X. M. Yang, C. S. Chan, M. J. Dobson, M. Jayaram, and S. Velmurugan The 2 micron plasmid purloins the yeast cohesin complex: a mechanism for coupling plasmid partitioning and chromosome segregation? J. Cell Biol., August 19, 2002; 158(4): 625 - 637. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Hagstrom, V. F. Holmes, N. R. Cozzarelli, and B. J. Meyer C. elegans condensin promotes mitotic chromosome architecture, centromere organization, and sister chromatid segregation during mitosis and meiosis Genes & Dev., March 15, 2002; 16(6): 729 - 742. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Lavoie, E. Hogan, and D. Koshland In vivo dissection of the chromosome condensation machinery: reversibility of condensation distinguishes contributions of condensin and cohesin J. Cell Biol., March 4, 2002; 156(5): 805 - 815. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hirano The ABCs of SMC proteins: two-armed ATPases for chromosome condensation, cohesion, and repair Genes & Dev., February 15, 2002; 16(4): 399 - 414. [Full Text] [PDF] |
||||
![]() |
O. A. Cabello, E. Eliseeva, W. He, H. Youssoufian, S. E. Plon, B. R. Brinkley, and J. W. Belmont Cell Cycle-dependent Expression and Nucleolar Localization of hCAP-H Mol. Biol. Cell, November 1, 2001; 12(11): 3527 - 3537. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Biggins, N. Bhalla, A. Chang, D. L. Smith, and A. W. Murray Genes Involved in Sister Chromatid Separation and Segregation in the Budding Yeast Saccharomyces cerevisiae Genetics, October 1, 2001; 159(2): 453 - 470. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Thrower and K. Bloom Dicentric Chromosome Stretching during Anaphase Reveals Roles of Sir2/Ku in Chromatin Compaction in Budding Yeast Mol. Biol. Cell, September 1, 2001; 12(9): 2800 - 2812. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Strunnikov, L. Aravind, and E. V. Koonin Saccharomyces cerevisiae SMT4 Encodes an Evolutionarily Conserved Protease With a Role in Chromosome Condensation Regulation Genetics, May 1, 2001; 158(1): 95 - 107. [Abstract] [Full Text] |
||||
![]() |
S. Laloraya, V. Guacci, and D. Koshland Chromosomal Addresses of the Cohesin Component Mcd1p J. Cell Biol., November 20, 2000; 151(5): 1047 - 1056. [Abstract] [Full Text] [PDF] |
||||
![]() |
Hartman, Stead, Koshland, and Guacci Pds5p Is an Essential Chromosomal Protein Required for both Sister Chromatid Cohesion and Condensation in Saccharomyces cerevisiae J. Cell Biol., October 30, 2000; 151(3): 613 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kimura and T. Hirano Dual roles of the 11S regulatory subcomplex in condensin functions PNAS, October 4, 2000; (2000) 220326097. [Abstract] [Full Text] |
||||
![]() |
K. Kimura, O. Cuvier, and T. Hirano Chromosome Condensation by a Human Condensin Complex in Xenopus Egg Extracts J. Biol. Chem., February 16, 2001; 276(8): 5417 - 5420. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kimura and T. Hirano Dual roles of the 11S regulatory subcomplex in condensin functions PNAS, October 24, 2000; 97(22): 11972 - 11977. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Lavoie, E. Hogan, and D. Koshland In vivo dissection of the chromosome condensation machinery: reversibility of condensation distinguishes contributions of condensin and cohesin J. Cell Biol., March 4, 2002; 156(5): 805 - 815. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bhalla, S. Biggins, and A. W. Murray Mutation of YCS4, a Budding Yeast Condensin Subunit, Affects Mitotic and Nonmitotic Chromosome Behavior Mol. Biol. Cell, February 1, 2002; 13(2): 632 - 645. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||