|
|
|
|
Vol. 11, Issue 5, 1631-1643, May 2000
and
*Department of Genetics, Kassel University, 34132 Kassel, Germany;
and
Abteilung Zellbiologie, Max-Planck-Institut
für Biochemie, D-82512 Martinsried, Germany
| |
ABSTRACT |
|---|
|
|
|---|
Discoidin I expression was used as a marker to screen for mutants
affected in the growth-differentiation transition (GDT) of
Dictyostelium. By REMI mutagenesis we
have isolated mutant 2-9, an overexpressor of discoidin I. It displays
normal morphogenesis but shows premature entry into the developmental
cycle. The disrupted gene was denominated gdt1. The
mutant phenotype was reconstructed by disruptions in different parts of
the gene, suggesting that all had a complete loss of function.
gdt1 was expressed in growing cells; the levels of
protein and mRNA appear to increase with cell density and rapidly
decrease with the onset of development. gdt1 encodes a
175-kDa protein with four putative transmembrane domains. In the C
terminus, the derived amino acid sequence displays some
similarity to the catalytic domain of protein kinases. Mixing experiments demonstrate that the gdt1
phenotype is cell autonomous. Prestarvation factor is secreted at
wild-type levels. The response to folate, a negative regulator of
discoidin expression, was not impaired in gdt1 mutants.
Cells that lack the G protein
2 display a loss of discoidin
expression and do not aggregate.
gdt1
/G
2
double mutants show no aggregation but strong discoidin expression. This suggests that gdt1 is a negative regulator of the GDT downstream of or in a parallel pathway to G
2.
| |
INTRODUCTION |
|---|
|
|
|---|
The process of a cell switching from proliferation to differentiation is of general importance not only for the development of multicellular organisms but also for the initiation of malignant transformation, in which this process is reversed. Similar to most higher eukaryotic cells, extracellular signals control the transition from growth to development in Dictyostelium discoideum. The elucidation of these signals and their pathways toward the switch in the genetic program may provide insights into general mechanisms for the initiation of differentiation.
The life cycle of D. discoideum consists of two distinct
phases: growth and development, which can be easily manipulated in the
laboratory. At the growth-differentiation transition (GDT), the
discoidin I gene family is among the first to be activated and thus
considered an excellent marker for the onset of differentiation (Endl
et al., 1996
). Transcription of discoidin I is undetectable when cells feed on bacteria. When the food supply decreases, expression is induced and later down-regulated by the cAMP signaling cascade. Discoidin I is a facultative marker for the GDT: expression is not
required for development, nor does discoidin expression lead to
obligatory development. This is demonstrated by
discnull and discover
mutants, which undergo relatively normal development: both display mature fruiting bodies, although discnull cells
do not stream but aggregate by random collision (Alexander et
al., 1983
; Crowley et al., 1985
), whereas
discover mutants frequently display a ragged
colony shape and broad growth edges (U. Huitl and W. Nellen,
unpublished observations). Furthermore, discoidin is continuously
expressed at high levels during growth in axenic medium (Blusch
et al., 1995
).
During exponential growth on bacteria, Dictyostelium cells
continuously secrete a factor denominated prestarvation factor (PSF)
into the extracellular medium (Clarke et al., 1988
). Cells measure the concentration of PSF in relation to signals provided by the
bacterial food source and thus calculate the density of the population
relative to the density of the remaining nutrients (Clarke et
al., 1992
). Above a threshold level of the PSF:bacteria ratio
(approximately three generations before the onset of starvation), low-level discoidin expression is initiated (Rathi et
al., 1991
). Folate represses discoidin expression when added to
axenically growing cells (Blusch and Nellen, 1994
). Similarly,
autoclaved bacteria can repress discoidin (Burdine and Clarke, 1995
).
When the food source is exhausted and cells stop growing, PSF
production declines, and a strong secondary induction of discoidin
occurs. This may be mediated by conditioned media factor (CMF),
a second secreted factor (Jain et al., 1992
), which
senses cell density and initiates differentiation or by some other
signal. The inducing signaling pathway most likely involves the
G-protein
2 (Blusch et al., 1995
), pianissmo (Chen
et al., 1997
; K. Riemann and W. Nellen, unpublished
observations), cytosolic regulator of adenylyl cyclase (CRAC), a
yet unidentified adenylyl cyclase, and PKA (Endl et al.,
1996
).
The recently characterized yakA gene (Souza et
al., 1998
), which is also involved in the GDT, may be part of the
positive pathway for discoidin and GDT regulation: YakA is required for the shutoff of growth stage genes and the induction of early
developmental genes. PufA (Souza et al., 1999
) appears to be
a translational inhibitor of PKA-C mRNA and should thus serve as a
negative regulator of the GDT. PufA is down-regulated by YakA; a
disruption of pufA can therefore partially rescue the
yakA
phenotype.
Itoh et al. (1998)
have described that overexpression
of the calcium-binding protein calfumirin-1 promotes the switch from growth to differentiation possibly by induction of the cAMP receptor 1 gene. This may, however, be a later step in the GDT, because discoidin
expression is down-regulated by extracellular cAMP via cAMP receptor
1 ~6 h after the onset of development. Down-regulation by the
receptor is independent of G
2 but can be bypassed by
Ca2+ (Endl et al., 1996
).
Several mutants with defects in discoidin regulation have been
described (Alexander et al., 1983
; Wetterauer et
al., 1993
). However, these mutants were generated by chemical
mutagenesis, and it has not yet been possible to identify the molecular
basis of the defect.
To further elucidate GDT signaling, we have used REMI
(restriction enzyme-mediated integration; Kuspa and Loomis, 1992
) to isolate mutants with defects in the expression of the discoidin I
genes. Misexpression of discoidin can be monitored by colony blots
using a monoclonal anti-discoidin antibody (Wetterauer et al., 1993
). Because colony blots are semiquantitative, expression above and below wild-type levels can be detected. From the identified mutants, the disrupted gene can be isolated. We have generated several
REMI mutants, which displayed over- or underexpression of
discoidin I. One of these was identified as a disruption in CRAC (K. Riemann and W. Nellen, unpublished data) and confirmed our previous
results that CRAC was involved in the GDT (Endl et al.,
1996
). This paper describes gdt1, a new signal transduction component,
which is a negative regulator of discoidin expression and the GDT in
D. discoideum.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Growth
D. discoideum Ax2 and the derived transformants were
grown either in AX medium (Watts and Ashworth, 1970
) or in suspension with Klebsiella aerogenes (KA) as a food source (for
details, see Endl et al., 1996
). KA was grown for 3 d
on standard bacterial medium (SM) agar plates at room
temperature and then washed off with 30 ml of phosphate buffer. The
resulting growth medium was termed 1× KA suspension.
To obtain single clones, ~50-200 Dictyostelium cells were
suspended in 100 µl of phosphate buffer (20 mM sodium phosphate, pH
6.0) containing KA and plated on SM plates (Sussman, 1951
). Plates were
grown at 22°C for 3 d, and single clones were picked and
transferred to new KA/SM plates or grown in AX medium with antibiotics
(50 µg/ml ampicillin and 100 U/ml penicillin-streptomycin).
Differentiation Conditions
Vegetative cells were harvested from bacterial suspension cultures at a density of <1 × 106 cells/ml and washed free of bacteria by differential centrifugation (1200, 1100, and 1000 rpm) in 20 mM phosphate buffer. Cells were resuspended in buffer at 2 × 107 cells/ml and allowed to develop in shaking suspension for 5 h. Axenically growing cells were harvested at 2 × 106 cells/ml, washed with phosphate buffer, resuspended at a density of 2 × 107 cells/ml, and developed in shaking suspension for 5 h.
For monitoring morphological development, cells were harvested from
axenic culture at a density of 5 × 106,
washed, and resuspended at 1 × 108
cells/ml. Cells (5 × 106) were spotted on
phosphate-agar, developed at 22°C as described (Newell et
al., 1977
), and observed microscopically.
REMI Mutagenesis
REMI mutagenesis was essentially done as described by
Kuspa and Loomis (1992)
. The ura
strain
DHI was used as the parent for REMI mutagenesis. DHI cells were grown in FM medium (Franke and Kessin, 1977
; purchased from Life Technologies, Gaithersburg, MD) supplemented with 20 µg/ml uracil. Twenty micrograms of DIV-2 vector were linearized with BamHI and electroporated into DHI cells together with 100 U
of BamHI at 2.5 kV/cm, 3.0 µF. After electroporation,
cells were distributed on five Petri dishes, and transformants were
selected in FM medium. When clones could be detected on the
plates, cells were washed off, counted, and plated in association with
KA on SM plates for cloning.
Colony Blot Screen for REMI Mutants
Clones (~0.5 cm diameter) on KA/SM plates were transferred
onto nitrocellulose filters and treated as described previously (Wallraff and Gerisch, 1991
). Discoidin expression was detected with
the monoclonal antibody 80-52-13 (Wetterauer et al., 1993
) and a phosphatase-coupled secondary goat anti-mouse antibody (Dianova, Hamburg, Germany). After antibody detection with nitro blue
tetrazolium, filters were counterstained with Ponceau S to
detect all cellular proteins. Colonies displaying no discoidin
expression and colonies showing stronger expression than wild-type
cells were picked, recloned, and blotted again to confirm the mutant
phenotype and its stability.
Genomic DNA Preparation and Southern Blot Analysis
Genomic DNA was prepared, digested with restriction enzymes as
indicated, and blotted onto nylon membranes as described previously (Nellen et al., 1987
). Probes were radiolabeled by random
priming as specified by the supplier (Stratagene, La Jolla, CA).
Isolation of a 3.7-kb Fragment of the gdt1 Gene from the REMI 2-9 Mutant
A 3.7-kb fragment was recovered from the 2-9 REMI
mutant by plasmid rescue as described (Kuspa and Loomis, 1992
). Genomic DNA from the mutant was digested with HindIII, circularized
by ligation in a diluted solution, and transformed into
Escherichia coli. A plasmid (2-9 rescue) containing 3.7 kb
of genomic sequence flanking one side of the vector insertion was recovered.
Reconstruction of gdt1 Mutants
A vector (2.9-BsR-XbaI) was
constructed by inserting the BsR cassette from
vector pUC BsR
Bam (Sutoh, 1993
) into the
XbaI site within the 3.7-kb fragment from 2-9 rescue. The
vector was cut with BamHI and BstXI to generate the 3.7-kb fragment with the BsR cassette insert.
The mixture of vector and fragment was transformed into Ax2 cells by
electroporation (2.5 kV/cm, 3 µF). The resulting gene disruptants (L
series) were selected by colony blot.
Similarly, the gdt1 gene was disrupted in the HindIII site (see Figure 2): the BsR cassette was ligated into the pGEM7Z+ vector as a HindIII-XbaI fragment, and then the 3.7-kb BamHI-HindIII fragment was added. The vector was linearized with ClaI and electroporated into Ax2 cells. The gdt1 gene was disrupted by a single-copy integration of the entire vector, and the resulting disruptants (K-series) were screened by colony blot and confirmed by Southern blots with a 32P-labeled 3.7-kb gdt1 probe.
Two more series of gene disruptants (X and D series) were generated by homologous recombination as indicated in Figure 2. In the X series, the BsR cassette and the Psp 72 vetor were inserted into the XbaI site. In the D series, the BsR cassette and pGem3 vector were inserted into the gene such that 2.6 kb downstream of the XbaI site were deleted.
PCR
PCR from genomic DNA was performed in a reaction volume of 50 µl with 1 ng of DNA, 50 pmol of oligonucleotide primers, 25 µM dNTPs, and 2.5 U of Taq polymerase (MBI Fermentas, Vilnius, Lithuania) in 1× PCR buffer (Boehringer Mannheim, Mannheim, Germany). PCR was done for 30 cycles at 94, 40, and 72°C for 1 min each. The first denaturing step was for 2 min; the last extension step was for 5 min.
For inverse PCR, 10 µg of genomic DNA from Ax2 were digested with BamHI and BglII. After phenol-chloroform extraction, the DNA was dissolved in H2O and set up for self-ligation in a volume of 100 µl. One microliter of the ligation mix was used for inverse PCR using the 5' primer CCAATCAATGATAATGATCCTCCC and the 3' primer AAAGTGAATCCTCGACAAG.
For cloning of the PCR products, the reaction mix was separated on an agarose gel, and the fragment was purified with the JETsorb DNA extraction kit (GenoMed, Beverly Hills, CA) and cloned into the T-cloning vector pUC 57 (MBI Fermentas).
RNA Isolation and Northern Blot Analysis
RNA was prepared and blotted as described previously (Maniak
et al., 1989
). Antisense in vitro transcripts of the
discoidin I
gene (Vauti et al., 1990
), the gdt1 gene, and
the V4 gene (Singleton et al., 1991
) were used for
hybridization. Blots contained equal amounts of total RNA as measured
in a spectrophotometer and confirmed by ethidium bromide staining of
rRNA after electrophoresis. Hybridization was performed at 56°C.
gt11 Library Screening
Infection-competent E. coli Y1090 were mixed with 1 µl of a
gt11 library [made from poly(A)+
RNA of vegetative Ax2 cells grown in bacterial suspension; a generous
gift from H. Freeze, La Jolla Cancer Research Foundation, La Jolla,
CA] at 5 × 106 pfu/ml and plated in
soft agar on complete medium agar in 11 × 11-cm Petri dishes.
Cells were incubated at 37°C until nearly complete lysis. DNA was
then transferred to a nylon membrane and hybridized with a
32P-labeled 3.7-kb gdt1 gene probe.
Positive plaques were picked, rescreened, and plaque purified. Inserts
were cut out with EcoRI and cloned into pGEM 3Z (Promega,
Madison, WI).
Expression and Purification of Recombinant D1
Nine hundred sixteen base pairs of the gdt1 gene (341-1257),
denominated domain 1 (D1) were amplified from plasmid 2-9 rescue by PCR
using the 5' primer TTCATAGGGAGGATCATTATCATTG and the 3' primer
TGGACCTATTACCAATG. The PCR product was cloned into the pET15b vector
(Novagen, Madison, WI). The resulting vector, D1-pET15b, was
transformed into E. coli BL 21 cells (Novagen) for
expressing D1 as a 6x His-tagged recombinant protein. Purification was
performed under denaturing conditions (20 mM sodium phosphate, 8 M
urea, and imidazole from 10 to 200 mM, pH 7.4) by using the BioLogic fast protein liquid chromatography system (Bio-Rad, Hercules, CA) and
the His Trap kit (Amersham Pharmacia Biotech, Uppsala, Sweden). The
36-kDa recombinant D1 eluted at 200 mM imidazol and was further
purified by SDS-PAGE. Antisera were generated by immunizing rabbits
with the recombinant D1 protein purified on SDS-PAGE (Ausubel et
al., 1995
). Crude serum after the third boost was used for gdt1
detection on Western blots.
Western Blots
Total protein was prepared by lysing 1-5 × 107 Dictyostelium cells in 100-500
µl of Laemmli buffer (Laemmli, 1970
). Equal amounts of protein were
separated on a 12% discontinuous polyacrylamide gel and blotted by
semidry transfer (Bjerrum, 1986
) for discoidin detection or on a
5-12% gradient SDS-PAGE and blotted by "tank transfer"
(Sartorius, Göttingen, Germany) for detection of the gdt1
protein. A discoidin monoclonal antibody (Wetterauer et al., 1993
) and a peroxidase-coupled secondary goat anti-mouse antibody (Dianova) were used for detection of discoidin; the polyclonal antiserum against recombinant D1 and a phosphatase-coupled goat anti-rabbit secondary antibody (Dianova) were used for detecting the
gdt1 protein.
-Galactosidase Assays
Cells were harvested at a density of ~1 × 106 and collected by centrifugation. Cells were
lysed by shock freezing in liquid nitrogen and thawing. Cell debris was
pelleted, and
-galactosidase activity was measured in the
supernatant by using 2-nitrophenyl-
-D-galactopyranoside as a substrate (Bühl and MacWilliams, 1991
). Activity from
contaminating Klebsiella was negligable.
PSF Measurements
To measure PSF production, Ax2 and
gdt1
cells were grown in KA suspension to
a density of 5 × 106 cells/ml. Residual
bacteria and cells were removed by centrifugation, and fresh KA were
resuspended in the conditioned buffer. Dictyostelium DAG cells, which expressed
-galactosidase under the control
of the discoidin I
promoter (Wetterauer et al., 1993
),
were inoculated into the conditioned medium and grown to a maximum
density of 106 cells/ml. To determine background
activity, DAG cells were also grown in fresh medium.
-Galactosidase
activity was determined as described above.
| |
RESULTS |
|---|
|
|
|---|
Identification of the REMI Mutant 2-9
During vegetative growth on bacteria, discoidin expression in wild-type Ax2 cells is below the detection level. In colony blots, this results in an outer ring, which is stained red by Ponceau S but not by the anti-discoidin antibody. With the onset of development, discoidin expression is induced, resulting in antibody staining of an inner ring of preaggregation cells. Even though transcription is down-regulated in later development, the discoidin protein is stable and can be detected in late stages. Because colony blots are semiquantitative, overexpression mutants, which display stronger antibody staining than the wild type, can be identified.
The 2-9 mutant was detected in a REMI screen as a discoidin
overexpressor (Figure 1A). In contrast to
wild-type colonies, discoidin protein was found in cells beyond the
visible border of the colony, i.e., in growing cells that have
sufficient supply of nutrients. In addition, 2-9 mutant cells
aggregated close to the growing edge and even on the bacteria lawn.
This resulted in a ragged colony shape compared with the smooth edge
observed in wild-type clones. (Figure 1B). A similar phenotype was
observed in the discoidin overexpression mutants isolated by Alexander et al. (1983)
(W. Nellen and U. Huitl, unpublished
observations).
|
In wild-type Ax2 cells, discoidin expression is induced approximately
three generations before the onset of starvation and then increases
precociously (Wetterauer et al., 1995
). Cells of the wild
type and of a gdt1
mutant (L8, see below)
were grown in bacterial suspension culture and harvested at densities
of 1 × 106, 2 × 106, and 5 × 106
cells/ml. Expression of discoidin I was monitored on Northern blots
using an in vitro transcript of the discoidin I
gene as a
hybridization probe. Figure 1C shows significant amounts of mRNA at low
cell density in the mutant but not in the wild type. Western blots (see
Figure 8; our unpublished data) also confirmed that discoidin
was significantly increased in growing
gdt1
cells compared with the Ax2 wild type.
To further confirm premature induction of discoidin expression, Ax2 and
gdt1
cells were grown in
Klebsiella suspensions of different densities (0.5, 1.5, and
3×) to a titer of 106 cells/ml. In wild-type
cells, a low supply in nutrients induces discoidin expression at lower
cell densities, whereas a high supply shifts expression to higher cell
densities. As expected, discoidin expression was only detected at the
reduced (0.5×) KA concentration in wild-type cells. For
gdt1
cells, strong expression was still
observed even at 3× bacterial concentration (Figure 1D). Nevertheless,
the amounts of discoidin protein were reduced with increasing density
of the food source. The data demonstrated that
gdt1
cells could still sense the
concentration of the food source but were less sensitive.
It was possible was that gdt1
cells
produced more PSF and thus overestimated their own population density.
We prepared conditioned buffer from gdt1
and from Ax2 cells and used this to grow DAG cells. Discoidin promoter
activity was measured by
-galactosidase assay. As expected, the
crude PSF preparation induced
-galactosidase in comparison with
fresh buffer. Conditioned medium from high-density cells had a stronger
effect than that from lower-density cells (our unpublished results). No
significant difference was, however, found between conditioned buffer
from Ax2 and gdt1
cells (Figure 1E). This
indicated that premature discoidin induction in the mutant strain was
not due to an overproduction of PSF.
To see whether the cell cycle with the onset of starvation was
affected by the mutation, we monitored cell density in submerged cultures and in suspension cultures after transfer of the cells from
bacterial suspension into phosphate buffer. For both
gdt1
and Ax2 cells we found that
approximately half of the cells completed one round of cell division
within the first 2 h in starvation buffer; after that, cell
numbers remained constant for at least another 2 h (our
unpublished data).
Taken together, the data demonstrate that the mutant prematurely entered the GDT (as defined by discoidin expression) at low cell densities. This was not due to overexpression of PSF but rather to a less-sensitive measuring of the food source. Cell division after the onset of starvation was not changed in the mutant strain compared with wild type.
Reconstruction of the 2-9 Phenotype in Ax2 Cells
Part of gdt1 was isolated from mutant 2-9 by
plasmid rescue using HindIII-digested genomic DNA. Thus, one
flanking genomic sequence of the gdt1 gene of 3.7 kb could
be cloned (Figure 2). The insert was used
as a hybridization probe on a genomic Southern blot containing
HindIII-digested DNA from strains DH1, Ax2, 2-9, and a
reconstructed gdt1
mutant, L8. The
11.2-kb wild-type fragment in Ax2 DNA, the 6.5-kb fragment in 2-9 cells, and two fragments of 4.5 and 8.1 kb in the reconstructed mutant
L8 (see below) agreed with the disruptions depicted in Figure 2 (our
unpublished data).
|
The mutant phenotype was reconstructed in several ways: in the L series, the genomic sequence was disrupted in the XbaI site; the K series contained a duplication and a disruption at the genomic HindIII site; and in the D series 2.6 kb of coding sequence were deleted. X series transformants were similar to the L series in that they were disrupted at the XbaI site, but they contained a complete plasmid as an insert. From all transformations, several discoidin overexpressor clones were identified by colony blot and found to be identical in phenotype to the original mutant 2-9. Further analysis by Southern blot confirmed the disruption of gdt1. The reconstructed mutants differed from the original in that they were in the Ax2 background and that they carried the blasticidine resistance cassette instead of the pyr5-6 gene. Furthermore, because the BamHI site and the HindIII site are located at opposite ends of the 3.7-kb gene fragment, and all disruptions resulted in the same phenotype, this suggested a continuous gene over this stretch of DNA. For most of the further experiments L8, a clone from the L series, was used because it had a short insert and was in the genetic background of the common laboratory strain Ax2.
Sequence Analysis of the gdt1 Gene
Sequence analysis revealed an open reading frame (ORF) over the entire 3.7-kb fragment, but no initiation or termination codon was found. Further gene sequence was obtained by plasmid rescue with BglII from X series mutants. The fragment contained a 191-bp ORF in frame with the 3.7-kb fragment and started with an ATG. Surprisingly, two other short ORFs, potentially encoding peptides of five and six amino acids, preceded the ORF of gdt1 (see DISCUSSION).
Several approaches were used to isolate the 3' end of gdt1: cDNA library screening, inverse PCR, and plasmid rescue from D series disruptants using SmaI-EcoRV digests. All fragments confirmed previous sequence and/or added new data. The continuous ORF was closed with a TAA stop codon 755 bp downstream of the HindIII site.
Potential AATAAA polyadenylation signals were detected 29, 1003, 1051, 1233, 1380, and 1634 downstream of the stop codon. The last poly(A) signal was probably used, because it agreed with the mRNA size in Northern blots and a corresponding fragment was obtained by 3'-rapid amplification of cDNA ends (our unpublished data).
Within the putative 3' untranslated region, several palindromes were
found, which may serve as RNA destabilization elements: a potential
stem-loop-destabilizing element (Brown et al., 1996
) 4922UUGGGAC-4948GUCCCAA, is
located 123 bp after the stop codon, and many UUAUUUAU and CCAA (or
UUGG) repeats are found. Preliminary data showed that the 3' truncated
gdt1 mRNA in the L8 mutant accumulated to higher levels and
appeared to be more stable (Figure 3; B. Wetterauer, personal communication).
|
Overall, almost 12 kb of the gdt1 gene locus have been isolated. These
include 4683 bp of the gdt1 coding region, 1895 bp of 3' flanking
region, and 113 bp of 5' flanking region (European Molecular Biology
Laboratory [EMBL] database, accession number AJ000992). Approximately
2.8 kb upstream of the gdt1 gene, an ORF encoding a putative cationic
amino acid transporter was detected in the opposite orientation (EMBL
database, accession number AJ005263). Still further upstream there was
a 1114-bp ORF encoding the 3' end of a putative glycoprotein with some
similarity to csA (EMBL database, accession number AJ005262; Noegel
et al., 1986
).
The gdt1 Gene Is Expressed in Vegetative Cells Only and Encodes a 175-kDa Membrane Protein with a Putative Kinase Domain
gdt1 is weakly transcribed to an ~7-kb mRNA during growth. With the onset of development, the mRNA was rapidly lost (Figure 3A). Interestingly, the L8 mutant displayed a truncated mRNA of 1.2 kb, which appeared more abundant than the full-size message (Figure 3B), suggesting that the full-length mRNA contained destabilizing elements, which were lost in the shorter message. The expression pattern of gdt1 was also confirmed by Western blots (Figure 3C) with a polyclonal antiserum directed against the recombinant D1 peptide (see Figure 4A). The 175-kDa gdt1 protein was only detected in Ax2 vegetative cells but not after 5 h of development and not in the L8 mutant.
The gdt1 gene product contains 1561 amino acids (Figure
4A) and has a calculated pI of 7.15 and a
calculated molecular mass of 175,292 Da. Analysis by the EMBL
TMpred program predicted four transmembrane domains (TM1-TM4) with the
direction of N-i-o-i-o-i-C as indicated in Figure 4A. Western blotting
of fractionated cells confirmed the membrane localization of the gdt1
protein (our unpublished results).
|
Comparison of gdt1 with different databases indicated
similarity of the C-terminal 320 residues with the catalytic domain of
protein kinases (Figure 4B). When the repetitive sequence
N2SN2SN20SN2SN2S3, was removed for the analysis (Figure 4A, *) good alignments were found
with all 11 subdomains (reviewed by Hanks and Hunter, 1995
) in the
serine/threonine and tyrosine kinase families; however, some highly
conserved signatures of kinases were missing. The best similarity was
found with a nonreceptor serine/threonine kinase in
Entamoeba (ENHPSTK-1), a small 290-amino-acid cytoplasmic protein of the mos family (Lohia and Samuelson, 1994
). However, this
was mostly due to sequence before the "glycine-rich loop," which is
usually not conserved among protein kinase.
The gdt1
Mutant Displays Slow Growth in Bacteria and
Accelerated Development
In bacterial suspension culture, L8 mutant cells grew with a generation time of 4.5 ± 0.3 h, whereas for wild-type Ax2 cells the generation time was 3.3 ± 0.3 h. However, when cells were grown in axenic medium, a similar generation time of 8 h was observed for both L8 and Ax2 (our unpublished data). This would be consistent with the assumption that the mutant has a defect in sensing of the bacterial food source.
To further investigate the defect in the developmental process, a
timing experiment was performed with the
gdt1
mutant and wild-type Ax2 as a
control. Development on phosphate-agar plates was monitored
microscopically. As shown in Figure 5, L8 cells aggregated earlier than the wild type, whereas the rest of
development was normal. In contrast, KP4 cells, which overexpress the
PKA catalytic subunit (Anjard et al., 1992
), aggregated
almost normally but then rapidly passed through tipped aggregates and formed slugs (our unpublished results). We have also monitored earlier
stages by timing morphological changes in cells starved in submerged
culture. gdt1
cells elongated ~2 h
earlier than Ax2 cells under these conditions (our unpublished data).
Taken together, this demonstrated that disruption of gdt1
specifically accelerated the GDT, whereas overexpression of PKA
predominantly affected late development.
|
The gdt1
Mutation Is Cell Autonomous
To see whether gdt1 function was cell autonomous, mixing
experiments were performed with L8 and DAG cells, which expressed
-galactosidase under the control of the discoidin I
promoter (Wetterauer et al., 1993
).
gdt1
and DAG cells were grown in
bacterial suspension to a density of <106, mixed
at the indicated ratios, and diluted to 5 × 104 cells/ml in bacterial suspension. Cells were
harvested at a density of 1 × 106 cells/ml,
and
-galactosidase expression was measured as described (Bühl
and MacWilliams, 1991
).
-Galactosidase activity, a very sensitive
indicator for discoidin promoter activity, increased proportionally to
the ratio of DAG cells, indicating that
gdt1
cells do not release an
extracellular factor to significantly stimulate the expression of
discoidin in the wild-type background (Table
1).
|
The reverse experiment was done by mixing
gdt1
and Ax2 cells as described above and
measuring discoidin protein expression by Western blot (Figure
6). At a cell density of
106 cells/ml, discoidin is undetectable in Ax2
cells (in contrast to
-galactosidase activity directed by a
discoidin promoter as assayed before). The amount of discoidin protein
detected in the blot therefore originates exclusively from the
gdt1
cells. The expression of discoidin I
increased proportionally with the ratio of the
gdt1
cells, and no significant inhibition
was observed. The data demonstrated that wild-type cells did not
produce any extracellular signal that could complement the mutation in
L8 cells. The mutant could therefore be considered cell autonomous.
|
The gdt1
Mutant Is Not Affected in Sensing of Folate
Folate is known as an extracellular signal that inhibits discoidin
expression. In axenic medium, discoidin is expressed at moderate
to high levels even at low cell densities. To determine whether the
gdt1
phenotype was due to a loss of
sensitivity to folate, cells were grown in axenic medium and treated
for various times with 1 mM folate while cell density was kept at or
<106 cells/ml. As shown in Figure
7, discoidin was essentially undetectable in wild-type cells after 19 h of folate treatment. As expected, gdt1
cells produced considerably higher
amounts of discoidin, but they clearly decreased when cells were
cultivated in the presence of folate. When
gdt1
samples were diluted 10-fold, the
decrease in discoidin expression was also detectable in earlier time
points (our unpublished data). The defect in the mutant was thus not in
the folate-sensing pathway.
|
Disruption of the gdt1 Gene Partially Rescues the
G
2
Mutant Phenotype
G
2
mutants do not form
aggregates and show strongly reduced expression of discoidin when
developed after growth on bacteria (Endl et al., 1996
). To
determine the relationship between G
2 and gdt1, double mutants were
constructed by disruption of gdt1 in a
G
2
background.
Successful disruption was confirmed by Southern blot (our unpublished
data). Colony blots (Figure 8A) clearly
showed that cells with both genes disrupted still did not aggregate but expressed high amounts of discoidin during growth on bacteria and in
development. This was confirmed in Western blots (Figure 8B), which
showed that the double mutant expressed discoidin at similar levels as
the gdt1
mutant. Disruption of gdt1
could thus partially complement the defect in the
G
2
mutant, suggesting
that the negative regulator gdt1 was downstream of
G
2
in the same pathway or in a parallel
signaling cascade.
|
| |
DISCUSSION |
|---|
|
|
|---|
To further elucidate the signal transduction pathways involved in
the GDT, we have screened REMI mutants for misregulation of
discoidin I expression. A mutant (2-9) was identified because of
overexpression of discoidin I and premature aggregation (Figure 1).
gdt1 mutants were different from other signal transduction mutants identified to date: they did not affect aggregation per se,
were not sporogenous (our unpublished data), and did not show any
obvious effect on the morphology during development or on spore and
stalk differentiation. Previously identified mutants displaying rapid
aggregation (e.g., rdeA [Abe and Yanagisawa, 1983
]) or rapid
development (e.g., rdeB, rdeC [Abe and Yanagisawa, 1983
] and KP
[Anjard et al., 1992
]) were all sporogenous and formed abnormal fruiting bodies. This indicated that gdt1 was predominantly involved in the GDT pathway but was not substantial for later development. In agreement with this, gdt1 disruptants
expressed the GDT marker discoidin prematurely at low cell densities.
gdt1 mutants spread out to more abundant resources and
switched at lower cell densities from growth to differentiation,
probably because of an incorrect interpretation of the cell
density:food source ratio. Early aggregation and spreading into the
bacterial lawn could be due to a constitutive or enhanced prestarvation response (Clarke et al., 1988
). However, the respective PSF
signal only results in very-low-level discoidin expression (U. Huitl and W. Nellen, unpublished results; Endl et
al., 1996
), and we have shown here that PSF production is
apparently not enhanced in the mutant. The observation that the mutant
is cell autonomous also argues against overproduction of a secreted
factor. Although we cannot yet exclude an oversensitivity of
gdt1
cells to PSF, we rather assume that
the mechanisms to sense the quantity of the food source are impaired
although not abolished.
gdt1 RNA and protein are detected in growing cells, and both rapidly disappear with the onset of development. Even though gdt1 protein was not seen in cells at low density (5 × 105; Figure 3C), it is most likely present because even at lower densities (1 × 105) discoidin overexpression was observed in the disruption mutant. Apparently, gdt1 levels increased with cell density, suggesting that increasing amounts of the protein are required to inhibit increasing competence of the cells to enter the GDT. This was supported by the observation that in the gdt1 mutants discoidin was not constitutively expressed but precociously accumulated with cell density. We therefore propose that cells gradually acquire developmental competence during growth; this competence is, however, suppressed by increasing amounts of gdt1. Above a certain cell density, suppression is released, and they synchronously enter the GDT.
To confirm that gdt1 was not only a specific inhibitor of discoidin
expression but had a general function in the GDT, we examined the
expression of the V4 gene (Singleton et al., 1991
),
which is specifically expressed in vegetative cells and rapidly
switched off with the onset of development. V4 expression was strongly reduced in gdt1
cells even at low
densities during bacterial growth (our unpublished data).
Suppression of developmental competence may be released by different
means; one is obviously the rapid loss of gdt1 mRNA and protein when cells enter development. In the mRNA, several putative destabilization elements in the unusually long 3' untranslated region
may account for the apparent short half-life of the mRNA (Brown
et al., 1996
). This assumption is supported by the
observation that the truncated 1.2-kb gdt1 transcript in the
L8 mutant appeared more stable than the complete mRNA (Figure 3B; B. Wetterauer, unpublished observations). In the 5' region, two short
upstream ORFs were found, which are often involved in
translational regulation (for review, see Geballe and Morris, 1994
) and
may prevent further translation of gdt1 with the onset of development.
In the N-terminal part, the gdt1 protein revealed no significant
similarity to sequences in the databases. However, four putative transmembrane domains were predicted by computer analysis. This was
supported by a strong enrichment of gdt1 in the membrane fraction (our
unpublished data). No signal peptide for membrane insertion was found
in the sequence, unless one assumes that TM1, which is, however, rather
far from the N terminus, serves this function. Many polytopic
transmembrane proteins such as, e.g., the Dictyostelium adenylyl cyclase A (Pitt et al., 1992
) do not require signal
peptides (Bibi, 1998
). The C terminus of the gdt1 protein displayed
some similarity to the catalytic domain of protein kinases. However, some of the highly conserved kinase signatures were not found. In the
original REMI mutant, gdt1 was disrupted within
the second transmembrane domain, the L8 mutant carried a disruption in
the intracellular loop between TM2 and TM3, and the K series mutants had an insertion just before the C-terminal kinase-like domain. Because
all disruptants displayed the same phenotype, none of them apparently
expressed a partially functional protein.
First experiments to elucidate the position of the gdt1 protein in the signal transduction cascades demonstrated that it was apparently not involved in sensing folate, an inhibitor of discoidin expression.
Interestingly, double mutants disrupted in the gene encoding the
G-protein
2 and in gdt1 partially bypassed the defect in G
2
mutants: although
the cells were still aggregation deficient, they expressed high levels
of discoidin. We have previously shown that G
2 is part of a positive
signaling pathway via CRAC and PKA leading to high discoidin expression
(Endl et al., 1996
; Primpke et al.,
2000
). The data presented here suggest that gdt1 is located downstream of G
2 and that the positive pathway may function by inactivation of the inhibitory gdt1 protein. Alternatively, gdt1 may be
in a parallel, interacting pathway. The idea that discoidin expression
is controlled by a network of pathways was already proposed by
Alexander et al. (1986
, 1990
). It should be noted that the
double mutant also shows that G
2-mediated signaling apparently
splits into two branches: although the GDT (i.e. discoidin expression)
can be rescued by gdt1 disruption, morphological development cannot.
The REMI technique and the use of discoidin as a marker for
molecular analysis of the GDT has proven to be successful: a screen revealed a signal transduction component, which may be a new type of
receptor kinase that responds to food supply. Further experiments are,
however, required to examine whether the protein really has kinase
activity. In addition, gdt1 confirmed our previous
suggestion that the first steps into differentiation occur in the
absence of any visible morphological development (Endl et
al., 1996
).
| |
ACKNOWLEDGMENTS |
|---|
We thank H. Freeze for kindly providing the
gt11 cDNA
library. W.F. Loomis and N. Iranfar are acknowledged for performing part of the sequencing in the frame of the Dictyostelium
genome project. We thank S. Hanks for helpful comments on the putative kinase domain. B. Wetterauer, K. Salger, and G. Primpke contributed to
this work by helpful discussions and by communicating unpublished data.
P. Zahnwetzer and S. Wille are acknowledged for excellent technical
assistance. This work was supported by Deutsche Forschungsgemeinschaft grant Ne 285/5 to W.N. C.A. is a recipient of European Molecular Biology Organization fellowship ALTF 560-1996.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
nellen{at}hrz.uni-kassel.de.
| |
REFERENCES |
|---|
|
|
|---|
separate but related pathways control chemotaxis and gene regulation.
Mol. Microbiol.
11, 331-335[Medline].