|
|
|
|
Vol. 11, Issue 5, 1753-1764, May 2000

Departments of Biology and Chemistry, Indiana University, Bloomington, Indiana 47405-3700
Submitted December 20, 1999; Revised March 1, 2000; Accepted March 3, 2000| |
ABSTRACT |
|---|
|
|
|---|
In vitro DNA-binding assays demonstrate that the heat shock transcription factor (HSF) from the yeast Saccharomyces cerevisiae can adopt an altered conformation when stressed. This conformation, reflected in a change in electrophoretic mobility, requires that two HSF trimers be bound to DNA. Single trimers do not show this change, which appears to represent an alteration in the cooperative interactions between trimers. HSF isolated from stressed cells displays a higher propensity to adopt this altered conformation. Purified HSF can be stimulated in vitro to undergo the conformational change by elevating the temperature or by exposing HSF to superoxide anion. Mutational analysis maps a region critical for this conformational change to the flexible loop between the minimal DNA-binding domain and the flexible linker that joins the DNA-binding domain to the trimerization domain. The significance of these findings is discussed in the context of the induction of the heat shock response by ischemic stroke, hypoxia, and recovery from anoxia, all known to stimulate the production of superoxide.
| |
INTRODUCTION |
|---|
|
|
|---|
Since its discovery in 1962 (Ritossa, 1962
), the heat shock
response has been the focus of intensive investigation, leading to
significant insights into protein folding and global gene regulation. In virtually all organisms, the heat shock response is manifested as
the stress-induced, rapid, and dramatic increase in synthesis rates of
a small number of protein chaperones. The chaperones bind to partially
unfolded proteins and act to prevent their aggregation and to
facilitate their refolding. Thus, this highly conserved system serves
as an intricate means to protect cells against damage resulting from
environmental stress.
The most common stresses that induce the heat shock response are
elevated temperature and oxidative stress. The latter is particularly
important medically, because it typically results from the production
of superoxide anion that occurs during partial oxygen deprivation or
during the recovery from anoxia that occurs upon reperfusion after
ischemia. Induction of the heat shock system upon recovery from anoxia
may be universal; it has been described not only in mammalian systems
but in Drosophila (Ritossa, 1964
) and yeast (Brazzell and
Ingolia, 1984
). It has been unclear, however, how reperfusion triggers
the heat shock response. Superoxide is rapidly converted to hydrogen
peroxide, which can stimulate the production of the highly reactive
hydroxyl radical, which, in turn, causes considerable "reperfusion
damage." Thus, the heat shock response could be induced directly via
one or more of these reactive oxygen species, or it could be induced by
the protein damage caused by the hydroxyl radical.
In eukaryotes, the heat shock response depends on modulating the
activity (rather than the concentration) of a transcription factor. The
heat shock transcription factor (HSF) is synthesized constitutively;
its activity is regulated posttranslationally. Despite this
commonality, different species show remarkably dissimilar HSF proteins.
Furthermore, there is diversity in the mechanisms of regulation of HSF
activity. For example, under nonstressed conditions, metazoans
sequester the majority of HSF as chaperone-bound monomers within the
cytoplasm; upon heat-shock, HSF monomers undergo an intramolecular
rearrangement that allows HSF subunits to trimerize (Mosser et
al., 1990
; Abravaya et al., 1992
; Baler et
al., 1992
, 1993
, 1996
; Rabindran et al., 1993
; Westwood
and Wu, 1993
; Zuo et al., 1994
; Shi et al., 1998
;
Zou et al., 1998
). Trimers bind DNA and facilitate
transcription. Despite the apparent simplicity, transcriptional
activation is not a necessary consequence of DNA binding. Treatment of
human cells with salicylate induces HSF to trimerize and bind DNA but
not to activate transcription (Jurivich et al., 1992
). This
suggests that there are at least two activation steps for metazoan HSF,
one of which occurs subsequent to DNA binding.
HSF from Saccharomyces cerevisiae and Kluyveromyces
cerevisiae (but not HSF from Schizosaccharomyces pombe)
behaves differently from metazoan HSFs. Budding yeast HSF trimerizes
and binds to promoters before stress (Jakobsen and Pelham, 1988
; Gross
et al., 1990
). Nonetheless, upon heat shock, the level of
HSF-dependent transcription is enhanced. This suggests that yeast HSF
can exist in two conformations, an unstressed "low-activity"
conformation and a stressed "high-activity" conformation. The
analysis of deletions and gene fusions suggests that these two
conformations differ in that the transcriptional activation domains are
buried, or masked, in the low-activity form (Nieto-Sotelo et
al., 1990
; Sorger, 1990
; Bonner et al., 1992
).
To date, most of the analyses of conformational differences between HSF
from nonshocked versus heat-shocked cells have focused on the metazoan
monomer-to-trimer transition (Rabindran et al., 1993
;
Westwood and Wu, 1993
; Zuo et al., 1994
). Yet, the
effects of salicylate on human HSF (Jurivich et al., 1992
)
and the natural DNA-bound state of yeast HSF (Gross et al.,
1990
; Giardina and Lis, 1995
) suggest that functionally significant
conformational differences may occur subsequent to DNA binding. In this
study, we have sought to address the issue of a heat shock-dependent conformational change in DNA-bound HSF. Specifically, we have examined
the DNA-binding patterns of single or multiple HSF trimers to synthetic
heat shock elements (HSEs) in vitro and sought to determine the
nature of the signals that trigger the HSF conformational change.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
-Galactosidase assays were performed as described previously
(Breeden and Nasmyth, 1985
; Bonner et al., 1994
). Reagents
and human and Escherichia coli superoxide
dismutases were purchased from Sigma (St. Louis, MO). Molecular and
yeast manipulations were performed as described by Sambrook et
al. (1989)
and Sherman et al. (1986)
.
Strains and Plasmids
Yeast strain YJB341 (Torres and Bonner, 1995
) was used for
-galactosidase assays after transformation with plasmids carrying various alleles of the HSF1 gene and expulsion of the
resident plasmid by selection on 5-fluoro-orotic acid. The
protease-deficient strain YJB270 (Torres and Bonner, 1995
) was used
similarly for the preparation of protein extracts.
The plasmid pJB398 was constructed as the wild-type HSF1
plasmid to which other alleles were compared; it carries the
EcoRI-XhoI genomic fragment cloned into
YEplac181 (Gietz and Sugino, 1988
) and has been modified to carry
additional BglII and KpnI sites at codons 268 and
440, respectively. This plasmid was modified as follows. To construct
HSF1-583, we inserted an oligonucleotide
carrying stop codons in all three reading frames into the
StuI site at codon 583. To construct
HSF1-424, we used oligonucleotide-directed
mutagenesis to insert a stop codon at codon 425 and XhoI
sites at codons 426 and 833; the material between 426 and 833 was
deleted. To construct HSF161-833, we constructed
PCR primers to amplify HSF from codons 161 to 833, with the stop codon
intact, with the addition of BamHI sites for insertion into
the BglII site of YCpGAL3 (Bonner,
1991
). Mutant L269P was generated by PCR mutagenesis (Torres and
Bonner, 1995
), mutant F261L, I272L was generated by mutagenesis with an
oligonucleotide carrying 1% random bases, and other mutants were
generated by oligo-directed mutagenesis as described previously
(Torres and Bonner, 1995
). For HSF purification, a 6-histidine tag was
inserted at codon 832 by oligonucleotide-directed mutagenesis. All
mutations were verified by sequencing.
Gel Mobility Shift DNA-Binding Assays
Extracts were prepared and used in gel mobility shift
DNA-binding assays as described previously (Bonner et al.,
1994
). The DNA probes used in the assays were BS4T
(GGGATCCTGTGAAGCTTCCTGAAGCTTCCTAGAGTCGACCTGCAG) and BS6T
(CATGACGTCGACCCTGAAGCTTCTAGAAGCTTCTAGAAGCTTCCTAGAGTC-GACCTGCAG). These were rendered double-stranded by annealing to BSb
(CTGCAGGTCGACTCTAG) and extending with Sequenase (United States
Biochemical, Cleveland, OH), with [
-32P]dCTP
(Amersham, Arlington Heights, IL) to label the probe. For use as an
unlabeled competitor, BS6T was annealed to an oligonucleotide complementary to its entire length. DNA-binding incubations were 15-µl reactions containing 15 µg of whole-cell extract (or an appropriate amount of purified HSF), 1.3 ng of labeled probe, 15 ng of
bovine serum albumin, 1.5 ng of sonicated E. coli DNA, and 1 mM ATP in the binding buffer described by Sorger et al. (1987)
: 20 mM HEPES, pH 7.9, 1 mM EDTA, 60 mM KCl, 1 mM
dithiothreitol, and 12% glycerol. The addition of ATP was necessary to
dissociate bound hsp70 (Bonner et al., 2000
). For kinetic
analyses, samples were loaded onto the gel at appropriate time points;
thus earlier samples were electrophoresed somewhat longer than later samples.
Purification of HSF
The HSF1 gene in pJB398, modified to include a
6-histidine tag at the C terminus, was introduced into BJJ5457
(
ura3-52 trp1 lys2-801 leu2
1 his3
200
pep4::HIS3 prb1
1.6R can1 GAL [Jones, 1991
]) for
extract preparation. HSF was purified by chromatography on immobilized
nickel (Novagen, Madison, WI) according to the protocol supplied by Novagen.
| |
RESULTS |
|---|
|
|
|---|
Adjacent DNA-bound HSF Trimers Form a Complex That Correlates with In Vivo Activity
Our laboratory has isolated previously a mutation in yeast HSF
that shows altered regulation of activity (Bonner et al.,
1992
). The mutation M232V affects a highly conserved position within the DNA-binding domain of HSF. We have sought to understand how this
substitution causes this effect; our analysis led us to examine the
interaction between DNA-bound trimers.
The most significant aspect of this mutation is that it dramatically
elevates basal-level HSF activity. By the use of an HSE-lacZ reporter
gene to assess HSF activity levels, wild-type HSF displays low
basal-level activity before heat shock and ~20-fold higher activity
after a brief heat shock (Figure 1A). The
mutation increases basal-level activity so that it is equivalent to the
level of activity in heat-shocked wild-type cells. The mutant allele is not completely deregulated, however, because its activity is further induced approximately fivefold with heat shock.
|
To assess whether the mutant might differ from wild-type HSF in
DNA-binding ability, we examined HSF binding to a synthetic HSE that
accommodates only a single trimer (Bonner et al., 1994
). As
shown in Figure 1B, there is no detectable difference in complex formation between wild-type and mutant HSF. Both form a single complex
under nonshocked conditions. With heat shock the complexes become
somewhat more heterodisperse because of phosphorylation (Sorger and
Pelham, 1988
). We extended our analysis to include the kinetics of
binding; no difference was detected between mutant and wild type
(our unpublished observations). From these observations, we
conclude that the mutation does not affect the inherent DNA-binding ability of HSF.
Although the inherent DNA-binding ability of
HSFM232V appears normal, we thought it might be
possible that the lesion affects the ability of two bound trimers to
interact. To test this possibility, we repeated the DNA-binding assays
using a synthetic HSE that binds two HSF trimers (HSE6T; Figure 1C). On
this HSE, HSF forms three distinct complexes (I, II, and III), whose
abundances vary depending on the source of HSF. Complex I is of
identical mobility to a complex that forms on an HSE that can
accommodate a single HSF trimer (Figure 1C, compare with lane 1) and
therefore represents the binding of a single trimer to this HSE.
Complex II is of identical mobility to a complex comprised of six HSF
monomers (Bonner et al., 1994
) and thus represents the
binding of two trimers to HSE6T. Wild-type HSF from nonshocked cells
forms almost exclusively complexes I and II, whereas HSF from
heat-shocked cells forms a modest amount of complex III in addition to
complexes I and II. In previous work (using different DNA probes and
exclusively wild-type HSF [see Bonner et al., 1994
]),
complex III was either undetectable or so minor as to be overlooked.
However, complex III became very abundant when we examined
HSFM232V. Comparison of the four samples shown in
Figure 1C reveals that the amount of complex III increases with HSF
activity, showing quite clearly that the DNA-binding pattern of HSF is
affected by its in vivo activity state. These observations, in
combination with results presented below, suggest that complex III
might represent an active species of HSF.
If complex III does, indeed, represent a high-activity HSF species, its
abundance should increase in response to heat shock and decrease during
recovery from heat shock. To test this possibility, we grew cells in
rich medium to midlog phase, heat shocked them for 30 min at 37°C,
and then allowed them to readapt to 25°C for either 6 or 24 h.
We chose two time points during the readaptation period to ensure that
cells had fully recovered from the heat shock. Figure 1E tracks HSF
activity, as measured by expression of an HSE-lacZ reporter gene,
before, during, and after exposure to thermal stress. As expected, a
brief heat shock results in the induction of
-galactosidase
activity. During the recovery period, the level of
-galactosidase
activity gradually returns to preheat-shocked levels, though the
kinetics depends both on the dilution of the
-galactosidase enzyme
that was produced during the shock and on the decrease in
transcriptional activation by HSF. We observed a similar trend with
respect to complex III formation (Figure 1D); complex III was induced
by heat shock and became less abundant during recovery. Again, the
propensity to form complex III was affected by the physiological state
of the cells from which the HSF was extracted, with the cells showing
higher activity also forming more complex III. Yet, the correlation
between in vivo activity and complex III is imperfect; we therefore
sought additional evidence that might support or refute the idea that complex III might be an active form of HSF.
In addition to heat shock, other agents also induce the stress response. Here, we examined ethanol and hydrogen peroxide to determine whether they might also induce complex III formation. To test their effects, we grew cells to midlog phase and exposed them either to 6% ethanol or to 125 µM H2O2 for 30 min. Figure 1F demonstrates that these chemical agents also induce complex III formation, although to different degrees.
Together, the data presented above are consistent with the idea that complex III may represent an active conformation of HSF. Data presented below, identifying the triggers that can induce HSF to form complex III in vitro and examining the effects of additional mutations, further support this idea.
Two Adjacent DNA-bound Trimers Can Convert to Complex III
Kinetic analysis of the formation of complexes I, II, and III
(Carlson, 1998
) indicated that complexes I and II form before complex
III and then decrease in abundance as complex III appears. This
suggests that complexes I and II may serve as precursors to complex
III. Our kinetic analyses also showed that whole-cell extracts from
nonshocked cells begin to form more complex III after long incubations,
suggesting that some form of biochemical "stress" might activate
HSF in vitro. Therefore, we sought to define experimental conditions
that would test these ideas rigorously.
To determine whether nonshocked extracts could respond to heat shock in
vitro and thus generate complex III in response to stress, we performed
a series of DNA-binding reactions at different temperatures. As shown
in Figure 2A, relatively little complex III forms when the DNA-binding reaction is incubated at 25°C for 30 min, but increasing quantities of complex III form with increasing reaction temperatures. Thus, an in vitro heat shock generates conditions that favor the formation of complex III. This finding offers
the possibility of determining the biochemical conditions that lead to
complex III formation but also complicates the analysis, because the
quantity of complex III is dependent not only on the treatments to
which the cells were subjected before extract preparation but also on
the conditions of the DNA-binding assay.
|
Although it seemed logical that complex III should form by the independent binding of "activated" HSF trimers to DNA, our kinetic data (our unpublished observations) suggested that complex III actually formed by modification of preexisting complexes I or II. To determine whether complex III can form from preexisting complexes I and II, we performed a two-step incubation experiment. First, we allowed HSF to bind to labeled HSE6T probe for a time sufficient to form primarily complexes I and II, and then we added a 1000-fold excess of unlabeled HSE6T to block further binding and sampled the DNA-binding reaction over time. (This concentration of unlabeled HSE6T is sufficient to eliminate binding to the labeled probe when both are added simultaneously [Figure 2B].)
When we used nonshocked extracts for this assay (Figure 2C), we observed primarily a decrease in bound counts, consistent with the dissociation of HSF from the labeled probe (Figure 2F, quantitated by phosporimager). Nonetheless, complexes I and II disappeared more rapidly than did complex III. Indeed, there was some production of complex III even as the other complexes disappeared (Figure 2G), consistent with the idea that extracts incubated under these conditions can undergo a biochemical stress that affects HSF. The nature of this stress is described below.
When we used heat-shocked extracts for this assay (Figure 2D), we observed a similar decrease in bound counts (Figure 2F), but with a marked difference in the behavior of complexes I and II versus complex III. Complexes I and II disappeared somewhat more rapidly than they did when we used nonshocked extracts, whereas the amount of complex III increased significantly (Figure 2G). This result can be accounted for most easily by the conversion of complex I or II (or both) into complex III. That is, the difference in the rate of disappearance of complexes I and II for the two experiments most likely reflects simple dissociation for nonshocked extracts and dissociation plus conversion to complex III for heat-shocked extracts.
As a last experiment to confirm the conversion of complexes I and/or II into complex III, we asked whether preformed complexes I and II, from nonshocked extracts, could be induced to convert to complex III by an in vitro heat shock. As before, we incubated nonshocked extracts with labeled HSE6T and added competitor but then shifted the reaction to 37°C. As shown in Figure 2E, this dramatically increased the appearance of complex III, which formed at the expense of complexes I and II. This result indicates that complex III forms from preexisting complexes I and/or II.
These data do not distinguish which complex serves as the precursor to
complex III. To address this issue, we considered the possibility that
the cooperative interaction between the two trimers that form complex
II might be necessary to form complex III. To disturb the cooperative
interaction, we introduced 5 bp between nGAAn motifs 3 and 4 in our
probe. This new probe (HSE6T + 5) not only affects the spacing between
trimer binding sites but also alters the helical orientation between
them. Cooperativity should be abolished. Figure
3A shows that this 5-bp insertion still
allows the formation of complex I but reduces the abundance of complex
II to ~10% of normal and eliminates complex III. Thus, complex III,
like complex II, requires cooperative interactions for its formation.
It is therefore likely that complex II serves as the precursor to
complex III.
|
Complex III Is Comprised of Two HSF Trimers in an Alternate Conformation
The slower mobility of complex III relative to complex II could be
caused by one of several possibilities. Complex III could represent
1) the binding of a third trimer of HSF, 2) the binding of one
or more non-HSF proteins, or 3) a change in the conformation of HSF. To
address the first possibility, we used the technique that has been
traditionally used to determine the subunit structure of enzymes:
heteromultimer formation with "fast" and "slow" allelic variants. For a fast electrophoretic variant, we used a
truncated HSF allele, HSF1-583, analogous to the
method used by Sorger and Nelson (1989)
to demonstrate the trimeric
nature of HSF. This analysis was facilitated by the fact that the
truncated HSF forms complex III under the same conditions as does
full-length HSF (see Figures 3B and 6A) and by the finding that
Tris-glycine electrophoresis buffer destabilizes complexes I and II (or
converts them into complex III) so that complex III alone can be
studied using HSFM232V from heat-shocked cells
(Figure 3B).
We coexpressed full-length HSFM232V with
the M232V version of HSF1-583, heat shocked the
cells, and assayed the extracts by the gel mobility shift DNA-binding
assay, using Tris-glycine as the gel buffer. As shown in Figure 3C, the
coexpressed HSFs display six distinct bands, the lowest of which
represents the HSF M232V:1-583 homomultimer, and
a seventh, more diffuse complex that corresponds to the homomultimer of
full-length HSFM232V. We obtained the same result
if we simply mixed extracts containing the two HSFs, because of
reassociation of trimers (our unpublished observations). The HSF
M232V:1-583 sample (Figure 3C, left lane)
reveals several bands whose mobilities are similar to those of
heteromultimers with full-length HSFM232V,
despite the fact that HSFM232V:1-583 is expressed from a
gene into which a TAA stop codon was inserted. We have shown previously
(Kopczynski et al., 1992
) that some stop codons in our
strain of yeast can be subject to low-frequency translational
readthrough (Kopczynski et al., 1992
);
immunoblot analysis confirmed that this is the case for
this stop codon as well (Figure 3D). Therefore, the "pure
HSF1-583 control" not only identifies the
mobility of HSF1-583 homomultimers but also
serves to illustrate that altering the ratio of full-length to
truncated HSF derivatives shifts the distribution of heteromultimers in
a predictable manner.
Because the bands are not fully resolved at the top of the distribution, it is difficult to determine, unambiguously, how many bands there are. From the relative masses of the two HSF polypeptides, one can predict the positions of the various heteromultimers, not only for complexes containing six HSF subunits, but also for those containing more. Only the prediction based on six subunits matches the observed mobilities of the bands (Figure 3C). These data are most easily accommodated by a model in which complex III contains only six HSF subunits, i.e., two trimers.
To investigate the possibility that other proteins might associate with
HSF to generate complex III, we used amine-specific cross-linking,
coimmunoprecipitation, and epitope-tagging of HSF but were unable to
demonstrate the presence of another protein besides HSF in the
complexes. We note that the hsp70 proteins that bind HSF are unlikely
candidates, because they are dissociated from HSF by the ATP present in
the DNA-binding reactions (Bonner et al., 2000
). However,
these are negative results and thus carry relatively little weight. The
strongest evidence that complex III does not contain additional
proteins is the finding (see below) that HSF that has been purified
from nonstressed cells (and should therefore lack this putative
protein) can nonetheless form complex III upon in vitro activation.
Although these results do not exclude the possibility that another
protein exists that we cannot detect, we think it more likely that
complex III represents an alternate conformation by which two trimers
can bind DNA cooperatively.
Characterization and Purification of an HSF-activating Factor
The availability of a gel mobility assay for a conformational
change in HSF offers the possibility of defining the biochemical conditions that trigger this change. Could there be a factor in heat-shocked cells that modifies HSF, thereby increasing its propensity to form complex III? In an initial experiment (Carlson et
al., 1999
), we found that material from heat-shocked cells, when
added to extract from nonshocked cells, stimulates the formation of complex III in vitro. It therefore seemed possible that we could use
the formation of complex III to identify an HSF-activating factor.
Because it is known that HSF is subject to phosphorylation (Sorger and
Pelham, 1988
) and that phosphorylation at some sites seems to be
responsible for downregulation of HSF activity (Høj and Jakobsen,
1994
; Xia et al., 1998
), whereas phosphorylation at other
sites may be responsible for activation (Liu and Thiele, 1996
), we
thought it likely that this HSF-activating factor might be a kinase or
a phosphatase. We began the fractionation of heat-shocked extracts
using gentle methods and assaying the fractions by adding them to a
DNA-binding reaction using nonshocked HSF. It soon became clear that
gentle methods were not necessary. Fractionation of heat-shocked
extracts on Affi-Gel blue, phenyl-Sepharose, and heparin agarose
revealed that the factor failed to bind to these resins (Carlson,
1998
). By contrast, it proved to be susceptible to dialysis (molecular
weight cutoff, 6000-8000) and resistant to boiling, to treatment with
N-ethylmaleimide, and to extraction with phenol/chloroform.
It fractionated in the included volume on Sephadex G25. Together, these
observations argue that the HSF-activating factor is small and not a
peptide. It is, however, ethanol precipitable, thus offering a
convenient means of concentrating activity.
A partially purified fraction, when analyzed by mass spectroscopy and
UV absorption, suggested that a nucleotide of mass 448 might be the
active material. The nucleotide guanosine-5'-monophosphate-2'3'-cyclic monophosphate (5G2^3) has
such a mass. Commercially prepared
5G2^3 exhibited activity
(Figure 4A). Because the activity of
5G2^3 required
surprisingly high concentrations, we suspected that the activity might
be either a breakdown product of the nucleotide or a contaminant in the
commercial preparation.
|
Our most highly purified preparation exhibited a main component of mass 175 and lacked the component of mass 448. Collision-induced breakdown analysis of this component (our unpublished observations) was most consistent with a magnesiated ene-diol form of a pentose (the intermediate in the interconversion of ribose and ribulose) in which the sugar is coordinated with a Mg+2 ion. Ribulose alone was unable to affect the conformation of HSF, but upon extended incubation with MgCl2, it formed an ethanol-precipitable complex that induced the formation of complex III (our unpublished observations). The incubation period probably reflects isomerization to the Mg-trapping, ene-diol form. It is likely that both ribose/ribulose and Mg+2 are present in the commercial preparation of 5G2^3, the former as a breakdown product.
It is unclear from these findings whether Mg+2,
the ene-diol pentose, or the coordinated complex is responsible for
stimulating the formation of complex III
or whether they are
physiologically significant. Ene-diol sugars have been shown to
autoxidize and generate superoxide anion
(O2
) (Thornalley and Stern,
1984
; Thornalley et al., 1984
; Thornalley, 1985
; Benov and
Fridovich, 1998
). Is it possible that superoxide stimulates HSF directly?
To test this possibility, we performed our DNA-binding reactions with
purified HSF in the presence of copper-phenanthroline (CuPh), which
undergoes cyclic oxidation-reduction to generate O2
. As shown in Figure 4B,
CuPh induced formation of complex III very efficiently. This result
indicates that HSF is sensitive to reactive oxygen species.
However, after O2
has been
generated, it undergoes a dismutation reaction, to generate H2O2, that can be acted on
by CuPh to generate the hydroxyl radical (·OH). It is therefore
necessary to determine which of these reactive oxygen species acts on
HSF. We tested the effects of radical scavengers that are sensitive to
·OH (DMSO, ethanol, and 2-propanol); they were unable to block the
effect of CuPh (Figure 4B).
H2O2 had no effect on HSF,
even at very high concentrations (Figure 4C). The same was true for
H2O2 plus
FeSO4 (the Fenton reagent), which stimulates
production of ·OH (Figure 4D), despite the fact that the same
concentrations of FeSO4 and
H2O2 readily oxidized
phenol (our unpublished observations). By contrast, superoxide
dismutase (both human and E. coli) blocked the effect of
CuPh (Figure 4E, human SOD). These results indicate that HSF responds
directly to O2
but not to
hydrogen peroxide or the hydroxyl radical. To determine whether
O2
or its protonated form
·HO2 is the active species, we examined the pH
dependence of CuPh; between pH 6.0 and 7.9, there was no difference in
how well CuPh induced complex III (our unpublished observations). We conclude that it is superoxide anion itself that acts
on HSF.
Because the material we purified from cells also contained
Mg+2, we tested the ability of
Mg+2 to induce the formation of complex III. It
could, both with crude extracts and with purified protein, although at
higher concentrations than those at which free
Mg+2 is typically found in vivo (Figure 4, C and
F). How might Mg+2 work to induce formation of
complex III? Because we had recovered Mg+2 in our
preparation of putative HSF-activating factor, we considered the
possibility that it may function in our DNA-binding reactions to
stimulate the formation of superoxide. To test this idea, we treated
the DNA-binding reactions with Mg+2 or with
Mg+2 and SOD. SOD blocked the ability of
Mg+2 to induce formation of complex III (Figure
4F). It therefore seems likely that Mg+2 acts
indirectly on HSF, by stimulating the production of
O2
, which in turn acts on HSF.
These results indicate that HSF can form complex III upon exposure to
O2
. To determine whether
purified HSF also forms complex III in response to heat, we incubated
purified HSF with DNA at elevated temperature (Figure 4G). Indeed, in
vitro heat shock stimulated the formation of complex III. Apparently,
HSF is directly responsive to elevated temperature.
The ability of HSF to respond directly to elevated temperature seems to
obviate the need for a temperature-dependent signaling system to
activate HSF during stress. Yet, our fractionation studies recovered
Mg+2 as a possible HSF activator. Is it likely
that Mg+2 might act in vivo as a signal of
stress? To be useful in such a role, it seems that
Mg+2 would need to be released from sites of
sequestration so that it could activate HSF. To test the idea of
Mg+2 release, we performed in vitro heat shocks
with both purified HSF and crude extracts in the presence of 10 mM EDTA
to chelate any Mg+2 that might be released. EDTA
had no effect on the stimulation of complex III by elevated temperature
(our unpublished observations), suggesting that free
Mg+2 is not released during this in vitro
analogue of heat shock. We therefore think it more likely that the
stimulation of O2
production
by Mg+2 is a property of our in vitro DNA-binding
conditions; as such, it may be useful for analyzing the transition to
complex III but reveals no more about the in vivo situation than do the
data shown above for CuPh.
Glutathione Counteracts the Effects of Superoxide
In vivo, treatment with
H2O2 induces HSF activity
and causes the formation of complex III (Figure 1F), but HSF does not
respond to H2O2 in vitro
(Figure 4C). This suggests that the interplay between HSF activation
and oxidative stress is more complex in vivo than it is in our
simplified system. Cells contain a number of enzymes that serve to
maintain the redox balance, among them SOD, catalase, and enzymes that
rely on the tripeptide glutathione for their reducing power. It is
therefore conceivable that the effect of
H2O2 in vivo reflects its
ability to alter the redox balance of cells, perhaps via an effect on
glutathione. Because yeast HSF contains no cysteine residues, it is
unlikely that reduced glutathione (GSH) can act on it directly. This
prediction is met in the finding that GSH had no effect on purified HSF
and did not block the induction of complex III by
Mg+2-induced production of
O2
(Figure
5A). However, in whole-cell extracts, GSH
did influence the behavior of HSF. Figure 5B shows that GSH
can counteract the effect of Mg+2 and, in the
absence of high concentrations of Mg+2, can
prevent the binding of HSF to DNA. These results suggest that there are
likely to be GSH-dependent enzymes in the extract, undoubtedly part of
the normal redox balance system, that can influence the behavior of
HSF. This may explain the differing effects of
H2O2 in vivo and in vitro:
after H2O2 oxidizes the redox system in vivo, it may be difficult to prevent the buildup of
superoxide that may be produced by normal physiological sources.
|
The Response to O2
Maps to the
Evolutionarily Conserved Portion of the Linker Domain
Yeast HSF contains an N-terminal transcriptional activation domain
(TAD) and two C-terminal transcriptional activation domains (Sorger,
1990
; Bonner et al., 1992
; Chen et al., 1993
).
Neither of these shows significant sequence similarity to HSFs from
other species. Sequence conservation is restricted to the DNA-binding domain and trimerization domain. Because a major component of the
regulatory response to heat shock also maps to this conserved region
(Bonner et al., 1992
), we sought to determine whether the sensitivity to O2
, and
formation of complex III, might also map to this region.
We performed gel mobility shift DNA-binding assays with HSF
derivatives that were truncated at residues 583 and 424 (HSF1-583 and HSF1-424)
and with an HSF derivative from which residues 1-160 had been removed
(HSF161-833). The C-terminal deletions
HSF1-424 and HSF1-583
behaved exactly like full-length HSF (Figure
6A), demonstrating that material
C-terminal to the trimerization domain is unnecessary for complex III
formation. The N-terminal deletion HSF161-833
showed a more complex behavior. Like the C-terminal deletions, it
showed a significant increase in the abundance of complex III after
addition of Mg+2, suggesting that the critical
O2
response element lies
between residues 161 and 424. However, HSF161-833 showed a detectable amount of complex
III even without Mg+2 and appeared to be unable
to form complex II. This is consistent with the idea that complexes II
and III represent the inactive and active forms of HSF, respectively,
because it has been shown by Sorger (1990)
that deletion of residues
1-161 renders HSF constitutively active. From the data, we suggest
that the N-terminal domain functions to stabilize complex II but does
not actually contain the O2
response element.
|
To obtain additional mapping data, we examined mutations that we
recovered during the course of a variety of mutagenesis experiments (Torres and Bonner, 1995
; our unpublished observations).
Although most mutations that we have recovered do not affect HSF
phenotypically, two additional DNA-binding domain mutations besides
M232V display elevated activity in the absence of heat shock. Both the
single mutation L269P and the double-mutation F261L, I272L elevate
expression of an HSE-lacZ reporter gene under normal growth
conditions, although less than does M232V (Figure 6B). When analyzed by
gel mobility shift DNA-binding assay, both mutations also induce the
constitutive formation of complex III (Figure 6C). By contrast, a
variety of mutations isolated as part of a structural investigation of
HSF (Bonner, unpublished observations) had no effect on complex III formation. The mutations that we have analyzed are listed in the legend
to Figure 6D, which summarizes the results of these analyses in the
context of the known structure of HSF.
These genetic data map a critical element for the formation of complex
III to the region immediately downstream of the minimal DNA-binding
domain
a region that is essential for viability (Flick et
al., 1994
). This region, which contains a number of highly conserved residues in HSF, forms a flexible loop in the NMR structure of Vuister et al. (1994)
, where it forms a close contact
with Met232. This region has been considered to
be part of the flexible linker that joins the DNA-binding and
trimerization domains (Flick et al., 1994
), but our results
suggest that this flexible loop might be a functional part of the
DNA-binding domain, because it appears to play a role in modulating the
structure of DNA-bound trimers.
| |
DISCUSSION |
|---|
|
|
|---|
It has long been thought that the activation of HSF upon heat
shock must involve a conformational change that "unmasks" the transcriptional activation domains of HSF. There have been a number of
analyses of HSF conformational changes (Rabindran et al.,
1993
; Westwood and Wu, 1993
; Zuo et al., 1994
), but these
have generally examined metazoan HSF free in solution and have provided
information primarily on the monomer-trimer transition. The
observations of Jurivich et al. (1992)
that salicylate can
induce human HSF to trimerize and bind DNA without concomitant
activation of hsp70 expression suggest that there is likely to be a
second aspect of HSF activation beyond trimerization. Our observations
provide information about this second step, at least for
Saccharomyces HSF.
The argument that complex III represents an active form of HSF is based on three kinds of evidence. The first is correlative, as it must be for an assay based on electrophoretic mobility. The propensity of wild-type HSF to form complex III in vitro depends, at least in part, on the physiological state of the cells from which the HSF was extracted. Heat shock favors the formation of complex III; recovery from heat shock disfavors it. Chemical stresses that affect the heat shock response also favor the formation of complex III. These correlations are imperfect, however. In part, this may reflect the fact that HSF can be induced to form complex III by exposure to superoxide, which is generated spontaneously in the DNA-binding reactions that are exposed to atmospheric oxygen. The imperfect correlation may also reflect the fact that reduced glutathione, present in whole-cell extracts, counteracts the induction of complex III in vitro.
The second line of evidence is that HSF can be induced to form complex III in vitro in response to agents that are known to induce HSF activity in vivo: heat and oxidation. If the mechanism of HSF activation were a direct effect of these stress agents, rather than a complex signal transduction cascade, this is the very result that would be predicted. The third line of evidence that complex III represents an active conformation of HSF is genetic. We have observed that several mutations that elevate HSF activity in vivo also increase the formation of complex III in vitro. Together, these three lines of evidence suggest that complex III may, indeed, represent a conformation that HSF can adopt upon activation.
Our data do not reveal the nature of the conformational change that
gives rise to complex III. However, they do provide two important
pieces of information. First, the change in conformation is detectable
only when two HSF trimers are bound cooperatively to DNA; singly bound
trimers show no detectable differences in our gel mobility shift assay.
This suggests that the conformational change represents a change in the
nature of the cooperative interaction between trimers. This is
intriguing, because it helps explain how differences in the
architecture of HSEs can exhibit differences in biological
activity that are not easily explained simply by differences in binding
affinity. For example, the HSEs of the yeast CUP1 gene
(Sewell et al., 1995
; Liu and Thiele, 1996
; Santoro et
al., 1998
) and of the human IL1
gene (Cahill
et al., 1996
) do not provide for cooperative interactions
between trimers and display activities that are distinct from
traditional HSEs. In contrast, traditional HSEs of natural heat shock
genes typically have binding sites for two or more HSF trimers (Nover,
1987
). In both yeast and Drosophila, these cooperative
interactions have been shown to be either important (yeast) or critical
(Drosophila) for normal heat shock-inducible transcription
(Cohen and Meselson, 1988
; Amin et al., 1994
; Bonner
et al., 1994
).
Our data also map the regions that are important for complex III
formation. The N-terminal "masking" domain (Sorger, 1990
), the
flexible loop joining the DNA-binding domain to the linker domain, and
residue Met232 all seem to play roles in the
transition between complexes II and III. Interestingly, these all share
a certain physical proximity. The structural data for the DNA-binding domain (Harrison et al., 1994
; Vuister et al.,
1994
) indicate that the N-terminal domain joins the DNA-binding domain
near the flexible loop, which in turn is capable of closely approaching Met232. Unfortunately, the elegant cocrystal of
Littlefield and Nelson (1999)
uses the minimal DNA-binding domain and
lacks the flexible loop. It is therefore unable to offer insights into
the nature of this portion of the HSF protein. In the absence of more precise structural data, we imagine that the flexible loop adopts one
conformation in complexes I and II and a different conformation in
complex III.
Our data indicate that the transition to complex III can be induced in
vitro by stimulation of purified HSF by heat or by the superoxide anion
O2
. This indicates that HSF is
directly responsive to the two stresses that are best known
as inducers of the heat shock response: heat and oxidative stress.
These findings are primarily consistent with those of Zhong et
al. (1998)
, who have shown that Drosophila HSF also
responds directly to heat and to oxidation. The difference that yeast
HSF responds to O2
whereas
Drosophila HSF responds to
H2O2 (Zhong et
al., 1998
) may be caused by methodological differences or by
differences in the physiology or in the sequences of HSF, but the
similarity is striking. The production of
O2
is coupled in vivo to the
production of H2O2 via the
dismutation of superoxide into
H2O2. The major source of
cellular O2
is mitochondrial
metabolism, via which, it has been estimated, 1-2% of electrons are
"spilled" into the generation of superoxide (Grisham, 1992
). The
mitochondrial Mn-dependent superoxide dismutase rapidly converts much
of this to H2O2. The
generation of superoxide will increase during stresses that affect
mitochondrial activity. Thus, the same basic physiological stress
creates both species of reactive oxygen.
The finding that HSF is directly responsive to superoxide (or, in the
case of Drosophila HSF, its byproduct
H2O2) provides a
mechanistic explanation for the finding that the heat shock response is
induced by such stresses as recovery from anoxia, hypoxia, and ischemic
stroke. For aerobic organisms, all of these stresses have the same
result: a burst of superoxide production. Via the dismutation of
O2
to
H2O2 and the subsequent
conversion to the hydroxyl radical (·OH), these treatments lead to
significant cellular damage
the classic "reperfusion injury." It
has long been thought that the induction of a heat shock response was
the result of the ·OH-induced protein damage, stimulating an unfolded
protein response. These findings, both ours and those of Zhong et
al. (1998)
, indicate that HSF is activated directly by the
oxidative stress and may therefore occur before there is extensive
protein damage. Thus, the induction of the heat shock response by
anoxic stresses is immediate and potentially protective, rather than a
mere reaction to damage previously done.
In analyses of protein damage by reactive oxygen species, it is usually
the ·OH that causes damage after production of
O2
(Goscin and Fridovich,
1972
; Que et al., 1980
; Davies et al., 1987
;
Gieseg et al., 1993
). Hydroxylation of aromatic amino acid residues can usually be prevented by ·OH scavengers, but not by superoxide dismutase. It is therefore surprising that it is
O2
itself that activates HSF.
Superoxide seems to work directly, and probably reversibly, on yeast
HSF. It is unlikely that O2
simply binds to HSF, because at least some HSF remains in its "complex III-competent" form after extraction from stressed cells. More likely, O2
modifies one
or more amino acid residues, in which case conversion of activated HSF
back to the inactive form must entail the reversal of this modification.
It is possible that the inactivation of HSF during recovery from stress
requires two activities: hsp70 proteins to help refold HSF and, as
suggested by our data, one or more glutathione-dependent enzymatic
activities. It is striking that high concentrations of GSH could
completely prevent nonshocked HSF from binding to DNA, as judged by our
gel mobility shift assay. This suggests that there may be an
"inactive" from of HSF that has a very low affinity for DNA, as is
the case in metazoans. This finding is consistent with the observations
of Giardina and Lis (1995)
, who have shown that, in vivo, yeast HSF is
rapidly and efficiently removed from its DNA-binding site upon the
return of heat-shocked cells to normal growth temperature. On the basis
of our findings, we suspect that this may occur via the GSH-dependent
deactivation of HSF.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grant GM-51853 from the National Institutes of Health.
| |
FOOTNOTES |
|---|
* These authors contributed equally to this work.
Corresponding author. E-mail address:
jbonner{at}bio.indiana.edu.
Present address: Parke Davis, Inc., Ann Arbor, MI 48105.
| |
REFERENCES |
|---|
|
|
|---|
gene by heat shock factor 1.
J. Biol. Chem.
271, 24874-24879
implications for DNA binding by trimeric proteins.
J. Biol. Chem.
269, 12475-12481