|
|
|
|
Vol. 11, Issue 6, 1989-2005, June 2000




and
*Department of Cell Biology and
Department of
Biochemistry and Molecular Genetics, University of Alabama at
Birmingham, Birmingham, Alabama 35294-0005; §Department of
Biology, Indiana University-Purdue University at Indianapolis,
Indianapolis, Indiana 46202-5132; and
Wyeth Ayerst
Research, Princeton, New Jersey 08543-8000
| |
ABSTRACT |
|---|
|
|
|---|
Yeast phosphatidylinositol transfer protein (Sec14p) is essential for Golgi function and cell viability. We now report a characterization of five yeast SFH (Sec Fourteen Homologue) proteins that share 24-65% primary sequence identity with Sec14p. We show that Sfh1p, which shares 64% primary sequence identity with Sec14p, is nonfunctional as a Sec14p in vivo or in vitro. Yet, SFH proteins sharing low primary sequence similarity with Sec14p (i.e., Sfh2p, Sfh3p, Sfh4p, and Sfh5p) represent novel phosphatidylinositol transfer proteins (PITPs) that exhibit phosphatidylinositol- but not phosphatidylcholine-transfer activity in vitro. Moreover, increased expression of Sfh2p, Sfh4p, or Sfh5p rescues sec14-associated growth and secretory defects in a phospholipase D (PLD)-sensitive manner. Several independent lines of evidence further demonstrate that SFH PITPs are collectively required for efficient activation of PLD in vegetative cells. These include a collective requirement for SFH proteins in Sec14p-independent cell growth and in optimal activation of PLD in Sec14p-deficient cells. Consistent with these findings, Sfh2p colocalizes with PLD in endosomal compartments. The data indicate that SFH gene products cooperate with "bypass-Sec14p" mutations and PLD in a complex interaction through which yeast can adapt to loss of the essential function of Sec14p. These findings expand the physiological repertoire of PITP function in yeast and provide the first in vivo demonstration of a role for specific PITPs in stimulating activation of PLD.
| |
INTRODUCTION |
|---|
|
|
|---|
Phosphatidylinositol transfer proteins (PITPs) are
defined by their ability to transfer phosphatidylinositol
(PtdIns) or phosphatidylcholine (PtdCho) monomers between membrane
bilayers in vitro (Cleves et al., 1991a
; Wirtz, 1991
). PITP
dependence has been observed in reconstitutions of constitutive
exocytosis, regulated exocytosis, intra-Golgi membrane trafficking, and
plasma membrane signaling in permeabilized mammalian cells. These data
suggest that PITPs play important roles in regulating phosphoinositide
production in vivo (Hay and Martin, 1993
; Hay et al., 1995
;
Ohashi et al., 1995
; Cunningham et al., 1996
;
DeCamilli et al., 1996
; Jones et al., 1998
; Simon
et al., 1998
).
The major PITP of Saccharomyces cerevisiae is encoded
by SEC14 (Bankaitis et al., 1990
; Cleves et
al., 1991b
). Sec14p is essential for protein transport from the
Golgi complex and for cell viability (Novick et al., 1980
;
Bankaitis et al., 1989
). Consistent with a role for Sec14p
in stimulating Golgi secretory function, Sec14p localizes to yeast
Golgi membranes in vivo (Cleves et al., 1991b
). Information
gained from a Sec14p crystal structure has guided the generation of
Sec14p mutants specifically inactivated for PtdIns-transfer activity
(Phillips et al., 1999
). Interestingly, a mutant Sec14p
deficient in PtdIns-transfer activity, and in its ability to stimulate
phosphoinositide production in vivo and in vitro, fulfills essential
Sec14p functions in yeast (Phillips et al., 1999
).
Insights into the in vivo mechanism of Sec14p function have been
derived from analyses of loss-of-function mutations that effect an
efficient bypass of the essential Sec14p requirement for Golgi function
and cell viability (Cleves et al., 1991a
; Kearns et
al., 1998a
). One class of "bypass-Sec14p" loci define
inactivating mutations that involve structural enzymes of the
CDP-choline pathway for PtdCho biosynthesis (Cleves et al.,
1991b
; McGee et al., 1994
), one of the two pathways for
PtdCho biosynthesis in yeast (Figure 1).
The evidence suggests that PtdCho-bound Sec14p down-regulates flux
through this PtdCho biosynthetic pathway (McGee et al.,
1994
; Skinner et al., 1995
). Another bypass-Sec14p locus
defines loss-of-function mutations in SAC1 (Cleves et
al., 1989
; Figure 1). SAC1 encodes an integral membrane
protein of the yeast endoplasmic reticulum and the Golgi complex
(Sac1p; Whitters et al., 1993
). SacIp regulates inositol phospholipid and PtdCho metabolism in vivo (Cleves
et al., 1991a
; Whitters et al., 1993
; Kearns
et al., 1997
; Guo et al., 1999
; Rivas et
al., 1999
; Stock et al., 1999
; Hughes et
al., 2000
) and has intrinsic phosphoinositide phosphatase activity (Guo et al., 1999
). The last characterized set of
bypass-Sec14p mutations inactivate KES1, a gene encoding a
yeast member of the oxysterol-binding protein family (Fang et
al., 1996
). These three classes of bypass-Sec14p mutations all
require participation of the normally nonessential yeast phospholipase
D (PLD) to manifest their bypass-Sec14p phenotypes (Sreenivas et
al., 1998
; Xie et al., 1998
; Figure 1). In this regard,
it is interesting to note that Sec14p deficiency evokes PLD activation
(Patton-Vogt et al., 1997
; Sreenivas et al.,
1998
; Xie et al., 1998
), even though popular models posit
that PITP stimulates PLD activation (Liscovitch and Cantley, 1995
).
|
In this report, we describe four novel yeast SFH (Sec Fourteen Homologue) proteins designated Sfh2p, Sfh3p, Sfh4p, and Sfh5p. These PITPs are atypical in that they exhibit PtdIns-transfer activity, but not PtdCho-transfer activity, in vitro. Individual overexpression of these novel PITPs rescues the growth and/or secretory defects associated with Sec14p deficiency. In all cases, however, PLD is either required for rescue or markedly facilitates the efficiency of rescue. We further demonstrate, by several independent assays, that bulk PLD activity is sensitive to en bloc disruption of the SFH genes and that SFH deficiencies phenocopy PLD defects. Collectively, these data expand the repertoire of PITPs and PITP-dependent functions in yeast and provide the first insights into the identities of proteins that contribute to PLD activation in this organism.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains, Media, and Genetic Methods
Yeast complex and minimal media (Sherman et al.,
1983
), and methods for transformation of yeast with plasmids and linear
DNA fragments (Ito et al., 1983
; Rothstein, 1983
;
Sherman et al., 1983
), have been described. Complete
genotypes of yeast strains are listed in Table
1. Fine chemicals were purchased from
Sigma Chemical (St. Louis, MO) unless specified otherwise.
Fenpropimorph was purchased from Crescent Chemical (Hauppauge, NY), and
restriction endonucleases were purchased from Promega (Madison, WI).
[1,2-3H(N)]Inositol and
[14C]PtdCho were supplied by American
Radiolabeled Chemicals (St. Louis, MO). All other phospholipids
were obtained from Avanti Polar Lipids (Birmingham, AL).
[
-35S]dATP was from Amersham (Arlington
Heights, IL).
|
Construction of SFH Expression Plasmids
The 1.25-kilobase (kb) coding region of SFH2 was
amplified by PCR from plasmid pML103 (Lai et al., 1994
) with
the use of the primers identified in Tables
2 and
3. The PCR product was digested with the restriction endonucleases BsmBI and SphI
and subcloned into the cognate restriction sites of plasmid
pRE375. In this manner, the SFH2 coding sequence was
positioned directly downstream of the 500-base pair promoter of
the yeast SEC14 gene (PSEC14). The
PSEC14::SFH2 cassette was recovered as a 1.75-kb
EcoRI-SphI restriction fragment and subcloned
into the unique EcoRI and SphI sites of the
YEp(URA3) vector pSEY18. The resultant plasmid was designated pCTY201, and it drives constitutive overexpression of Sfh2p.
|
|
The coding sequences of the SFH3, SFH4, and SFH5 genes were amplified by PCR from genomic DNA with the use of the forward and reverse primers identified in Tables 2 and 3 (initiator codons are shown in boldface). The 1.15-kb SFH3, 1.2-kb SFH4, and 1.1-kb SFH5 PCR products were digested by HpaI and BamHI and inserted into the HpaI and BamHI sites of the YEp(URA3) plasmid pCTY335. These manipulations placed these genes under the transcriptional control of the powerful and constitutive yeast phosphoglycerate kinase promoter (PPGK) to yield plasmids pCTY344, pCTY345, and pCTY346, respectively.
Invertase Assays
Appropriate strains were grown to midlogarithmic phase in 2%
glucose medium at 26°C with shaking. Cells were pelleted, washed with
2 volumes of water, resuspended in 2 volumes of prewarmed glucose
(0.1%) YP medium, and incubated at 37°C for 2 h. The samples were adjusted to 10 mM NaN3, washed twice with
ice-cold 10 mM NaN3, and resuspended in 0.5 ml of
10 mM NaN3. Each sample was divided into two
aliquots, and the volumes were adjusted to 1.0 ml with 0.2% Triton
X-100 and 10 mM NaN3 or 10 mM
NaN3 to generate intact cell or permeabilized
cell samples, respectively. External and total invertase activities
were quantified as described previously (Salama et al.,
1990
).
Gene Disruptions
For each SFH gene, a DNA disruption cassette consisting of yeast URA3 as selectable marker, flanked by 25- to 35-base pair homologous sequences from the targeted gene, was created. Thus, upon recombination into the yeast genome, the individual disruption cassettes evoked replacement of the entire corresponding SFH coding region with URA3. Correctly targeted recombinant proteins were identified by positive PCR diagnosis with the use of one primer hybridizing to sequences within the disruption cassette and another primer hybridizing to sequences outside the deleted region of the targeted gene. As independent confirmation, a second PCR amplification was performed with the use of one primer hybridizing to sequences outside the disruption cassette and another primer hybridizing to SFH DNA deleted from the targeting cassette. These negative diagnoses were expected not to yield PCR product from genomic DNA templates prepared from correctly targeted yeast recombinant proteins. A comprehensive list of primers used in these experiments is presented in Tables 2 and 3.
Preparation of Yeast Cytosol and Phospholipid Transfer Assays
Appropriate strains were grown to midlogarithmic phase in medium
lacking uracil and harvested by centrifugation. Cell pellets were
resuspended in spheroplast buffer (1.1 M sorbitol, 10 mM Tris-HCl, pH
7.5), and 2-mercaptoethanol was added to a final concentration of 25 mM. Cells were incubated at room temperature for 10 min, pelleted, and
resuspended in spheroplast buffer. Oxalyticase (Enzogenetics,
Corvallis, OR) was added to a final concentration of 2 µg/ml, and
cultures were incubated at 30°C for 60 min. Cells were pelleted
(500 × g) and resuspended in modified spheroplast buffer (0.55 M sorbitol, 5 mM Tris-HCl, pH 7.5, 1 mM PMSF). Equal volumes of glass beads (0.1 mm, Sigma) were added, and the cells were
shaken for a total of 6 min in 1-min bursts with 1-min rests on ice.
Salt stripping of the membranes was then performed by adding KCl to a
final concentration of 0.5 M and incubating the membranes on ice for 30 min. The broken spheroplast extracts were then clarified by serial
centrifugation at 1000 × g, 13,000 × g, and 100,000 × g. The resulting cytosol
fractions were assayed for protein concentration with the use of the
bicinchoninic acid kit (Pierce, Rockford, IL) and BSA standards.
PtdIns- and PtdCho-transfer assays were performed as described by
Aitken et al. (1990)
.
Expression and Purification of SFH Proteins
To express full-length SFH proteins with
hexahistidine epitopes at their amino termini, the coding regions of
the corresponding SFH genes were subcloned into the Qiagen
(Chatsworth, CA) His6 vector pQE-30. Primers were
designed to amplify the SFH genes by PCR. These primers were
designed to flank the SFH2 coding region with
5'-SalI and 3'-KpnI sites and to flank the
SFH3, SFH4, and SFH5 coding regions
with 5'-BamHI and 3'-KpnI sites. The forward and
reverse primers used to amplify each gene are listed in Tables 2 and 3.
The resulting PCR products were digested with the appropriate restriction enzymes and subcloned into the corresponding sites of
pQE-30 (Qiagen). The final constructs were transformed into Escherichia coli strain KK2186. The SFH2,
SFH3, SFH4, and SFH5 expression
plasmids were designated pRE644, pRE743, pRE744, and pRE745,
respectively. Recombinant His6-tagged
SEC14 was expressed from pRE526 (Skinner et al.,
1995
). Preparation of cytosolic fractions from E. coli and
purification of His6-tagged PITPs have been
detailed by Kearns et al. (1998b)
.
Construction of SFH2::GFP Plasmid
The 1.9-kb SFH2 gene (including its own promoter region) was amplified by PCR from yeast genomic DNA with the use of the forward and reverse primers SFH2-C (5'-AAAAGAATTCCACTGTAAGAAGAACAAGAGATGATGC-3') and SFH2-D (5'-AAAAACTAGTCTTAAAGTGGTTTTAAGGGCCTGTGGTG-3'). The fragment was digested with EcoRI and SpeI and cloned into the YEp vector pRS423 to yield YEp(SFH2). To subclone the EGFP gene into YEp(SFH2), a linker DNA fragment harboring XmaI and SphI sites was first inserted just upstream of the SFH2 stop codon in YEp(SFH2) by site-directed mutagenesis with the use of the following primers: SFH2-H (5'-AATGGTTCTCTAAAAGTTGCCCGGGCAGCATGCTGAGCCAAGCCACGCGAC) and SFH2-I (5'-GTCGCGTGGCTTGGCTCAGCATGCT GCCCGGGCAACTTTTAGAGAACCATT). The EGFP-coding region was then amplified by PCR from pEGFP-N1 (Clontech, Palo Alto, CA) with the use of primers EGFP-5' (5'-AAAACCCGGGGCCACCATGGTGAGCAAGGGCGAG) and EGFP-3' (5'-AAAAGCATGCCTTGTACAGCTCGTCCATGCC) and inserted into the XmaI and SphI sites (underlined in primer sequences) of the modified YEp(SFH2) plasmid. The resultant YEp(SFH2::GFP) plasmid was designated pCTY824.
Immunofluorescence Microscopy
The YEp(SFH2::GFP) plasmid was transformed
into the sec14-1ts strain CTY1-1A (Table
1). Liquid cultures were subsequently grown overnight at 25°C in
medium selective for the plasmid (i.e., uracil-free minimal medium).
These cultures were subsequently diluted to an OD600 of 0.3-0.5 and were incubated as before
for 2 to 3 h. Staining of yeast endosomes with the styryl dye FM
4-64 (Molecular Probes, Eugene, OR) was performed by
incubating cells with FM 4-64 (40 µM final concentration from an 8 mM
stock in DMSO) for 30-60 min at 0°C. Cells were washed twice with
ice-cold YPD medium and incubated at 15°C for 15-25 min to chase FM
4-64 into endosomes (Vida and Emr, 1995
). Stained cells were gently
pelleted by centrifugation and mounted as suspensions in growth medium
onto cold glass slides. Epifluorescence microscopy was performed with
the use of a Nikon (Garden City, NY) Diaphot 300 microscope equipped
with a Photometrics (Tucson, AZ) CH250 charge-coupled device camera.
Excitation wavelengths for GFP and FM 4-64 were 495 and 545 nm,
respectively, and fluorescence images were processed by IP Lab 2.0, Adobe Photoshop 5.0, and Adobe Pagemaker 6.0 software (Mountain View,
CA).
|
Quantification of Choline Release
Choline was chemically measured in samples of media obtained
from the appropriate yeast cultures. Appropriate yeast strains were
grown to logarithmic growth phase at 26°C in minimal defined Wickerham's medium supplemented with inositol (100 µM) and
lacking choline. Cells were pelleted, washed with water, and
resuspended in fresh choline-free medium at 33.5°C. After 3 h,
cells were pelleted by centrifugation, the culture supernatants were
collected, and the supernatants were then further clarified by passage
through a 0.45-µm (pore size) filter. The choline content of the
supernatants was then determined with a choline oxidase-coupled assay.
A coupled reaction was used in which
H2O2 (produced via
enzymatic oxidation of choline by choline oxidase) was reacted with
aminoantipyrine and phenol to form quinoneimine (Warnick, 1986
).
Quinoneimine was then quantified spectrophotometrically at an
absorbance wavelength of 490 nm. Standard curves relating choline
concentration to quinoneimine production were used to relate
A490 readings from media samples to absolute
choline concentrations (Warnick, 1986
).
Phosphatidic Acid Determinations
Yeast strains were grown to midlogarithmic growth phase (3 ml,
OD600 = 0.8-1.0) in defined minimal medium
containing 1 mM inositol and 1 mM choline and presented with
[32P]orthophosphate (10 µCi/ml) for 20 h at
25°C with shaking. Cells were washed, resuspended in radio-label free
medium, and incubated for 3 h at 33.5°C with shaking. Cell metabolism
was terminated by the addition of TCA to 5%. One-tenth of the culture
was removed after trichloroacetic acid (TCA) precipitation to assess
incorporation of label. The cells were subsequently incubated for 20 min on ice in 5% TCA, and phospholipids were extracted by the method of Atkinson (1984)
. Briefly, cell pellets were resuspended in 1 ml of
polar extraction solvent (McGee et al., 1994
) for 20 min at
65°C. Lipids were recovered by the addition of 5 ml of
CHCl3/CH3OH/butylated hydroxytoluene (2:1:0.005) and 0.5 ml of
H2O, followed by vigorous shaking for 30 s.
After phase separation at 4°C and a 5-min centrifugation, the organic
phase was removed, dried under N2 gas, and
reconstituted in 60 µl of
CHCl3/CH3OH/butylated
hydroxytoluene. Phospholipids were resolved by two-dimensional
chromatography with the use of Whatman (Clifton, NJ) SG81 paper treated
with EDTA (Steiner and Lester, 1972
). The first-dimension solvent was
CHCl3/CH3OH/NH4OH/H2O (22:9:1:0.26), and the second-dimension solvent was
CHCl3/CH3OH/CH3COOH/H2O (8:1:1.25:0.25). Radiolabeled phospholipids were quantified with the
use of the Phosphorimager 425 instrument (Molecular Dynamics, Sunnyvale, CA).
PLD Assays
PLD activity was assayed by measuring conversion of
1-palmitoyl-2-[6-N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)-amino]caproyl
(NBD)- PtdCho to NBD-phosphatidic acid (PtdOH) with the use
of clarified extracts prepared from appropriate yeast strains by
vigorous disruption with glass beads (300-500 µm diameter). Assays
were as described by Waksman et al. (1996)
except that 100 µg of total protein was used per reaction and reactions were
incubated at 30°C for 1 h. NBD-PtdCho and NBD-PtdOH were
resolved in one dimension by TLC with the use of
CHCl3/CH3OH/CH3COOH/H2O
(8:1:1.25:0.25) as developing solvent. NBD phospholipids were
visualized by UV illumination, and the corresponding NBD species were
quantified by fluorescence counting with the use of the Storm
apparatus (Molecular Dynamics).
| |
RESULTS |
|---|
|
|
|---|
Yeast Gene Products with Functional Relatedness to Sec14p
The yeast genome database identifies one ORF that potentially
encodes a product sharing 64% primary sequence identity with Sec14p
(Bankaitis et al., 1996
). Four other ORFs potentially encode proteins sharing ~25% identity and 45% similarity with Sec14p (Figure 2A). We designate these ORFs
SFH1, SFH2, SFH3, SFH4, and SFH5 (Bankaitis et al., 1996
; Phillips et
al., 1999
). The SFH3 and SFH4 genes have
also been encountered in independent studies analyzing genes whose
transcription is stimulated by challenge of yeast cells with inhibitors
of sterol biosynthesis. In these studies, SFH3 and
SFH4 have been designated PDR16 and
PDR17, respectively (van den Hazel et al., 1999
).
We will use the SFH nomenclature here, both for purposes of
conformity in referring to this class of proteins and because this
nomenclature better reflects their structural and functional
properties. Northern analyses indicated that SFH2,
SFH3, SFH4, and SFH5 are all
transcribed in vegetative cells, but no accumulation of SFH1
mRNA or protein was recorded under various growth conditions (our
unpublished results).
To assess whether any of these SFH gene products share
significant functional redundancy with Sec14p, we generated appropriate expression vectors in both high-copy episomal (YEp) and low-copy centromeric configurations. These vectors were designed such that the
powerful promoter of the yeast phosphoglycerate kinase structural gene
drives the constitutive transcription of each SFH gene.
SFH2 was an exception. For technical reasons, the
YEp(SFH2) plasmid used the constitutive SEC14
promoter. Each expression plasmid was subsequently introduced into a
sec14-1ts yeast strain (CTY1-1A), and the
ability of each expression construct to effect phenotypic rescue of the
signature growth defects of sec14-1ts
strains at 37°C was subsequently assessed. Only the SFH4
expression cassette was able to support rescue of
sec14-1ts-associated growth defects when
configured on a centromeric plasmid (our unpublished results). However,
individual expression of SFH2, SFH4, or
SFH5 from YEp expression plasmids clearly rescued
sec14-1ts-associated growth defects
(Figure 2B). Of these plasmids, YEp(SFH2) and
YEp(SFH4) were efficient in restoring growth to
sec14-1ts strains at 37°C, whereas
YEp(SFH5) was less effective. In independent plasmid shuffle
experiments, these same three YEp(SFH) plasmids were also
able to rescue the unconditional lethality associated with
sec14 alleles (our unpublished results).
The phenotypic rescue of sec14-associated growth defects was accompanied by alleviation of the dramatic secretory pathway dysfunction that is associated with Sec14p insufficiency in yeast. In these experiments, secretion of the glycoprotein invertase was monitored as a measure of the efficiency of secretory pathway function. As shown in Figure 2C, wild-type yeast induced for invertase synthesis for 2 h at 37°C exhibited a secretion index of 0.90 ± 0.02, indicating that >90% of the invertase synthesized during that 2-h period was efficiently transported through the secretory pathway to the cell surface. In contrast, sec14ts strains incubated under the same conditions exhibited a dramatically reduced secretion index (0.18 ± 0.01). This reduced secretion index suggests accumulation of a large intracellular invertase pool that is arrested in its progression from the Golgi complex in Sec14p-deficient mutants. In accord with the results gleaned from phenotypic rescue experiments, YEp(SFH2), YEp(SFH4), and YEp(SFH5) dramatically improved the secretion index of the sec14-1ts strain from 0.18 ± 0.01 to 0.64 ± 0.01, 0.80 ± 0.02, and 0.64 ± 0.04, respectively.
In contrast, neither YEp(SFH1) (our unpublished results) nor YEp(SFH3) expression plasmids effected any detectable phenotypic rescue of sec14 growth defects at restrictive temperatures (Figure 2B). YEp(SFH1) also had no effect on the abnormally low secretion index of the sec14 host strain (our unpublished results). The failure of YEp(SFH1) to rescue sec14 growth and secretory defects was surprising because SFH1 shares a high degree of similarity with the SEC14 gene itself. SFH1 expression was not a problem, as demonstrated by immunoblotting experiments that clearly showed that YEp(SFH1) drove robust accumulation of a single polypeptide of the correct mass (35 kDa) that exhibited strong immunoreactivity to Sfh1p-directed antibodies (our unpublished results). The collective results indicate that Sfh1p is not a functional PITP (see below). Interestingly, SFH3 expression elicited a significant improvement in the invertase secretion index of the sec14 mutant strain, an improvement that was almost as large as that recorded for cells carrying either YEp(SFH2) or YEp(SFH4) (Figure 2C). Yet, YEp(SFH3) failed to recapitulate the phenotypic rescue of sec14 defects that was recorded for YEp(SFH2) and YEp(SFH4).
We conclude that Sfh2p, Sfh4p, and Sfh5p share some functional
relatedness with Sec14p. The invertase data further suggest that Sfh3p
does as well. Although we have not determined why Sfh3p expression
fails to rescue sec14-associated growth defects, previous work has indicated that secretion indices of ~0.50 are near the threshold for cell viability (Kearns et al., 1998b
). Perhaps
Sfh3p simply fails to accumulate to the levels achieved by
overproduction of Sfh2p, Sfh4p, or Sfh5p and thereby does not effect a
sufficiently efficient alleviation of the
sec14-1ts Golgi secretory block to sustain
cell growth.
SFH2, SFH3, SFH4, and SFH5 Proteins Are Nonclassic PITPs
Overexpression of mammalian or plant PITPs in yeast is sufficient
to complement sec14-1ts-associated growth
and secretion phenotypes (Skinner et al., 1993
; Kearns
et al. 1998a
,b
). Because individual expression of the
SFH2, SFH3, SFH4, and SFH5
proteins rescues growth and/or secretion defects of
sec14-1ts mutants at 37°C, and because
the SFH proteins share primary sequence homology with
Sec14p, we determined whether these SFH proteins define a
novel class of yeast PITPs. Previous work by van den Hazel et
al. (1999)
demonstrated modest reductions in bulk PtdIns-transfer activity in crude yeast membrane fractions prepared from Sfh3p- and
Sfh4p-deficient yeast strains. Although suggestive, those experiments
lend themselves to multiple interpretations and do not yield clear
conclusions regarding the biochemical properties of any of the
SFH gene products. To characterize these proteins in more
detail, we first expressed individual SFH proteins in the
cki1,
sec14 yeast strain CTY303 and
assayed cytosol prepared from these strains for PtdIns- and
PtdCho-transfer activity. The Sec14p-deficient CTY303 is a useful host
strain for these experiments because it lacks detectable endogenous
PtdIns- and PtdCho-transfer activity. CTY303 retains viability in the
face of Sec14p deficiency because cki1 effects bypass of the
essential Sec14p requirement (Cleves et al. 1991
).
The PtdIns- and PtdCho-transfer profiles for yeast cytosol containing
Sec14p, or each individual SFH protein, are shown in Figure
3, A and B, respectively. Wild-type
Sec14p cytosol served as a positive control, and it exhibited robust
PtdIns- and PtdCho-transfer activities. Wild-type cytosol catalyzed the
in vitro transfer of ~23 and 20% of the total input
[3H]PtdIns- and
[14C]PtdCho-transfer substrate at saturation,
respectively. For in vitro transfer assays that used cytosol prepared
from a CTY303 derivative expressing SFH proteins, the assay
conditions for both PtdIns and PtdCho transfer were in the linear range
from 0 mg to at least 2 mg of input cytosol. Under these conditions, we were unable to record any detectable PtdIns-transfer activity in
cytosol containing Sfh1p (our unpublished results). However, cytosol
fractions prepared from yeast strains individually overproducing Sfh2p,
Sfh3p, Sfh4p, or Sfh5p all exhibited significant PtdIns-transfer activity (Figure 3A). At the highest concentrations of cytosol tested
(2 mg/ml), the Sfh2p, Sfh3p, and Sfh4p cytosol preparations catalyzed
the transfer of 13% of total input [3H]PtdIns
substrate from donor to acceptor membranes in vitro. Sfh5p-containing
cytosol effected a robust transfer of 25% of the input
[3H]PtdIns substrate when 2 mg of cytosol was
assayed, a value similar to that obtained for Sec14p at saturation.
However, the concentration of cytosol required to saturate the
PtdIns-transfer assay was quite different for Sec14p and Sfh5p. The
PtdIns-transfer assay saturated at 0.25 mg of input Sec14p cytosol,
whereas 2 mg of Sfh5p cytosol was required to achieve the same effect
(Figure 3A).
|
During the course of these experiments, we found that detection of PtdIns-transfer activity in all cases, with the exception of Sec14p and Sfh4p, required that yeast membranes be stripped with 0.5 M KCl during preparation of the cytosol fraction (see MATERIALS AND METHODS). These data indicate that Sfh2p, Sfh3p, and Sfh5p are rather tightly associated with membranes, whereas a significant fraction of Sfh4p is either cytosolic or more loosely membrane bound under the overexpression conditions used in these experiments (our unpublished results).
Assessments of PtdCho-transfer activity yielded unexpected results. Sec14p cytosol elaborated abundant PtdCho-transfer activity (20% of input [14C]PtdCho transferred during the course of the assay). Yet, we failed to detect PtdCho transfer in assays supplemented with high concentrations of cytosol prepared from any of the YEp(SFH) derivatives of CTY303 (Figure 3B), including those expressing Sfh1p to high levels (our unpublished results).
To gain independent confirmation of the biochemical data obtained from yeast cytosol, we individually expressed recombinant His6-tagged SFH proteins in E. coli and measured PtdIns- and PtdCho-transfer activities from crude E. coli cytosol fractions. His6-tagged Sec14p was used as a positive control. The data obtained with the recombinant proteins largely recapitulated those obtained from yeast cytosol. However, salt stripping of E. coli membranes was not required for detection of soluble phospholipid transfer activity. Recombinant Sec14p cytosol transferred 22% of the total input [3H]PtdIns at the highest concentration tested. Likewise, recombinant Sfh2p, Sfh3p, and Sfh4p cytosol catalyzed the in vitro transfer of 12, 11, and 14%, respectively, of input [3H]PtdIns from donor to acceptor membranes (Figure 3C). Sfh5p was an exception in that it catalyzed robust PtdIns-transfer activity when assayed in the context of yeast cytosol but failed to elaborate detectable transfer activity when expressed as a recombinant protein in E. coli cytosol. This inactivity was not the result of Sfh5p instability in E. coli, because immunoblotting experiments revealed significant levels of full-length recombinant Sfh5p in input cytosol (our unpublished results).
As illustrated in Figure 3D, the PtdCho-transfer data obtained for bacterial cytosol harboring recombinant SFH proteins were also in agreement with the yeast cytosol data. Whereas Sec14p catalyzed vigorous rates of PtdCho-transfer activity (14% of total input substrate transferred), none of the Sfhp-containing cytosols exhibited significant PtdCho-transfer activity. Recombinant Sfh1p was again inactive in both PtdIns- and PtdCho-transfer assays, even when added as purified protein at micromolar concentrations (our unpublished results).
These collective data, although not permitting direct comparisons of specific activities for PtdIns transfer between Sec14p and the SFH proteins, formally demonstrate that Sfh2p, Sfh3p, and Sfh4p are novel yeast PITPs that do not effect PtdCho transfer, at least under the assay conditions used. From this perspective, these proteins represent nonclassic PITPs. Although we believe it is likely that Sfh5p is also a PtdIns-transfer protein of this class, our inability to detect PtdIns-transfer activity with recombinant Sfh5p leaves the evidence short of what is needed for confirmation.
SFH Gene Products and Sec14p-independent Cell Growth
We considered the possibility that SFH gene expression could influence the phenotypes associated with Sec14p insufficiency in yeast. To address the possible roles of SFH gene products in the execution of Sec14p-dependent secretory events, we systematically disrupted SFH genes individually and in combination in various yeast genetic backgrounds.
Initially, the SFH2, SFH3, SFH4, and
SFH5 genes were individually disrupted in SEC14
strains to assess whether any single SFH gene was essential
for cell growth. None of the individual disruption mutations exerted
any dramatic effect on the viability of SEC14 strains,
indicating that none of these gene products executes a unique essential
function (Figure 4A). In the cases of the
sfh3 and
sfh4
mutants, discernible phenotypes do exist, and these provide some
insight into biological function (see DISCUSSION). Yet, en bloc
deletion of all four of these SFH genes in a
SEC14 strain also had little effect on cell viability and
vigor (Figure 4A). Thus, SFH-encoded PITPs are dispensable
as a class in SEC14 yeast strains.
|
If any of the SFH proteins exhibit authentic physiological
redundancy with Sec14p, we would expect to record exacerbation of
sec14-1ts defects upon ablation of
SFH protein function. We did not find this to be the case
for
sfh4 or
sfh5.
Individual disruption of SFH4 or SFH5 failed to
exert any negative effect on the growth of
sec14-1ts strains, even at temperatures
approaching the restrictive temperature of 34°C (Figure 4A). However,
the
sfh2 and
sfh3
alleles did decrease the restrictive temperature of
sec14-1ts strains to 33°C (Figure 4A).
When
sfh2,
sfh3,
sfh4, and
sfh5 null
alleles were combined in a sec14-1ts
genetic background, no synthetic lethality was observed. Rather, a more
severe reduction in the restrictive growth temperature of
sec14-1ts strains was again recorded
(Figure 4A). These data suggest that the SFH2,
SFH3, SFH4, and SFH5 gene products
collectively exert some influence on
sec14-1ts growth phenotypes and that Sfh2p
and Sfh3p perhaps play more prominent roles in this regard.
We also determined whether the Sec14p-independent viability of
bypass-Sec14p mutants relied on SFH function. Individual
sfh2,
sfh3,
sfh4, and
sfh5
alleles were introduced into strains carrying cki1,
kes1, or sac1 bypass-Sec14p alleles. Again,
sfh3,
sfh4, and
sfh5 alleles had no obvious effects on the
ability of any of these alleles to effect bypass Sec14p. The
sfh2 allele visibly reduced the efficiency
with which mutations in the CDP-choline pathway for PtdCho biosynthesis
rescued sec14-1ts growth defects at 37°C
but did not abolish this phenotypic rescue (Figure 4B). Thus, Sfh2p
contributes to the bypass-Sec14p phenotype associated with CDP-choline
pathway defects. Finally, aggregate incorporation of the
sfh2,
sfh3,
sfh4, and
sfh5
alleles into the cki1 or sac1 strain abolished
their ability to effect bypass Sec14p (Figure 4C). Similarly,
kes1-mediated bypass Sec14p was dramatically compromised by
en bloc deletion of the SFH genes. Thus, Sec14p-independent
growth exhibits a requirement for SFH gene product activity.
SFH protein involvement in facilitating Sec14p-independent growth in bypass-Sec14p mutants raised the possibility that SFH gene products are overproduced in these mutants. Northern analyses indicated no significant increase in SFH gene expression in Sec14p-deficient bypass-Sec14p strains relative to wild-type strains (our unpublished results).
Optimal PLD Activity Is Dependent on SFH Gene Product Function In Vivo
Yeast express a single
PtdIns-4,5-P2-activated PLD that is encoded by
the SPO14 gene (Rose et al., 1995
; Waksman
et al., 1996
). PLD, which catalyzes the hydrolysis of PtdCho
to PtdOH and free choline, is normally nonessential for vegetative
growth of yeast, but this enzyme is obligatorily required for the
viability of bypass-Sec14p mutants (Sreenivas et al., 1998
;
Xie et al., 1998
). Moreover, PLD deficiency renders
sec14-1ts strains much more temperature
sensitive for growth, i.e.,
spo14 alleles
reduce the restrictive temperature of
sec14-1ts strains by several degrees, from
34 to ~31°C (Rivas et al., 1999
). Because the phenotypes
associated with en bloc deletion of the SFH genes closely
resembled those associated with PLD deficiency (Figure 4), we
considered the possibility that SFH proteins contribute to
PLD activation. This hypothesis predicts: (i) that PLD deficiency will
compromise SFH overexpression-mediated rescue of
sec14-1ts-associated growth defects, and
(ii) that en bloc disruption of the SFH genes will result in
reduced PLD activity in vivo.
To determine whether the SFH proteins require PLD activity
for stimulation of the Sec14p pathway in vivo, we tested the ability of
YEp(SFH2), YEp(SFH4), and YEp(SFH5) to
rescue sec14-1ts-associated growth defects
in yeast strains deleted for SPO14. Only the
sec14-1ts,
spo14, YEp(SFH2) strain grew at all
at 37°C, and it grew more poorly relative to the isogenic
SPO14 strain (Figure 5A).
Overexpression of either SFH4 or SFH5 failed to
effect phenotypic rescue of Sec14p defects in the absence of a
functional PLD (Figure 5A).
|
To determine whether the SFH gene products collectively
regulate PLD activity in vivo, we used two independent approaches to
measure PLD activity in living cells. In vivo measurements were
initially used because in vitro assays for PLD activity in yeast
cell-free lysates do not always reliably reflect PLD activity in vivo.
As an example of this discordance, deletion of the yeast PLD amino
terminus yields a protein that is robustly active in vitro but that
fails to hydrolyze PtdCho in vivo (Rudge et al., 1998
; Xie
et al., 1998
; our unpublished results).
The first approach used an adapted version of a standard cross-feeding
assay to crudely assess PLD-mediated production of choline in yeast
cells blocked for choline salvage via the CDP-choline pathway (e.g.,
cki1 mutants) (Cleves et al., 1991
). In these
cki1 mutants, the choline generated via PLD-mediated
hydrolysis of PtdCho is an inert metabolite that excreted from the
cell. The excreted choline is then available for scavenging by an
indicator strain that requires choline for growth (Patton-Vogt et
al., 1997
). As shown in Figure 5B, a cki1,
sec14-1ts, SPO14 strain incubated at
30°C exhibited robust excretion of choline. This is shown by the
large halo of indicator cells that grew around the focus at which the
test cki1 cells were deposited. The PLD dependence of this
choline excretion was indicated by the fact that the cki1,
sec14-1ts,
spo14 strain
failed to support even a small halo of indicator growth. Examination of
the cki1, sec14-1ts,
sfh2,
sfh3,
sfh4,
sfh5 mutant demonstrated that its choline excretion
phenotype was strongly diminished relative to the cki1, sec14-1ts, SFH strain (Figure 5B).
Little effect on choline excretion was recorded in strains carrying
individual
sfh2,
sfh3,
sfh4, or
sfh5 alleles (our unpublished results).
To provide quantitative confirmation of the cross-feeding results,
these same cki1 derivative strains were grown to early logarithmic growth phase in choline-free minimal medium at 26°C, washed, resuspended in fresh choline-free medium, and incubated at
33.5°C for 3 h. This incubation at 33.5°C results in partial inactivation of Sec14pts and concomitant
activation of PLD (Patton-Vogt et al., 1997
; Sreenivas
et al., 1998
; Xie et al., 1998
). The medium was
collected from each culture, and the choline content of each culture
supernatant was measured by chemical assay (see MATERIALS AND METHODS).
The quantitative data were consistent with the cross-feeding data. Sec14p-proficient cells accumulated only small amounts of choline in
the culture supernatant (5.9 ± 0.3 nmol·OD600
cells
1·ml
1), whereas
the isogenic cki1, sec14-1ts derivative
excreted approximately threefold more choline per unit cell during the
same 3 h of incubation at 33.5°C (16.2 ± 1.5 nmol·OD600
cells
1·ml
1) (Figure
5C). The cki1,
sec14-1ts,
sfh strain exhibited threefold reduction in
excreted choline relative to its SFH partner and was no more
proficient in choline release than was the SEC14 strain
(5.8 ± 0.6 versus 5.9 ± 0.3 nmol·OD600
cells
1·ml
1). All of
the excreted choline measured with this assay was attributable to PLD
action, because choline levels were essentially undetectable in culture
supernatants of the cki1,
sec14-1ts,
spo14 strain (0.3 ± 0.2 nmol·OD600
cells
1·ml
1) (Figure
5C). These data clearly demonstrate that PLD-dependent production of
choline (and, by extension, PLD activity) is severely compromised in
yeast deficient in SFH protein function.
The reduction of choline excretion in
sfh
strains was not simply a nonspecific consequence of further
exacerbating Golgi dysfunction. Inactivation of the Pik1p
PtdIns-4-kinase (by the pik1-101ts mutation
that also blocks late Golgi secretory pathway function in yeast;
Walch-Solimena and Novick, 1999
) failed to recapitulate the
sfh effect of reducing PLD activity in
cki1, sec14-1ts strains at 33.5°C.
Moreover, unlike sec14-1ts, the
pik1-101ts allele failed to evoke PLD
activation in a cki1 genetic background under the same
conditions (our unpublished results). These data suggest that Pik1p is
not a limiting component of an SFH-dependent pathway, or
even of a Sec14p-dependent pathway, for PLD activation.
The choline excretion-based measurements of PLD activity
required strains exhibiting specific defects in PtdCho metabolism for readout. To obtain independent assessments of PLD activity that did
not rely on restrictions in PtdCho metabolism, we quantified PLD-dependent production of PtdOH in SFH-proficient and
SFH-deficient strain pairs that were competent for PtdCho
synthesis via the CDP-choline pathway. In these experiments, cells were
labeled to steady state at 26°C with
[32P]orthophosphate. Cells were then washed,
resuspended in label-free medium, and incubated at 33.5°C for 3 h. This last incubation initiates a crude chase of
32P from PtdCho to PtdOH under conditions in
which Sec14p deficiency is induced and PLD is activated (Patton-Vogt
et al., 1997
; Sreenivas et al., 1998
; Xie
et al., 1998
). The PLD-mediated generation of PtdOH was then
measured by comparing PtdOH levels in PLD-proficient and PLD-deficient
strains after termination of the chase. Although this equilibrium
32P radiolabeling/chase regimen is a less
sensitive measure of PLD-mediated metabolism of PtdCho (because the
PtdOH product is both metabolically labile and actively generated by
metabolic pathways other than PLD-mediated PtdCho hydrolysis),
the contribution of PLD to PtdOH production is nonetheless readily discerned.
As shown in Figure 5D, PtdOH represented 0.42 ± 0.14% and
1.10 ± 0.16% of total extractable phospholipid in the
SFH-proficient SEC14 and
sec14-1ts strains, respectively. A
spo14, sec14-1ts derivative
served as a negative control, and PtdOH levels were reduced severalfold
in this mutant relative to its SPO14,
sec14-1ts partner (0.39 ± 0.18% versus
1.10 ± 0.16%). Thus, the 2.5-fold increase in PtdOH levels
observed for the sec14-1ts strain (relative
to its isogenic SEC14 partner) represented a measure of the
PLD activation evoked by Sec14p deficiency in yeast. The
SFH-deficient strain also exhibited marked reductions in
PtdOH levels relative to its SFH-proficient partner, even
though both strains expressed wild-type PLD (Figure 5D). In this case,
the SFH-insufficient mutant was twofold reduced for PtdOH
relative to the SFH-proficient strain (0.59 ± 0.16%
versus 1.10 ± 0.16%).
These results were recapitulated when the cki1 yeast strains
used in the choline excretion experiments were similarly analyzed. The
cki1, sec14-1ts strain produced
approximately twofold and sixfold more PtdOH during the chase
incubation at 33.5°C than did the cki1,
sfh and cki1,
spo14 derivatives, respectively (our
unpublished results). The collective data demonstrate that en bloc
deletion of SFH2, SFH3, SFH4, and
SFH5 compromises PLD activity in vivo, independent of
CDP-choline pathway activity. Additional support for an in vivo link
between Sfh2p and PLD function comes from an entirely independent
Sfh2p-associated phenotype (see DISCUSSION).
PLD Activity and SFH Gene Product Function as Measured by Broken Cell Assay
We also determined whether the stimulatory effects of
SFH gene product function on PLD activity in vivo were
discernible in broken cell assays that directly monitor the action of
PLD on fluorescently labeled phospholipid substrate. To this end, the set of cki1, sec14-1ts derivative strains
described above was cultured at 25°C to early logarithmic growth
phase and shifted to 33.5°C for 3 h to induce activation of PLD,
as described above. Clarified supernatants were subsequently prepared
from broken cell preparations of these strains, and PLD activity in
each lysate was measured by monitoring conversion of NBD-PtdCho
substrate to NBD-PtdOH product (see MATERIALS AND METHODS). As shown in
Figure 6A, the
sec14-1ts strain exhibited clearly
measurable PLD activity, as determined by conversion of NBD-PtdCho to
NBD-PtdOH. Lysate prepared from the isogenic
spo14 control failed to execute this
conversion, thereby demonstrating that PLD is the source of this
hydrolytic activity. The ability of lysate prepared from the
sec14-1ts,
sfh
strain to convert NBD-PtdCho to NBD-PtdOH was significantly diminished
in this assay relative to that of the
sec14-1ts-positive control strain (Figure
6A).
|
Quantification of the data by fluorimetry confirmed the visual
interpretation of the experimental results. In assays that used 100 µg of protein, lysate from the sec14-1ts
control strain converted 0.82 ± 0.21% of total input NBD-PtdCho to NBD-PtdOH in 1 h at 30°C. This value was at least 40-fold
greater than that measured for the
spo14
control (0.02 ± 0.01% of NBD-substrate converted to product).
Consistent with the in vivo data, the
sec14-1ts,
sfh
strain exhibited a 2.5-fold reduction in PLD activity relative to the
SFH-positive control (0.82 ± 0.21% versus 0.33 ± 0.10%; Figure 6B). These data are qualitatively and quantitatively
consistent with the independent lines of in vivo evidence and establish
a critical role for the SFH gene products in stimulating PLD
activity in vivo.
Localization of Sfh2p and PLD in Endosomal Compartments
If SFH proteins regulate PLD activity in vivo, they
should exhibit detectable colocalization with PLD in cells. To test
this prediction, we expressed EGFP-tagged versions of SFH
proteins in yeast. The fluorescent tags were configured at the carboxyl termini of these proteins because this orientation is predicted not to
occlude the phospholipid-binding pocket of Sec14p-like proteins
(Sha et al., 1998
; Phillips et al., 1999
). In
further support of this notion, Yarrowia lipolytica Sec14p
exhibits a large carboxyl-terminal extension that does not interfere
with its PtdIns- and PtdCho-transfer activities (Lopez et
al., 1994
). The Sfh2p-GFP chimera met the dual criteria of being
functional in yeast as a stable protein [as judged by
immunoblotting and the ability of
YEp(SFH2::GFP) to rescue
sec14-1ts growth defects (our unpublished
results)] and of generating a detectable fluorescence signal.
Sfh2p-GFP localized to 5-10 punctate structures dispersed in the
cytoplasm (Figure 7A). This pattern was
similar to the one observed for the fluorescent styryl dye FM 4-64 that
was used to stain these same cells under conditions that capture the
dye in endosomal compartments (Figure 7B). Indeed, comparison of the Sfh2p-GFP and FM 4-64 images demonstrated a substantial colocalization of Sfh2p staining with endosomes. We estimate that ~60% of the Sfh2p-GFP-positive structures stain with FM 4-64, whereas some 80% of
the FM 4-64-positive structures stain with Sfh2p-GFP. Finally, we used
a functional GFP-PLD chimera (Rudge et al., 1998
) to
determine whether PLD and Sfh2p colocalize in yeast under conditions of Sfh2p overexpression. Comparisons of GFP-PLD and FM 4-64 staining profiles indicated that PLD exhibited predominantly endosomal staining
(Figure 7, C and D). We estimate that ~90% of the GFP-PLD-positive structures colocalized with FM 4-64-positive structures. These values
are based on comparisons of the punctate aspects of Sfh2p-GFP, GFP-PLD,
and FM 4-64 staining. Tubular structures also exhibit substantial
costaining of Sfh2p-GFP or GFP-PLD and FM 4-64. Quantification of
costaining in these structures is more difficult. Our finding that
GFP-PLD localizes to endosomes differs from a previous report that
GFP-PLD is diffusely distributed throughout the cytoplasm of vegetative
cells (Rudge et al., 1998
). We conclude that Sfh2p localizes
to yeast endosomes when overexpressed and that Sfh2p substantially
colocalizes with PLD under these conditions.
|
| |
DISCUSSION |
|---|
|
|
|---|
Herein we characterize a novel family of PITPs in Saccharomyces cerevisiae that expand the repertoire of PITPs from one (Sec14p) to five in this yeast. These PITPs are encoded by the SFH2, SFH3, SFH4, and SFH5 genes, respectively. The corresponding gene products (collectively referred to as SFH proteins) share modest homology with Sec14p throughout their primary sequences (Figure 2A). The modest level of primary sequence homology shared by Sec14p and the SFH proteins assumes functional significance because individual overproduction of Sfh2p, Sfh4p, or Sfh5p rescues both the growth and the Golgi secretory defects associated with Sec14p dysfunction in vivo (Figure 2, B and C). Sfh3p overproduction also partially alleviates these Golgi secretory defects but is insufficient for restoration of growth to Sec14p-deficient yeast. Individual overproduction of any one of these four SFH proteins in yeast results in increased PtdIns-transfer activity in cytosol preparations (Figure 3A), and recombinant Sfh2p, Sfh3p, and Sfh4p exhibit PtdIns-transfer activity (Figure 3C). These data formally demonstrate that at least Sfh2p, Sfh3p, and Sfh4p are PITPs. Sfh5p overproduction evokes measurable PtdIns-transfer activity in yeast but not in E. coli (Figure 3, A and C). We cannot provide a precise rationale for these results. Sfh5p may misfold when expressed in bacteria, although we detect soluble full-length antigen in E. coli expressing Sfh5p. Alternatively, Sfh5p may be modified in yeast, and this modification may be essential for PtdIns-transfer activity. Finally, Sfh5p may not be a PITP but may regulate expression of SFH2, SFH3, or SFH4. Although we favor the idea that Sfh5p exhibits intrinsic PITP activity, a formal confirmation remains lacking.
The yeast SFH PITPs exhibit biochemical similarities to
Sec14p. However, these proteins also exhibit properties that
distinguish them from Sec14p. Whereas Sec14p conforms to a classic
definition of a PITP (i.e., it is operationally a soluble protein that
effects both PtdIns and PtdCho transfer in vivo), the SFH
proteins exhibit PtdIns-transfer activity but not PtdCho-transfer
activity (Figure 3, B and D). Moreover, these PITPs are membrane
associated in yeast and must be stripped from membranes with salt for
their activities to be measured in cytosol preparations. Thus, these SFH proteins represent atypical PITPs that more closely
resemble the membrane-associated soybean Ssh2p, which exhibits
PtdIns-transfer activity (but not PtdCho-transfer activity) in vitro
and also binds phosphoinositides (Kearns et al., 1998b
).
Whether the yeast SFH proteins bind phosphoinositides
remains to be determined. An additional point of interest in this
regard is our inability to measure PITP activity in lysates prepared
from the
cki1,
sec14 strain
CTY303, a strain we have routinely used for biochemical characterization of both heterologous PITPs and the SFH gene
products (see above). This strain expresses the full complement of
functional SFH genes, but the aggregate SFH
expression levels are too low to contribute meaningful signal in
PtdIns-transfer assays.
The SFH proteins do not individually, or collectively,
execute essential cellular functions (Figure 4A). Moreover, with the exception of
sfh2 and
sfh3, individual disruptions do not exacerbate sec14-1ts-associated growth defects, and
en bloc deletion of SFH genes is not a lethal event when
introduced into sec14-1ts genetic
backgrounds. Rather, individual disruption of SFH2 or SFH3, or collective ablation of all SFH genes,
decreases the restrictive temperature of
sec14-1ts strains (Figure 4B). These data
suggest that SFH