INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Oxidative stress (OS) is an unavoidable consequence of oxygen metabolism and therefore occurs in the cells of all aerobic organisms. OS is a state within the cell in which the level of reactive oxygen species, such as superoxide anions (O₂), hydrogen peroxide (H₂O₂), and hydroxyl radicals (OH^.), exceeds the available antioxidant defenses that scavenge and inactivate the reactive oxygen species. It is important that aerobic cells respond to OS, because reactive oxygen species are chemically very reactive and consequently damage intracellular components. Such damage has been implicated in aging, all stages of cancer, and numerous other human diseases (for a review, see Halliwell, 1987). Thus, oxygen-utilizing cells have evolved defense mechanisms to protect against the damage caused by OS called the oxidative stress response (OSR). However, despite the importance of the OSR in maintaining homeostasis, little is known about how this response is regulated.

The yeast Saccharomyces cerevisiae is an important model organism for the study of the eukaryotic OSR (Jamieson, 1998). The discovery of the OSR in S. cerevisiae followed observations that pretreatment of cells with low doses of an oxidizing agent led to an increase in resistance to subsequent treatment with a higher dose (Jamieson, 1992). The tolerant state is achieved by increasing the production of antioxidant defense proteins through an increase in gene expression induced by exposure to low doses of oxidants (Jamieson et al., 1994).

The thioredoxin system is an important conserved system for protection against OS by reducing peroxides such as H₂O₂ to harmless products. The system is composed of three proteins, thioredoxin peroxidase (Tsa1p), thioredoxin (Trx2p), and thioredoxin reductase (Trr1p) (Chae et al., 1994; Netto et al., 1996) (Figure 1A). The expression of genes encoding the components of the thioredoxin system in S. cerevisiae, TSA1, TRX2, and TRR1, is induced in response to H₂O₂ (Kuge and Jones, 1994; Morgan et al., 1997; Godon et al., 1998; Lee et al., 1999).

View larger version (45K): [in this window] [in a new window]   Figure 1.   Genetic analysis of the H2O2-induced expression of the TRX2 gene. (A) The likely mechanism by which the thioredoxin system reduces peroxides. The transfer of electrons from NADPH to peroxide in the thioredoxin system is thought to occur in sequence. The electrons flow from NADPH to two tightly bound FAD molecules and from FAD to a redox-sensitive disulfide in thioredoxin (Trx2p), which can then reduce the disulfide linkages within thioredoxin peroxidase (Tsa1p). Tsa1p then passes the electrons onto the peroxide, reducing it to a harmless product and completing the electron transfer. Adapted from Chae et al., 1994. R and O indicate the reduced and oxidized forms of the respective proteins. (B) The sensitivity of W303-1a, skn7, yap1skn7, and the #48 mutant strains to H2O2. (C) Spot tests showing the sensitivity of the tsa1 strain to tBOOH. Strains were tsa1, tsa1 containing WT.TSA1, and W303-1a. (D) H2O2-induced lacZ assays of the tsa1 strain containing either the Ycplac111 vector or the WT.TSA1 plasmid.

Two transcription factors, Yap1p and Skn7p, are involved in the H₂O₂-induced expression of TSA1, TRX2, and TRR1 in S. cerevisiae (Kuge and Jones, 1994; Morgan et al., 1997; Lee et al., 1999). Yap1p is a member of the c-Jun family of proteins, containing a basic leucine zipper domain characteristic of all Ap-1-like proteins. An important method of regulating Yap1p activity by the OSR involves regulation of the nuclear localization of Yap1p mediated by its cysteine-rich C-terminal region (Kuge et al., 1997; Wemmie et al., 1997). However, other regions of Yap1p have also been suggested to play a role in the OS regulation of Yap1p (Wemmie et al., 1997). Although Skn7p has been shown to bind to the TSA1 and TRX2 promoters (Morgan et al., 1997; Lee et al., 1999), the mechanism by which OS regulates Skn7p activity is not understood but may involve regulation by the Ras/PKA pathway (Charizanis et al., 1999). Skn7p is a member of the response regulator protein family (Brown et al., 1993, 1994; Morgan et al., 1995; Krems et al., 1996), the members of which are usually transcription factors that regulate gene transcription through a two-component signal transduction system (for a review, see Stock et al., 1989). However, results suggest that the two-component mechanism is probably not important for the regulation of Skn7p in response to H₂O₂ (Morgan et al., 1997). Thus, although Skn7p and Yap1p regulate gene expression in response to OS, the mechanisms by which regulation takes place are not well characterized. Furthermore, Skn7p and Yap1p may not be the only transcriptional mechanisms that are used for the regulation of TRX2 expression in response to H₂O₂, because a skn7yap1 strain still shows some residual TRX2 induction (Morgan et al., 1997).

To identify proteins involved in the signal transduction pathways responsible for sensing and regulating the H₂O₂-induced expression of the TRX2 gene, a genetic screen was performed in S. cerevisiae. Mutants were isolated that affected the expression of a TRX2 promoter lacZ fusion in response to H₂O₂. Cloning and characterization of one such mutant identified Tsa1p as a novel regulator of TRX2 and TRR1 expression in response to H₂O₂.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Yeast Strains and Growth Conditions

The Saccharomyces cerevisiae strains used were W303-1a haploid (a ade2-1 trp1-1 can1-100 leu2-3,112 his3-11 ura3), W303-1a diploid (a/ ade2-1 trp1-1 can1-100 leu2-3,112 his3-11 ura3), skn7 (a ade2-1 trp1-1 can1-100 leu2-3,112 his3-11 ura3 SKN7::HIS3), and yap1 ( ade2-1 trp1-1 can1-100 leu2-3,112 his3-11 ura3 YAP1::TRP1).

S. cerevisiae strains were grown in either rich YPD medium for nonselective growth or minimal SD medium for selective growth (Sherman et al., 1986). For sporulation, medium contained 1% potassium acetate, 0.1% yeast extract, 0.05% dextrose, and 2% agar (Sherman et al., 1986). All strains were grown at 30°C unless stated otherwise.

Thirty percent H₂O₂ and 70% tetra-butyl hydroperoxide (t BOOH) were both obtained from Sigma Chemical (St. Louis, MO) and used at the concentrations given below. Restriction enzymes and DNA polymerases were from Promega (Madison, WI).

Yeast Techniques

Yeast cells were transformed with the use of the lithium acetate method described by Schiestl and Gietz (1989). Plasmids were isolated from yeast cells as described by Robzyk and Kassir (1992). Genomic DNA was isolated from yeast cells as described by Hoffman and Winston (1987).

Genetic Screen

To identify mutants that affect the H₂O₂-induced expression of TRX2 in S. cerevisiae, a reporter plasmid was used that contains the Escherichia coli lacZ gene fused to the TRX2 promoter region (TRX2lacZ) (Kuge and Jones, 1994). When this plasmid is introduced into S. cerevisiae, the expression of the lacZ gene is induced in response to OS in a manner mimicking that of chromosomal TRX2 (Kuge and Jones, 1994). Haploid wild-type S. cerevisiae cells containing the TRX2lacZ plasmid were mutagenized with UV light, and mutations were identified that showed reduced or abolished H₂O₂-induced expression of lacZ. As an additional means of selecting mutants affecting chromosomal TRX2 expression, mutants that also displayed increased sensitivity to H₂O₂ were favored because a trx2 strain has increased sensitivity to H₂O₂ (Kuge and Jones, 1994).

LacZ Expression Assays

H₂O₂-induced lacZ expression studies were performed by -galactosidase filter assays by the method of Guarente (1983). Filters of cells containing the TRX2lacZ plasmid (Kuge and Jones, 1994) were treated with 1 mM H₂O₂ for 90 min at 30°C, and then -galactosidase filter assays were performed. The filters were incubated at 37°C and examined at 1-h intervals for -galactosidase activity as determined by the development of blue color.

Deletion of the TSA1 Gene

The tsa1 strain was made by transformation of the wild-type W303-1a diploid strain with a 1.4-kilobase (kb) deletion fragment containing the HIS3 gene flanked by approximately 70 bases of genomic sequence from upstream of the TSA1 start codon and downstream of the TSA1 stop codon. The deletion fragment was obtained by PCR from the YDp-H vector (Berben et al., 1991) with the use of the oligonucleotide primers TSA1.3 and TSA1.4. Deletions were confirmed by PCR with the use of the primers TSA1.1 and TSA1.2. Haploid tsa1 cells were isolated by dissection of the heterozygous diploid strain. Attempts to obtain the tsa1 directly in a haploid strain were unreliable, because several different possible deletions were obtained that displayed peroxide sensitivities ranging from similar to that of the skn7 and yap1 strains to similar to that of the wild-type strain.

The tsa1skn7 and tsa1yap1 double mutants were obtained by dissection of heterozygous diploids constructed by mating a tsa1 strain with either the skn7 or the yap1 strain.

Oligonucleotide Primer Sequences

Lib.1 (5'CTGGTTGACTTGTGCATGAACACGAGC3') and Lib.2 (5'ACCGAGGTGATACAATCTACC3') were used to sequence the inserts in the suppressor library plasmids. TSA1.1 (5'CGTCAGATCAATGCCGAACCGTTC3') and TSA1.2 (5'GAGCTAGTGTGAATAGCTTCTTAGACGG3') were used to amplify and sequence the TSA1 gene. TSA1.3 (5'CGGGCCTTCCCCTCGTTCAATTGCTCACAACCAACCACAACTACATACACATACATACACAATGGAATT -CCCGGGGATCCGGTGATTG3') and TSA1.4 (5'AAGTATAAAC-GTAAAGAGTGAATTTTAAATAAGTAGTCATTTAGACAACTCT -GCAAGCGCTTTAAAGCTAGCTTGGCTGCAGGTCGACGC3') were used to construct the TSA1 disruption fragment. CTT1.1 (5'CCGTTGGTGGTGAAAGTGGTACAC3') and CTT1.2 (5'GGA-CACTGTTCGGCAGTGTATTGG3') were used for amplification of the catalase probe. TSA1.M1 (5'GCAATGCGATGTGGCCACGTTATATAATGC3'), TSA1.M2 (5'GAGTGGTTGGTGTCAGACAACAATGGAATG3'), TSA1.M3 (5'CTTCTTCGATCGTGACACCATAGTCTCTGG3'), and TSA1.M4 (5'CGGGCACCAGA-AGGAATTCGCGGTG3') were used to form the TSA^AS, TSA^LT, and TSA^AS/LT constructs.

Plasmid Constructs

To form the WT.TSA1 construct, a Yep24 library plasmid, containing the wild-type TSA1 gene, was digested with PstI and a 2.25-kb fragment containing the TSA1 gene and promoter region was isolated. The TSA1-containing fragment was then ligated into PstI-digested Ycplac111 to generate WT.TSA1. Ycplac111 is a centromeric LEU2 plasmid (Gietz and Sugino, 1988).

The high-copy TSA1 plasmid (Yep24-TSA1) contains the TSA1 gene and promoter region in the high-copy 2µ vector Yep24 and was isolated as a library plasmid that could suppress the #48 mutant strain phenotypes.

To form the construct TSA1^AS, a two-step PCR method was used. This method introduced a G/C-to-T/A base pair (bp) substitution at position 303 in the TSA1 DNA sequence, resulting in an alanine-to-serine amino acid change. In the first step, a 0.576-kb TSA1 DNA product was amplified by PCR from the WT.TSA1 plasmid with the use of the primers TSA1.M1 and TSA1.M2. TSA1.M2 contains the C-to-A base change at position 303 in TSA1 and amplifies a PCR product that contains the G/C-to-T/A base mutation at bp 303. In the next PCR step, a 1.18-kb full-length TSA1 product (also containing the G/C-to-T/A bp change) was amplified from the WT.TSA1 plasmid with the use of the 0.576-kb TSA1 product amplified from the first PCR as one primer and TSA1.M4 as the other primer. The TSA1 PCR product was then digested with EcoRI and ligated into Ycplac111 digested with EcoRI and SmaI to create TSA1^AS. The TSA1^LT construct was generated with the use of the same two-step PCR method described to make TSA1^AS except that a TSA1 sequence containing the TT/AA-to-AC/TG bp changes at positions 342 and 343, encoding the leucine-to-threonine amino acid change, was amplified. The oligonucleotide primers used in the first stage PCR were TSA1.M1 and TSA1.M3 (containing the AA-to-TG base changes at 342 and 343), which produced a 0.616-kb product. The first-step PCR product was then used in the second-stage PCR with the oligonucleotide primer TSA1.M4 to amplify the full-length TSA1 gene containing the TT/AA-to-AC/TG bp changes. The TSA1 PCR product was then digested with EcoRI and ligated into Ycplac111 digested with EcoRI and SmaI to create TSA1^LT. The TSA1^AS/LT construct, which encodes a Tsa1p containing both the alanine-to-serine and leucine-to-threonine amino acid changes, was generated essentially as described for the TSA1^LT construct. However, instead of WT.TSA1, the TSA1^AS construct was used as a DNA template for the first- and second-step PCR reactions.

DNA Sequencing

All DNA sequencing was performed by the Molecular Biology Sequencing Center (University of Newcastle upon Tyne) with the use of the appropriate oligonucleotide primers.

Sensitivity Tests

To test the sensitivity of the isolated mutants to H₂O₂, cells were resuspended in 20 µl of water and streaked onto SD medium. A 3-mm filter paper circle (Whatman [Clifton, NJ] microfiber paper) was soaked in 15 µl of 10% H₂O₂ and placed in the center of the plate. Plates were incubated for 2 d at 30°C, and the zone of inhibited growth was measured.

For spot tests, strains were grown to midlog phase (~1 × 10⁷ cells/ml) and serial 10-fold dilutions were made. Five microliters of undiluted strain and each of the dilutions were spotted onto medium containing various concentrations of tBOOH. Plates were incubated at 25°C for 2-3 d, and sensitivity was examined.

RNA Analysis

RNA was extracted, with the use of a method described previously by Aves et al. (1985), from cells of midlog-phase strains growing in SD medium. Northern blotting was performed as described previously (Morgan et al., 1995), and the blots were probed with various gene-specific probes. The TRX2 and TRR1 probes were obtained by PCR with the use of gene-specific oligonucleotides (Morgan et al., 1997). The CTT1 probe was obtained by PCR with the use of the gene-specific oligonucleotides CTT1.1 and CTT1.2. The ACT1 probe was used as a loading control (Morgan et al., 1997). Probed membranes were autoradiographed with Fuji Medical (Tokyo, Japan) x-ray film (Super RX) for the desired time and then developed. Alternatively, membranes were exposed to a Phosphorimager plate and analyzed with the use of a Phosphorimager (Bio-imaging analyzer Fuji film Bas-1500). The data obtained were quantitated with the use of Tina 2.0 software (Raytest, Straubenhardt, Germany).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Genetic Screen for Mutations That Regulate the OSR

A genetic screen was performed to isolate mutations in genes important for the H₂O₂-induced regulation of the TRX2 gene (see MATERIALS AND METHODS). One mutant isolated from the screen, mutant #48, was of particular interest because of several phenotypes. First, H₂O₂-induced expression of lacZ from a TRX2lacZ reporter plasmid was reduced. Second, it was extremely sensitive to peroxides, showing a much greater sensitivity than the isogenic wild-type, skn7, and yap1skn7 strains (Figure 1B). To further characterize the mutation(s) in the #48 mutant, the strain was mated with a wild-type haploid and the heterozygous diploid was sporulated. Analysis of tetrads suggested that the abolished H₂O₂-induced expression of lacZ from the TRX2lacZ plasmid and the increased sensitivity to peroxides (H₂O₂ and tBOOH) were the result of a single mutation or very closely linked gene mutations. In addition, characterization of the heterozygous diploid indicated that both of the phenotypes exhibited by the #48 mutant were only partially rescued by the presence of the wild-type locus.

Identification of the Mutated Gene

The ability of the heterozygous diploid to grow on medium containing 0.16 mM tBOOH, a concentration lethal to the haploid #48 mutant, was used to clone the wild-type allele. A high-copy S. cerevisiae genomic library, ligated into the Yep24 vector (kindly provided by L.H. Johnston, NIMR, London), was introduced into the haploid #48 mutant and transformants were identified that could grow on medium containing 0.16 mM tBOOH. Approximately 30,000 transformants were screened, and 10 plasmids that enabled the mutant to grow on 0.16 mM tBOOH were isolated and analyzed. Sequencing of the inserts from the suppressor plasmids with the use of the oligonucleotide primers Lib.1 and Lib.2 revealed that 8 of the 10 suppressor plasmids contained genomic inserts, which shared a region of chromosome XIII spanning two hypothetical ORFs and TSA1, a gene that had previously been shown to protect against OS.

To determine whether the TSA1 gene was responsible for suppression of the phenotypes observed in the #48 mutant, the wild-type TSA1 gene and promoter region were ligated into the centromeric vector, Ycplac111 (WT.TSA1) (Gietz and Sugino, 1988). The WT.TSA1 plasmid or the Ycplac111 vector was then introduced into the #48 mutant haploid strain for complementation studies. The Ycplac111 vector was unable to complement any of the phenotypes observed in the #48 mutant (our unpublished results). However, WT.TSA1 partially complemented the #48 mutant phenotypes of increased peroxide sensitivity and reduced H₂O₂-induced expression of lacZ from the TRX2lacZ plasmid, behaving very similarly to the #48/wild-type heterozygous diploid (our unpublished results). This is the expected result if the #48 mutant phenotypes are due to mutation(s) of the TSA1 gene, because the #48 mutant phenotypes are only partially rescued in a heterozygous diploid.

To confirm that TSA1 was indeed mutated in the #48 mutant strain, the TSA1 gene was amplified independently several times by PCR with the use of the oligonucleotide primers TSA1.1 and TSA1.2 from the genome of the #48 mutant and DNA sequences were obtained. Analysis of the DNA sequences revealed that TSA1 from the #48 mutant encoded two amino acid changes, an alanine-to-serine substitution at position 102 and a leucine-to-threonine substitution at position 114.

Phenotype of the tsa1 Strain

To examine the role of Tsa1p in the regulation of gene expression, a tsa1 strain was constructed. The tsa1 haploids were examined for sensitivity to H₂O₂ and tBOOH and also to H₂O₂-induced expression of the lacZ gene from the TRX2lacZ plasmid. Similar to mutant #48, the tsa1 strain was more sensitive than the isogenic wild-type strain to both H₂O₂ (our unpublished results) and tBOOH (Figure 1C) and also showed a reduction in H₂O₂-induced expression of lacZ (Figure 1D). Introduction of WT.TSA1 into the deletion strain rescued both the peroxide sensitivity and the reduced H₂O₂-induced expression of the reporter construct, confirming that both of these phenotypes were the result of losing Tsa1p function (Figure 1, C and D). The similar phenotypes of the tsa1 strain and mutant #48 strongly suggest that the phenotypes of the #48 mutant are the result of the loss of Tsa1p function. However, the #48 mutant phenotypes are only partially rescued in a heterozygous diploid, suggesting that the mutant tsa1 is semidominant but that tsa1 is recessive. Hence, the mutant Tsa1p in the #48/wild-type heterozygous diploid may also be interfering with the activity of the wild-type Tsa1p.

Loss of Tsa1p Reduces the H₂O₂-induced Expression of Native Chromosomal TRX2

To determine whether the reduced H₂O₂-induced expression of lacZ from the TRX2lacZ plasmid represented a reduction in induction of the normal TRX2 promoter in response to H₂O₂, Northern blot analysis was performed on RNA isolated from tsa1 cells. Total cellular RNA was isolated from untreated cells and cells treated with 0.1 mM H₂O₂ and examined for both TRX2 and ACT1 RNA levels (Figure 2A). These results showed that deletion of the TSA1 gene did not affect the basal expression of TRX2. However, the tsa1 strain showed reduced H₂O₂-induced expression of chromosomal TRX2 compared with the isogenic wild-type strain, in agreement with the lacZ reporter analysis. In addition, the tsa1 strain behaved very similarly to the skn7 and yap1 strains in that a weak residual induction of TRX2 was evident. Yet, although the tsa1, skn7, and yap1 strains show a weak residual induction of TRX2, the kinetics of TRX2 induction is different from that observed in the wild-type strain (Figure 2A). The wild-type strain responds rapidly to treatment with 0.1 mM H₂O₂, with TRX2 maximally expressed after 40 min. In contrast, the yap1, skn7, and tsa1 strains do not reach maximal H₂O₂-induced TRX2 expression until at least 60 min of incubation.

View larger version (33K): [in this window] [in a new window]   Figure 2.   Tsa1p regulates the expression of TRX2 and TRR1 in response to H2O2. Northern blot analysis of RNA isolated from different midlog-phase growing cultures either untreated (lanes 1, 3, 5, and 7) or treated with 0.1 mM H2O2 (lanes 2, 4, 6, and 8) for 40 min with the use of probes specific for TRX2 (A) or TRR1 (B) and ACT1. Strains were W303-1a (lanes 1 and 2), skn7 (lanes 3 and 4), yap1 (lanes 5 and 6), and tsa1 (lanes 7 and 8). The panels below the Northern blots show quantitation of the TRX2 and TRR1 transcript levels relative to the ACT1 transcript. The line graphs represent the kinetics of TRX2 and TRR1 induction in the W303-1a, skn7, yap1, and tsa1 strains during 60 min of incubation with 0.1 mM H2O2.

Trr1p is also involved in the thioredoxin system (Figure 1A) and, like TRX2, TRR1 expression is induced in response to H₂O₂ in a Skn7p- and Yap1p-dependent manner (Morgan et al., 1997). Hence, it was possible that TRR1 expression may also be affected by the loss of Tsa1p. Indeed, Northern blot analysis showed that, like TRX2, the H₂O₂-induced expression of TRR1 is reduced in the tsa1 strain compared with the wild-type strain (Figure 2B). The pattern of H₂O₂-induced expression of TRR1 in the tsa1 strain is very similar to that seen in the skn7 and yap1 strains, with no induction of TRR1 expression apparent (Figure 2B).

To confirm that the reduction in H₂O₂-induced TRX2 and TRR1 expression was the result of the loss of Tsa1p, gene expression was examined in a tsa1 strain that contained either Ycplac111 or the WT.TSA1 plasmid. The results demonstrated that the tsa1 strain containing the Ycplac111 vector alone showed a reduction in H₂O₂-induced expression of the TRX2 (Figure 3A) and TRR1 (Figure 3B) genes, whereas the introduction of WT.TSA1 restored the H₂O₂-dependent induction of the TRX2 (Figure 3A) and TRR1 (Figure 3B) genes to wild-type levels.

View larger version (29K): [in this window] [in a new window]   Figure 3.   Introduction of the wild-type TSA1 gene into a tsa1 strain restores the normal H2O2 induction of TRX2, TRR1, and CTT1. Northern blot analysis of RNA isolated from a midlog-phase culture of a tsa1 strain containing either Ycplac111 (lanes 1 and 2) or WT.TSA1 (lanes 3 and 4), which were either untreated (lanes 1 and 3) or treated with 0.1 mM H2O2 for 20 min (lanes 2 and 4) with the use of probes specific for TRX2 (A), TRR1 (B), or CTT1 (C) and ACT1. The panels below the Northern blots show quantitation of the different transcripts relative to the ACT1 transcript.

Loss of Tsa1p Induces Expression of the Catalase Gene

To determine whether the loss of Tsa1p reduced the transcription of another antioxidant-encoding gene, or whether it was specific for the thioredoxin system, the H₂O₂-induced expression of CTT1 was examined in a tsa1 strain. The CTT1 gene encodes the antioxidant protein catalase, which is involved in the detoxification of both H₂O₂ and superoxide radicals from the cell (Winkler et al., 1988). Like that of TSA1, TRX2, and TRR1, the expression of CTT1 is induced in response to H₂O₂. However, the level of CTT1 induction is dose dependent, whereas TRR1 levels appear to be maximally induced at low concentrations of H₂O₂ (Godon et al., 1998). Northern blot analysis was performed on RNA isolated from tsa1 cells with the use of probes specific to CTT1 and ACT1. Unlike the expression of TRX2 and TRR1, the loss of Tsa1p was found to increase the H₂O₂-induced expression of CTT1 (Figure 3C) compared with the wild-type strain. Introduction of WT.TSA1 into the tsa1 strain restored the wild-type expression of CTT1 (Figure 3C). At the concentration of H₂O₂ used, only a small induction of CTT1, if any, was expected (Godon et al., 1998; our unpublished results). In the tsa1 mutant, the effective H₂O₂ concentration is likely to be higher than that in the wild-type strain because one of the main pathways for H₂O₂ detoxification has been weakened considerably.

Analysis of the Effects of TSA1 Point Mutations on Tsa1p Function

To determine whether the amino acid alterations encoded by the mutant TSA1 gene were important for the phenotypes that were observed in the #48 mutant, three constructs were made in the centromeric plasmid Ycplac111. These constructs contained the TSA1 gene encoding the Ala¹⁰²-to-Ser¹⁰² amino acid substitution (construct TSA1^AS), the Leu¹¹⁵-to-Thr¹¹⁵ amino acid substitution (construct TSA1^LT), or both of the amino acid substitutions together (construct TSA1^AS/LT). Ycplac111, WT.TSA1, and the mutant TSA1 constructs were introduced into a tsa1 strain to determine whether they could complement the peroxide sensitivity and the effects on H₂O₂-induced expression of TRX2 associated with the tsa1 strain.

The TSA1^AS construct increased the resistance of the tsa1 strain to OS induced by tBOOH to almost wild-type levels. In contrast, the tsa1 strain containing either the TSA1^LT or TSA1^AS/LT construct showed similar sensitivity to the tsa1 strain containing the Ycplac111 vector (Figure 4A). Northern blot analysis revealed that the TSA1^AS construct, but not the TSA1^LT and TSA1^AS/LT constructs, increased the H₂O₂-induced expression of the TRX2 gene compared with the tsa1 strain containing the Ycplac111 vector (Figure 4B), although none of the constructs restored expression to the levels observed with WT.TSA1. Hence, these results suggest that the point mutations observed in TSA1 from mutant #48, in particular the Leu¹¹⁵-to-Thr¹¹⁵ substitution, affect peroxide sensitivity and H₂O₂-induced expression of TRX2.

View larger version (44K): [in this window] [in a new window]   Figure 4.   Analysis of the TSA1 point mutations. (A) Sensitivity of the TSA1 point mutations to tBOOH. Cultures of the tsa1 strain containing Ycplac111, WT.TSA1, TSA1AS, TSA1LT, or TSA1AS/LT were grown to midlog phase, and 10-fold serial dilutions were spotted onto SD medium containing various concentrations of tBOOH. (B) H2O2-induced expression of TRX2. Northern blot analysis of RNA isolated from midlog-phase cultures either untreated (lanes 1, 3, 5, 7, and 9) or treated with 0.1 mM H2O2 for 20 min (lanes 2, 4, 6, 8, and 10) with the use of probes specific for the TRX2 and ACT1 transcripts. The tsa1 strain contained Ycplac111 (lanes 1 and 2), WT.TSA1 (lanes 3 and 4), TSA1AS (lanes 5 and 6), TSA1LT (lanes 7 and 8), or TSA1AS/LT (lanes 9 and 10). The panel below the Northern blots shows quantitation of the TRX2 transcript level relative to the ACT1 transcript.

Tsa1p-dependent Regulation of TRX2 Is through a Skn7p- and Yap1p-dependent Pathway

Skn7p and Yap1p are directly involved in the H₂O₂-induced expression of TRX2 (Kuge and Jones, 1994; Morgan et al., 1997). A skn7yap1 strain shows the same level of residual H₂O₂-induced TRX2 expression as either of the single-deletion strains alone, indicating a Skn7p/Yap1p-independent pathway that regulates TRX2 expression in response to H₂O₂ (Morgan et al., 1997). Hence, to investigate whether Tsa1p regulates the H₂O₂-induced expression of TRX2 through this independent pathway, tsa1skn7 and tsa1yap1 double mutants were constructed and H₂O₂-induced expression of TRX2 was examined. If Tsa1p functions in a Skn7p/Yap1p-independent pathway, then the tsa1skn7 and tsa1yap1 double mutants should show a greater reduction in H₂O₂-induced TRX2 expression than the single deletions alone. Northern blot analysis revealed that both the tsa1skn7 and tsa1yap1 double mutants showed similar H₂O₂-induced TRX2 expression as the single-deletion strains (Figure 5), suggesting that Tsa1p functions within the Skn7p/Yap1p pathway.

View larger version (40K): [in this window] [in a new window]   Figure 5.   Northern blot analysis of RNA isolated from different midlog-phase cultures either untreated (lanes 1, 3, 5, 7, 9, and 11) or treated with 0.1 mM H2O2 (lanes 2, 4, 6, 8, 10, and 12) for 20 (A) and 40 (B) min with the use of probes specific for the TRX2 and ACT1 transcripts. The strains were W303-1a (lanes 1 and 2), tsa1 (lanes 3 and 4), skn7 (lanes 5 and 6), tsa1skn7 (lanes 7 and 8), yap1 (lanes 9 and 10), and tsa1yap1 (lanes 11 and 12). The panels below the Northern blots show quantitation of the different transcripts relative to the ACT1 transcript. (C) Kinetics of TRX2 induction. This graph shows the induction of TRX2 expression in the W303-1a, tsa1, skn7, tsa1skn7, yap1, and tsa1yap1 strains during 40 min of incubation with 0.1 mM H2O2.

Overexpression of TSA1

Analysis of the tsa1 strain and the TSA1 point mutations suggests that Tsa1p regulates the expression of components of the thioredoxin system. Such a result was completely unexpected, because it might have been predicted that a deletion of the TSA1 gene would have increased TRX2 and TRR1 expression by increasing the effective OS of the cell. In this scenario, overexpression of the TSA1 gene would be predicted to result in the reduction of TRX2 and TRR1 gene expression. Hence, the effects of overexpression of the TSA1 gene on peroxide resistance and H₂O₂-induced expression of TRX2 was examined (Figure 6). Overexpression of TSA1 increased both the peroxide resistance and the H₂O₂-induced expression of the TRX2 gene in the wild-type strain (Figure 6, A and B), although basal TRX2 expression remained unaffected. Thus, overexpression of TSA1 has the opposite affect than deletion of the TSA1 gene on peroxide resistance and H₂O₂-induced TRX2 expression. However, although the peroxide resistance of the skn7 and yap1 strains was increased on overexpression of TSA1 (Figure 6A), the H₂O₂-induced expression of the TRX2 gene remained unaffected (Figure 6B). Thus, the protective antioxidant function of Tsa1p is independent of Skn7p and Yap1p, whereas the H₂O₂-induced expression of TRX2 via Tsa1p requires both transcription factors.

View larger version (29K): [in this window] [in a new window]   Figure 6.   Overexpression of TSA1. (A) Spot tests showing the sensitivity to tBOOH after overexpression of TSA1. Strains were W303-1a, skn7, and yap1 containing either the Yep24 vector or the Yep24-TSA1 plasmid. (B) Northern blot analysis of RNA isolated from different midlog-phase cultures either untreated (lanes 1, 3, 5, 7, 9, and 11) or treated with 0.1 mM H2O2 for 20 min (lanes 2, 4, 6, 8, 10, and 12) with the use of probes specific for TRX2 and ACT1. Strains were W303-1a containing Yep24 (lanes 1 and 2), W303-1a containing Yep24-TSA1 (lanes 3 and 4), yap1 containing Yep24 (lanes 5 and 6), yap1 containing Yep24-TSA1 (lanes 7 and 8), skn7 containing Yep24 (lanes 9 and 10), and skn7 containing Yep24-TSA1 (lanes 11 and 12). The panel below the Northern blots shows quantitation of the TRX2 transcript relative to the ACT1 transcript.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The mechanisms by which eukaryotic cells sense and respond to redox conditions are not well understood. In this study, we describe a genetic screen that was designed to isolate proteins involved in the regulation of TRX2, a key gene implicated in the OSR in S. cerevisiae. The results demonstrate that a loss-of-function mutation or a deletion of the TSA1 gene, which encodes the antioxidant thioredoxin peroxidase, reduced the induction of expression of the chromosomal TRX2 and TRR1 genes in response to H₂O₂ without affecting basal-level transcription. These results were very unexpected, because loss of the antioxidant Tsa1p might be expected, if anything, to have the opposite affect on the transcription of the thioredoxin system genes. Indeed, deletion of other components of the thioredoxin system induces the expression of thioredoxin system genes even in the absence of H₂O₂ treatment (Izawa et al., 1999; our unpublished results). Overexpression of the TSA1 gene in a wild-type strain has the opposite affect than the gene deletion, resulting in higher and/or faster induced expression of TRX2 without affecting the basal level. Together, these results demonstrate that Tsa1p, but not Trx1p, Trx2p, or Trr1p, is required for the induction of gene expression after treatment with low concentrations of H₂O₂.

It is possible that Tsa1p is required for the induction of all H₂O₂-induced genes. Hence, the expression of the CTT1 gene, encoding catalase, was investigated. Analysis of Ctt1p levels after H₂O₂ treatment has revealed that the amount of Ctt1p present is dependent on the concentration of oxidizing agent used (Godon et al., 1998). At the concentration of H₂O₂ used here, a relatively low induction of CTT1 expression was expected in the wild-type control. However, it was suspected that the loss of induction of the genes involved in the thioredoxin system might increase the induction of CTT1, and this was observed; in a tsa1 strain, CTT1 expression was induced approximately threefold higher than in the wild-type after H₂O₂ treatment. Hence, only a subset of genes show a loss of H₂O₂ induction in a tsa1 strain, indicating that Tsa1p is not a global regulator of OS-induced genes.

Previous studies have shown that S. cerevisiae cells demonstrate an OSR at low concentrations of oxidizing agents, which results in increased resistance to higher doses of the agent (Jamieson, 1992; Jamieson et al., 1994). The results presented here demonstrate that Tsa1p is involved in the transcriptional response to low doses of H₂O₂. Indeed, treatment of tsa1 cells with much higher, damaging doses of H₂O₂ results in the induction of TRX2 expression even in the absence of the TSA1 gene (our unpublished results). It may be relevant to this point that Tsa1p is susceptible to substrate inhibition at high concentrations of H₂O₂ (Netto et al., 1996). These data indicate that the regulation of TRX2 gene expression is different at low and high doses of H₂O₂. The differences observed in TRX2 expression are thus likely to be related to the increased cellular damage that occurs at the higher concentrations of H₂O₂. Our results also demonstrate that Tsa1p does not affect the basal levels of TRX2 and TRR1 gene expression. However, the effect on TRR1 expression is in contrast to the results observed by Inoue et al. (1999), which showed an increased basal expression of TRR1 in a tsa1 strain, although induced expression was not examined. The basis of this observed difference in basal TRR1 expression is unclear.

Thioredoxin peroxidase proteins are highly conserved throughout evolution, and in higher eukaryotes these proteins have been found to have regulatory functions in addition to their antioxidant properties. For example, a human thioredoxin peroxidase, AEO372, has been shown to negatively regulate the activity of the transcription factor NF-B through an unknown mechanism that modulates the phosphorylation state of IB- (Jin et al., 1997). In addition, the human cytokine TRANK (thioredoxin peroxidase-related activator of NF-B and c-Jun N-terminal kinase), which is highly homologous to thioredoxin peroxidase, activates both NF-B and JNK (Haridas et al., 1998). In S. cerevisiae, the transcription factors Skn7p and Yap1p are involved in the regulation of TSA1, TRX2, and TRR1 expression in response to H₂O₂, suggesting that Tsa1p may regulate the activity of these proteins (Kuge and Jones, 1994; Morgan et al., 1997; Lee et al., 1999). Indeed, analysis of the tsa1skn7 and tsa1yap1 strains suggests that Tsa1p functions in the Skn7p/Yap1p pathway to regulate TRX2 expression (Figure 5). Furthermore, although overexpression of Tsa1p increases the peroxide resistance of the wild-type, skn7, and yap1 strains, only the wild-type strain shows an increase in the H₂O₂-induced expression of TRX2 (Figure 6), strongly suggesting that Tsa1p-dependent expression of TRX2 requires Skn7p and Yap1p. The regulation of Skn7p and Yap1p by the OSR is only partially understood. Previous studies have suggested that the DNA-binding ability of these transcription factors to the TRX2 promoter is largely unaffected by H₂O₂ (Kuge and Jones, 1994; Morgan et al., 1997). However, in response to various oxidizing agents, including H₂O₂, Yap1p localizes to the nucleus (Kuge et al., 1997). A cysteine rich domain (CRD) at the C terminus of Yap1p regulates the OS localization (Kuge et al., 1997), and it is possible that the regulation of the CRD region by OS is through the redox status of these cysteine residues. Hence, the localization of Yap1p could have been affected in a tsa1 strain after H₂O₂ treatment. However, Yap1p localizes to the nucleus normally in the tsa1 strain after H₂O₂ treatment (our unpublished results). Thus, the basis of the Tsa1p effect on TRX2 and TRR1 expression is not due to inhibition of Yap1p nuclear localization in oxidizing conditions.

The oxidation of other cysteine residues in Skn7p and/or Yap1p may be sensitive to the activity of the thioredoxin pathway. Indeed, deletion analyses have identified regions of Yap1p, in addition to the CRD region, that are important for activity in response to different oxidizing agents (Wemmie et al., 1997). The basis of the regulation of Yap1p by these different oxidizing agents is not understood but may be related to the regulation of the protein by Tsa1p. The regulation of Skn7p by the OSR is also poorly understood but is likely to involve the function of a coiled-coil domain in the protein and repression of Skn7p activity by the PKA pathway (Alberts et al., 1998; Charizanis et al., 1999). Hence, it is possible that Tsa1p may affect the regulation of Skn7p through these two pathways.

The ability of Tsa1p to interact directly with Skn7p or Yap1p was tested by two hybrid studies. However, in the presence or absence of OS, no interaction was observed (our unpublished results). In addition, the high- and low-dose responses of TRX2 expression to H₂O₂ are dependent on both Yap1p and Skn7p, whereas only the low-dose response is dependent on Tsa1p. Hence, Yap1p and Skn7p are able to respond to higher concentrations of H₂O₂ in a Tsa1p-independent manner. Thus, the basis of the regulation of TRX2 and TRR1 expression by Tsa1p in the OSR is unclear. It is possible that Tsa1p does not directly regulate TRX2 and TRR1 expression but rather the redox status of other proteins in the thioredoxin pathway regulates their expression (Figure 7).

View larger version (15K): [in this window] [in a new window]   Figure 7.   Model for the regulation of TRX2 expression by Tsa1p. The data suggest that thioredoxin peroxidase may regulate the expression of thioredoxin through the activity of the Skn7p and Yap1p transcription factors. This regulation by Tsa1p could involve the direct regulation of the redox status of Skn7p and/or Yap1p. Alternatively, the redox status of an interacting regulatory protein or the phosphorylation state of Skn7p and/or Yap1p could be regulated. It is possible that the affect of Tsa1p is indirect, i.e., that it alters the redox status of one or more members of the thioredoxin pathway and that this protein is the regulatory element for OS-induced expression of TRX2. The arrows between the proteins of the thioredoxin system represent changes in the redox status of the proteins, and YRE represents the Yap1p-binding sites.

The identification of thioredoxin peroxidase, a conserved abundant protein that reduces reactive oxygen species, as a specific inducer of thioredoxin and thioredoxin reductase gene expression in response to OS in S. cerevisiae suggests that this protein is part of an important conserved sensing mechanism for redox conditions in eukaryotes. Thioredoxin peroxidase is one of the main cellular enzymes for the detoxification of H₂O₂ through the thioredoxin system, and the observation that Tsa1p is required for the induction of the other components in the thioredoxin system suggests the presence of a positive feedback loop in which at low levels of OS the redox state of Tsa1p regulates the expression of the other components of the pathway. Further experiments to understand the basis of this regulation in S. cerevisiae should provide insight into the detection processes and cellular responses to OS.