![]() |
|
|
Vol. 11, Issue 8, 2643-2655, August 2000



and
*Departments of Cell Biology,
Biochemistry and
Molecular Genetics, and §Microbiology; and
Biostatistics Unit, Comprehensive Cancer Center,
University of Alabama at Birmingham, Birmingham, AL 35294-0005
| |
ABSTRACT |
|---|
|
|
|---|
How recycling receptors are segregated from down-regulated receptors in the endosome is unknown. In previous studies, we demonstrated that substitutions in the transferrin receptor (TR) transmembrane domain (TM) convert the protein from an efficiently recycling receptor to one that is rapidly down regulated. In this study, we demonstrate that the "signal" within the TM necessary and sufficient for down-regulation is Thr11Gln17Thr19 (numbering in TM). Transplantation of these polar residues into the wild-type TR promotes receptor down-regulation that can be demonstrated by changes in protein half-life and in receptor recycling. Surprisingly, this modification dramatically increases the TR internalization rate as well (~79% increase). Sucrose gradient centrifugation and cross-linking studies reveal that propensity of the receptors to self-associate correlates with down-regulation. Interestingly, a number of cell surface proteins that contain TM polar residues are known to be efficiently down-regulated, whereas recycling receptors for low-density lipoprotein and transferrin conspicuously lack these residues. Our data, therefore, suggest a simple model in which specific residues within the TM sequences dramatically influence the fate of membrane proteins after endocytosis, providing an alternative signal for down-regulation of receptor complexes to the well-characterized cytoplasmic tail targeting signals.
| |
INTRODUCTION |
|---|
|
|
|---|
Endocytosis is required for delivery of extracellular
nutrients, down-regulation of growth factor receptors, and maintenance of cell polarity and membrane homeostasis (for review, see Mellman, 1996
; Mukherjee et al., 1997
). After internalization,
transport receptors such as the transferrin receptor (TR) deliver and
release their cargo into the low-pH environment of the early endosome before recycling back to the cell surface (Dautry-Varsat et
al., 1983
; Hopkins, 1983
; Klausner et al., 1983
).
Because the t1/2 for TR recycling is
~16 min (Mukherjee et al., 1997
) and the TR protein
half-life is >24 h (Omary and Trowbridge, 1981
), the TR effectively
serves as the prototype for a recycling receptor. Growth factor
receptors, however, such as epidermal growth factor receptor,
internalize after ligand binding and are rapidly delivered to lysosomes
where they are degraded (Carpenter and Cohen, 1976
; Dunn et
al., 1986
). Segregation of recycling and down-regulated receptors
appears to occur at the level of the sorting endosome (for review, see
Mukherjee et al., 1997
), with recycling receptors trafficking to the recycling endosome (Willingham et al.,
1984
) before returning to the cell surface.
A number of studies suggest that lysosomal targeting is
signal-mediated, whereas recycling occurs by default (for review, see
Gruenberg and Maxfield, 1995
). Perhaps the clearest example of this is
the epidermal growth factor receptor that requires an active
cytoplasmic kinase domain for entry into internal vesicles of the
multivesicular body (Futter et al., 1993
). Other late
endosomal/lysosomal targeting signals have been identified in the
cytoplasmic tails of P-selectin (Green et al., 1994
), the
mannose-6-phosphate receptor (Johnson and Kornfeld, 1992a
,b
),
the major histocompatibility complex (MHC) class II invariant chain
(Ii) (Bakke and Dobberstein, 1990
; Pieters et al., 1993
;
Bremnes et al., 1994
; Odorizzi et al., 1994
; Pond
et al., 1995
; Kang et al., 1998
), the T cell
receptor CD3
-chain (Letourneur and Klausner, 1992
), lysosomal acid
phosphatase (Peters et al., 1990
), and lysosome-associated
membrane glycoprotein (Williams and Fukuda, 1990
), suggesting that
entry into multivesicular bodies does not occur by default.
Studies to determine the structural requirements for recycling have
remained unsuccessful. For the TR, removal of the cytoplasmic tail
(Jing et al., 1990
; Johnson et al., 1993
) or the
extracellular domain (Rutledge et al., 1991
) has no effect
on recycling or protein turnover. Furthermore, the kinetics of TR
recycling is the same as the kinetics of lipid recycling, suggesting
that recycling occurs as a constitutive, bulk flow process (Mayor
et al., 1993
). A critical unanswered question, however, is
what is the mechanism that distinguishes recycling receptors from
down-regulated receptors in the sorting endosome? Clearly, one
mechanism for down-regulation is by receptor cross-linking with
multivalent ligands (Mellman and Plutner, 1984
; Weissman et
al., 1986
), but how this relates to the normal clearance process
is unclear.
In previous studies, we demonstrated that a 10-residue region within the MHC class II Ii transmembrane domain (TM), when substituted for the corresponding region of the TR resulted in down-regulation of the TR mutant. In this study, we tested the role of polar residues within this region and demonstrated that three polar residues were necessary and sufficient to promote TR down-regulation. Surprisingly, inclusion of these residues also enhances TR endocytosis. Together, our studies suggest that the presence or absence of polar residues in the TM can dramatically alter the fate of the membrane proteins after endocytosis.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cells and Reagents
Chicken embryo fibroblasts (CEFs) were grown in DMEM supplemented with 1% chicken serum and 1% fetal bovine serum (Atlanta Biologicals, Norcross, GA), 2% (vol/vol) tryptose phosphate broth (Difco, Detroit, MI), 2 mM L-glutamine, penicillin, and streptomycin. Protease inhibitors (complete mini-inhibitors) were obtained from Roche Diagnostic (Indianapolis, IN).
Construction of TR and Ii-TR Chimera Transmembrane Mutants
Mutants were prepared as described previously (Odorizzi et
al., 1994
) by the method of Kunkel (1985)
. The
IiTM 11-19 mutant was originally described in
Kang et al. (1998)
. The oligonucleotide primer for
preparation of the IiTM 11-19 mutant was
GGGACTATTGCCCTGCTCCTCGCTGGCGCGGCCGCCTTTATGATTGGC,
and the primer for the TRTM
Thr11Gln17Thr19
mutant was
GGGACTATTACTGTGATCGTCTTTTTCCAGATTACATTTATGATTGGC. The underlined bases indicate where the substitutions were introduced. All mutations were verified by dideoxynucleotide sequencing of the
entire cytoplasmic and TMs in the expression vector BH-RCAS (Sanger
et al., 1977
; Tabor and Richardson, 1987
).
Expression of Ii and TR Mutants: Metabolic Labeling and Immunoprecipitation
Human TR and Ii-TR mutants were expressed in CEFs as described
previously (Odorizzi et al., 1994
) by using the BH-RCAS
expression vector. Metabolic labeling and Immunoprecipitation of CEFs
expressing the various TR and Ii-TR constructs were performed as
described previously (Odorizzi et al., 1994
).
Indirect Immunofluorescence
Double-label indirect immunofluorescence was performed as
described previously (Odorizzi et al., 1994
). Slides were
analyzed on an Olympus IX70 epifluorescence microscope. Optical
sections were captured with a charge-coupled device,
high-resolution camera equipped with a camera/computer interface.
Images were analyzed with a Power Mac 9500/132 computer with IPLab
Spectrum software (Scanalytics, Fairfax, VA).
Measurement of Transferrin (Tf) Internalization and Proteolysis
The rate of Tf internalization was determined with the internal
surface (IN/SUR) method (Wiley and Cunningham, 1982
) as
described previously (Kang et al., 1998
). For the
proteolysis assay, CEFs expressing the various TR and Ii-TR constructs
were plated in triplicate at a density of
7.5×104 cells/cm2, in
24-well tissue culture plates 24 h before the assay (Costar, Cambridge, MA). Cells were incubated in serum-free DMEM for 1 h at
37°C, and then washed once with ice-cold 0.15 M NaCl, 0.01 M sodium
phosphate buffer (pH 7.4) containing 0.1% bovine serum albumin
(BSA-PBS). The cells were then pulsed for 10 min at 37°C with
125I-labeled Tf (4 µg/ml) in 0.15 ml of
BSA-PBS. The medium was then removed, and the cells were washed three
times with ice-cold BSA-PBS and incubated at 37°C with prewarmed
(37°C) DMEM containing 0.1% BSA and 50 µg/ml unlabeled Tf for 0, 15, 30, 60, and 120 min. After incubation, the medium was collected,
protein was precipitated in 10% trichloroacetic acid (TCA) and removed
by centrifugation, and the acid-soluble and acid-insoluble
radioactivity was counted in a gamma counter. The surface-bound and
internalized Tf in CEFs was determined by the acid wash procedure
described in Kang et al. (1998)
.
Tf Cross-linking
Aggregated Tf was prepared by reacting Tf (30 mg/ml) with a 20-fold molar excess of glutaraldehyde (Sigma, St. Louis, MO) in 50 mM PBS, pH 7.4, for 1 h at room temperature with gentle mixing. The reaction was quenched with the addition of lysine (to a final concentration of 0.1 M). The product was purified by gel filtration chromatography to separate the fractions into various MW ranges before 125I-labeling. Fractions corresponding to Tf dimers (MW ~160 kDa) were radiolabeled and used for the proteolysis assay.
Sucrose Gradient Sedimentation
Oligomerization of the wild-type TR and Ii-TR chimeras was
analyzed by velocity gradient centrifugation in sucrose performed essentially as described (Weisz et al., 1993
). Discontinuous
5-25% (wt/wt) sucrose gradients were poured over a 60% (wt/wt)
sucrose cushion (0.35 ml) in SW50.1 tubes. The sucrose percentage
difference between fractions was 2%. All solutions were in MNT buffer
[100 mM NaCl, 20 mM Tris, 30 mM
2-(N-morpholino)ethanesulfonic acid, pH 5.8]
containing 0.1% Triton X-100 and protease inhibitors. CEFs expressing
wild-type TR, TRTM
Thr11Gln17Thr19,
IiTM 11-19, and IiTM 11-19
Ala11Ala17Ala19
chimeras were metabolically labeled for 2 h and chased for 1 h in complete media. Cells were lysed in MNT buffer containing 1%
Triton X-100 and protease inhibitors. Lysates were centrifuged at
38,000 rpm in a NVT90 rotor in Beckman ultracentrifuge for 30 min at
4°C. The supernatants were immediately loaded on the top of preformed
sucrose gradients and centrifuged at 40,000 rpm in a SW50.1 rotor for
16 h at 4°C. Fractions (350 µl) were collected, immunoprecipitated with B3/25 antibody at pH 7, and analyzed on SDS-polyacrylamide gels. Immunoprecipitates were quantitated on a model
425 PhosphorImager (Molecular Dynamics, Sunnyvale, CA). The locations
of the proteins in the gradient were compared with the protein
standards, aldolase (7.4S), catalase (11.3S), and thyroglobulin
(19.3S), which were centrifuged under the same conditions. The S values
for the various constructs were calculated according to Martin and Ames
(1961)
.
Receptor Cross-linking
CEF cells in 10-cm dishes expressing wild-type and mutant TRs were metabolically labeled with 1.2 mCi/ml trans-35S label overnight and chased in complete media for 1 h. Cells were lysed in 50 mM HEPES-NaOH in lysis buffer (1% Triton X-100, 0.5% sodium deoxycholate, 0.3 M NaCl, pH 7.4) for 20 min. The postnuclear supernatants were incubated at room temperature with 1 mM 3,3'-dithiobis[sulfosuccinimidylpropionate] (DTSSP) (Pierce, Rockford, IL) for 20 min, and the reaction was stopped with an equal volume of 50 mM Tris-HCl in lysis buffer. Cross-linked samples were immunoprecipitated with B3/25 monoclonal antibody. The samples were then split into two fractions containing SDS sample buffer with reductant and without reductant. The immunoprecipitates were then analyzed by SDS-PAGE to evaluate the extent of cross-linking. Noncross-linked controls were analyzed to determine the position of a receptor dimer.
Calculation of Protein Half-Life
Down-regulation of membrane proteins from the cell surface can
be represented by a two-compartment model, as illustrated
below.
|
Because the only available information for evaluating
half-life is the recycling time and the efficiency,
, which refers to the proportion of amount not degraded after each round of recycling, the two compartments are viewed as one compartment denoted by C(t). The following differential equation
describes the above-mentioned system:
|
(1) |
|
(2) |
, can be written as,
|
(3) |
|
(4) |
|
(5) |
|
(6) |
|
(7) |
|
(8) |
|
(9) |
), the period of time required for one cycle
(p), and the time required for a newly synthesized membrane
protein to reach the cell surface from the biosynthetic pathway
(tsur). For example, if the membrane
protein requires 1 h for transit to the cell surface, its
recycling efficiency is 98%, and the period of time required for one
cycle is 40 min (i.e., 0.6667 h), then the estimated half-life of the
protein (t1/2) = 0.6667 ln
(0.5)/ln 0.98 + 1 h is,
|
(10) |
|
(11) |
|
(12) |
Analytical Ultracentrifugation
Sedimentation equilibrium experiments were conducted on
Beckman XL-A Analytical ultracentrifuge equipped with absorption optics with a four-cell An-60 Ti rotor with Beckman Optima XL-A/XL-I data
analysis software (version 4.0). Peptides were dissolved in 80%
trifluroethanol in H2O to a final concentration
of 2 mg/ml. Synthetic boundary cells were loaded with 120 µl of
solute with the reference sector filled with 130 µl of 80%
trifluroethanol in H2O. Samples were centrifuged
at 60,000 rpm for 30 h to allow the system to reach equilibrium.
Scans were taken at the wavelength 265 nm at radial increments of 0.001 cm. Equilibrium distributions were fitted for the molar mass of the
solute by standard numerical analysis with the program Microcal Origin
4.1 (MicroCal Software, Northampton, MA; www.microcal.com). The
partial specific volumes of peptides were calculated from their amino
acid composition: wild-type TRTM 11-19 (0.81 ml/g) and
IiTM 11-19 (0.76 ml/g). The density of the solvent was
determined to be 1.32645 g/ml with SEDNTRP program (Hansen et
al., 1994
, no. 2740).
| |
RESULTS |
|---|
|
|
|---|
Polar Residues in the TM Promote Degradation in a Post-Golgi-processing Compartment
Previous studies demonstrated that a TR chimera containing a
nine-residue substitution in the middle portion of the TM from the MHC
class II Ii (Kang et al., 1998
) was efficiently delivered to
the lysosomal compartment. Because this region of the Ii contains a
number of noncharged polar residues, including one Gln and two Thr
residues (whereas the wild-type TR did not), we hypothesized that these
amino acids might influence lysosomal targeting. To test this, we
constructed two mutants. In the first, we removed all of the polar
residues from the IiTM 11-19 by replacing them with
alanines (IiTM 11-19
Ala11Ala17Ala19;
Figure 1A). In the second, we replaced
three residues in the wild-type TR with the polar residues, inserting
them in the same positions as found in the IiTM 11-19
mutant (TRTM
Thr11Gln17Thr19;
Figure 1B). Although the structure of the TM domain is not known, it is
established that the TR is a dimer with a disulfide bridge at residue
89 (right at the TM/extracellular domain interface; Jing and
Trowbridge, 1987
). Assuming that the TR traverses the lipid bilayer as
a helix and that the alignment of the helices is dictated by the
disulfide bond at residue 89 (residue 28 in the TM), this places the
Thr residues on the outside and the Gln on the inside at the dimer
interface (Figure 1B). This orientation also places the major acylation
site, Cys 62 (Jing and Trowbridge, 1987
), with the acyl chains pointing
out into the bilayer, lending credence to the proposed model. Using
these introduced modifications, we tested the hypothesis that the polar
residues influenced the trafficking of the TR.
|
IiTM 11-19, IiTM 11-19
Ala11Ala17Ala19,
wild-type TR, and TRTM
Thr11Gln17Thr19
were stably expressed in CEFs with BH-RCAS, a replication-competent retroviral vector derived from the Rous-sarcoma virus (Hughes et
al., 1990
). Binding studies at 4°C with
125I-labeled Tf indicated that all of the
chimeras/mutants were expressed on the cell surface and that each, like
the wild-type TR, was a ~200-kDa dimer on a nonreducing SDS-PAGE gel
(our unpublished results).
To determine the effects of the mutations on the half-lives of the
constructs, we performed metabolic pulse-chase experiments. CEFs
expressing either wild-type TR, IiTM 11-19,
TRTM
Thr11Gln17Thr19,
or the IiTM 11-19
Ala11Ala17Ala19
mutant were pulse-labeled with
trans-35S label for 30 min and chased
in complete media for the indicated periods of time; TR and TR mutants
were then isolated by immunoprecipitation and analyzed by SDS-PAGE
(Figure 2). The wild-type TR and the IiTM 11-19 mutant had half-lives of 26.9 ± 4.6 h (mean ± SE) and 5.4 ± 0.8 h, respectively.
Interestingly, the TRTM
Thr11Gln17Thr19
mutant had a greatly reduced half-life (5.6 ± 0.7 h),
whereas the IiTM
Ala11Ala17Ala19
mutant had an extended half-life (14.8 ± 1.9 h). After
2 h (Figure 2), the Mr of TR and
each of the mutants increased to that of the mature glycoprotein (Omary
and Trowbridge, 1981
), indicating that all of the mutants traverse the
Golgi where glycosylation is complete. Because the maturely
glycosylated form of each of the mutants was disappearing, this
suggested that the degradation occurred in a post-Golgi compartment.
|
Degradation Occurs in the Lysosomal Compartment
To confirm that the rapid degradation was due to delivery to the
lysosomal compartment, we compared the intracellular distributions of
each of the TR mutants with LEP100, an endogenous chicken lysosomal membrane protein (Lippincott-Schwartz and Fambrough, 1986
, 1987
). The
wild-type TR shows a typical punctate staining (shown in green, Figure
3A) with very little overlap with LEP100
(shown in red). The TRTM
Thr11Gln17Thr19
mutant, however, shows an altered intracellular distribution with
significant overlap with LEP100 (Figure 3B). The IiTM
11-19 mutant shows a similar colocalization with LEP100 (Figure 3C). Interestingly, the mutant with the polar residues removed,
IiTM Ala11Ala17Ala19,
has a distribution pattern very similar to the wild-type TR (Figure
3D), indicating that the TRTM
Thr11Gln17Thr19
and IiTM 11-19 mutants traffic along the prelysosomal
segment of the endocytic pathway. These results indicate that polar
residues within the TM are both necessary and sufficient for lysosomal targeting.
|
Internalization Is Affected by Amino Acid Substitutions in the TM
Because the substitutions dramatically affected the half-life and
intracellular distributions of the proteins, we next tested whether
these modifications affected endocytosis. The internalization rates of
the chimeras were monitored with the IN/SUR method of Wiley and
Cunningham (1982)
. Surprisingly, analysis of the TRTM Thr11Gln17Thr19
mutant indicated that it was internalized 79% faster than the wild-type TR (ke = 0.200 ± 0.046 min
1 versus 0.112 ± 0.015 min
1), making it comparable to the
IiTM 11-19 mutant (ke = 0.245 ± 0.089 min
1). Analysis of the
IiTM 11-19
Ala11Ala17Ala19
mutant indicated that it was internalized 26% slower than the IiTM 11-19 mutant (ke = 0.180 ± 0.055 min
1), but still
significantly faster than the wild-type TR (Figure 4). This indicated all of the constructs
that contained polar residues within the TM were internalized
significantly faster than the wild-type TR.
|
Polar Residues in the TM Inhibit Receptor Recycling
Because delivery of the proteins to the lysosomal compartment
could be mediated by sorting from the trans-Golgi network or the cell
surface (Kang et al., 1998
), we tested the effects of the TM
mutations on receptor recycling. Cells expressing TR, TRTM Thr11Gln17Thr19,
IiTM 11-19, or IiTM 11-19
Ala11Ala17Ala19
were incubated with 125I-labeled Tf for 10 min at
37°C. The cells were then rapidly rinsed with PBS to remove any
unbound label and prewarmed media (37°C) was then added to the cells.
The reappearance of intact and degraded Tf in the medium was monitored
by measuring TCA insoluble and soluble radioactivity, respectively. As
expected, the apo-Tf that was released into the medium from cells
expressing the wild-type TR was undegraded because only 2.9 ± 0.1% of the radioactivity was in the TCA soluble pool (Figure
5). This suggested that >97% of the
receptors were recycled back to the cell surface. In contrast, 7.1 ± 0.1% of the 125I-labeled Tf released from
cells expressing the TRTM
Thr11Gln17Thr19
mutant were degraded, implying that this percentage of the mutant receptors traffic directly from the cell surface to the lysosomal compartment where they are degraded. Interestingly, a similar amount of
125I-labeled Tf was released as TCA soluble
counts from cells expressing the IiTM 11-19 mutant,
7.8 ± 0.4%, suggesting that the polar residues within this TM
sequence were sufficient to inhibit efficient recycling. Further
support for this is shown with the IiTM
Ala11Ala17Ala19
mutant, which appears to be recycled at nearly wild-type levels (4.1 ± 0.1% TCA soluble counts), suggesting that the polar
residues in the IiTM 11-19 mutant were responsible for the
loss of efficient recycling. Furthermore, the amount of cell-associated
radioactivity of the IiTM 11-19 and TRTM
Thr11Gln17Thr19
mutants (base counts) was much higher than the wild-type TR or IiTM 11-19
Ala11Ala17Ala19
(19.8 ± 1.2 and 14.2 ± 1.5% versus 4.7 ± 0.1 and
8.7 ± 0.7%, respectively), providing additional evidence that
these mutants were not as efficiently recycled as the wild-type TR.
|
Polar Residues in the TM Promote Self-Association of TRs
To monitor differences in the association properties
of the TRs, we analyzed the wild-type TR and TR mutants in sucrose
gradients. Cell lysates from metabolically labeled CEFs expressing TR
and TR mutants were loaded onto 10-25% sucrose gradients and
centrifuged at 40,000 rpm in a SW 50.1 rotor for 16 h at 4°C.
Fractions were collected and TR, TRTM
Thr11Gln17Thr19,
IiTM 11-19, or IiTM 11-19
Ala11Ala17Ala19
were immunoprecipitated and analyzed by SDS-PAGE and autoradiography (Figure 6). The results indicated
that the wild-type TR and IiTM Ala11Ala17Ala19
sedimented with an S value of 6.9 and 7.4, respectively, whereas the
IiTM 11-19 sedimented with an S value of 9.5. The
TRTM
Thr11Gln17Thr19
mutant was more diffuse in the gradient and sedimented in what appeared
to be two populations with S values of 7.8 and 9.1. The second
population appeared as a shoulder with 11% of the protein in this
fraction, compared with the wild-type TR, which contained 5% protein
in this same fraction. These results are consistent with the wild-type
and IiTM
Ala11Ala17Ala19
being dimers, the IiTM 11-19 being a tetramer, and the
TRTM
Thr11Gln17Thr19
being a combination of dimers and tetramers (Alvarez et al., 1989
). This analysis indicated that the presence of polar residues in
the TR TMs promoted tetramer and perhaps larger aggregate formation, supporting the view that the polar residues affected the
self-association properties of the complexes.
|
To confirm this result with another method, we analyzed the TR
mutants by the use of chemical cross-linking. Cells expressing either
wild-type TR or a TR mutant were metabolically labeled and chased in
complete medium for 2 h to ensure that all of the labeled TRs were
maturely glycosylated. Cells were then lysed and the postnuclear
supernatants were incubated at room temperature with 1 mM DTSSP
for 20 min and the reaction stopped with 50 mM Tris in lysis
buffer. Cross-linked samples were immunoprecipitated and analyzed by
SDS-PAGE to evaluate the extent of cross-linking (Figure
7). The results indicate for the
wild-type TR the majority of the complexes formed by cross-linking were
dimers (72% of the label as measured by PhosphorImage analysis), with
very little protein running as larger complexes. Analysis of the
TRTM
Thr11Gln17Thr19
and IiTM 11-19 mutants, however, indicated that the amount
of dimer decreased to 25 and 18%, respectively, whereas the
IiTM 11-19
Ala11Ala17Ala19
mutant had 52% dimer, suggesting a partial recovery. Although the
absolute amounts of the different forms of cross-linked material are
difficult to quantitate from this type of an experiment, the results
clearly indicate that there is a difference in the amount of dimer
found for each of the constructs. The nondimeric forms of the proteins
ran as higher MW complexes with some material running at the top of the
stacking gel. Together, the sucrose gradient and cross-linking studies
indicate that the association properties of the TR mutants were
affected by the addition of the polar residues.
|
Cross-linked Tf Complexes Promote Lysosomal Targeting of Wild-Type TR
If polar residues in the TM region promote lysosomal targeting
through self-association of receptors, then other mechanisms leading to
native receptor self-association should have the same effect. To test
this idea, we prepared cross-linked Tf with glutaraldehyde. The
cross-linked material was purified by gel filtration and separated into
MW complexes >160 kDa (fraction 1) and ~160 kDa (fraction 2; our
unpublished results). Cross-linked (fraction 2) and native Tf were then
125I-labeled. Cells expressing the wild-type TR
were incubated with 125I-labeled monomeric and
cross-linked Tf for 10 min at 37°C. The cells were then rapidly
washed, and the reappearance of intact and degraded Tf in the medium
was monitored by measuring TCA insoluble and soluble radioactivity as
described above. As expected, the Tf released from cells incubated with
the monomeric Tf was mostly TCA insoluble, with only 2.6 ± 0.1%
in the TCA-soluble pool (Figure 8A),
whereas 18.7 ± 1.7% was in the TCA-soluble pool from cells incubated with the cross-linked Tf (Figure 8B), suggesting that recycling had been dramatically inhibited. Because this fraction contained dimeric Tf (~160 kDa of material; Tf monomer is 80 kDa), this suggested that cross-linking the receptors resulted in
down-regulation of the complexes, supporting the view that
cross-linking receptors, by any mechanism, results in a loss of
recycling efficiency.
|
| |
DISCUSSION |
|---|
|
|
|---|
The TR is the prototype for a recycling receptor and during its lifetime recycles 100 times or more. Although a number of studies, including our own, have examined the structural features within the cytoplasmic tails of proteins that are important for internalization and/or lysosomal targeting, very little information is available regarding the role of the TM residues in these processes. In this study, we have carefully analyzed the effect of mutations within the TM on the fidelity of recycling and found that the insertion of Thr and Gln residues inhibits receptor recycling, thereby promoting down-regulation. Furthermore, we demonstrated that small changes in the recycling efficiency dramatically alter the half-life of the receptors, providing an alternative mechanism for down-regulation of cell surface receptors that bypasses the need for a specific cytoplasmic tail sorting signal. By developing a mathematical model for recycling efficiency, we demonstrated that a loss of as little as ~8% recycling efficiency dramatically alters the half-lives of proteins trafficking in this pathway. For growth factor receptors, this would represent an effective mechanism for receptor clearance.
Because Golgi protein localization studies suggest that TM polar
residues promote self-association (Weisz et al., 1993
), we tested whether this same phenomenon was true in our TR mutants. Results
from both sucrose gradient analysis and the chemical cross-linker studies supported the view that receptor self-association correlated with down-regulation. Further support for this idea came from cross-linking the wild-type receptor with dimeric Tf, which also resulted in effective down-regulation of the complexes. This last result is consistent with previous studies that showed that the TR was
rapidly degraded after monoclonal antibody cross-linking (Weissman
et al., 1986
).
Our results are consistent with those of Maxfield and coworkers (Marsh
et al., 1995
) who demonstrated that oligomerized TRs were
retained in the recycling compartment in TRVb-1 cells. In spite
of the fact that Maxfield and coworkers were following the trafficking
of a cross-linked Tf complex composed of an average of 10 Tf molecules
rather than the dimeric Tf molecules we were using, both studies
support the view that cross-linked Tf recycles more slowly. In our
studies, ~25% of the cross-linked Tf was still intracellular after
2 h of chase. In our study, however, it remains unclear how much
of that intracellular material was in the lysosome versus the recycling
compartment. Interestingly, Marsh et al. (1995)
did see an
increase in the amount of TCA-soluble counts released into the media,
albeit to a lesser degree than we did.
One of the obvious questions resulting from our study is how do polar
residues mediate this effect? There seem to be a number of
possibilities that could explain our results. First, the polar residues
within the TM promoted self-association directly. When we analyzed the
sedimentation properties of peptides derived from the TM region in
nonpolar solvents (see MATERIALS AND METHODS), we found that those
peptides containing the Thr and Gln residues aggregated (the average MW
calculated from sedimentation equilibrium measurements was 5409, range
4569 to 6242), whereas peptides derived from the wild-type TR sequence
sedimented as a monomer (MW ~466, range 442 to 490; our unpublished
results), lending support for this hypothesis. A second possibility is
that the self-association properties could be mediated through the
extracellular domains. Recent studies with cryo-electron
microscopy on the TR reconstituted in phospholipid vesicles
indicate that the TR dimer consists of a large globular extracellular
domain (6.4 × 7.5 × 10.5 nm) separated from the membrane by
a thin molecular stalk (2.9 nm; Fuchs et al., 1998
). Because
the large extracellular domains of the dimer are tethered together
through these closely associated stalks that traverse the membrane, it
is conceivable that self-association occurs through the extracellular
domains. Because the TR undergoes a conformation change at the pH found
in the sorting endosome (Turkewitz et al., 1988
), it is
possible that these substitutions affect the conformational changes in
the sorting endosome. Furthermore, alterations in the TR conformational
changes may in turn affect the self-associating properties of the
complexes. A third possibility that we cannot rule out is that the
TM modifications affect the conformation of the TR cytoplasmic tail.
This idea is certainly consistent with the fact that these mutations
dramatically alter the TR internalization rate. An altered cytoplasmic
tail conformation might allow for a better interaction with the adaptor
complexes in the coated pits. An even simpler explanation would be that enhanced self-association of the receptors would bring a higher concentration of complexes into the pit, translating into a more efficient internalization rate. A fourth possibility is that the inclusion of polar residues promotes association of the TRs with other
proteins in the sorting endosome that are being down-regulated. Although we do not believe this is the case because we have never detected other protein bands either with chemical cross-linking or from
TR immunoprecipitations, we cannot rule out this possibility.
How might self-association of receptor complexes in the sorting
endosome result in down-regulation and lysosomal targeting? Recent
studies on lipid trafficking in the endocytic pathway suggest that
lipid sorting depends on the chemistry of the lipid hydrophobic tails
(Mukherjee et al., 1999
). This intriguing study demonstrated that lipids with long (16-carbon) saturated tails are delivered to late
endosomes, whereas lipids with two cis double bonds or with
saturated but shorter tails (12-carbon) are delivered to the recycling
compartment. In their model, Mukherjee et al. (1999)
propose
that lipid trafficking in the endocytic and other pathways depends on
differences in fluidity. They suggest that those lipids with long
unsaturated tails preferentially partition into domains that are more
ordered and unsaturated or shorter tails partition into more fluid
regions of the bilayer.
In support of this model, recent studies have shown that long
saturated glycosphingolipids concentrate in the inner invaginations of
the multivesicular body (Sandhoff and Klein, 1994
). Interestingly, a
unique lipid, lysobisphosphatic acid, also has been found to associate
with these inner invaginations and the latter stages of the endocytic
pathway (Kobayashi et al., 1998
), suggesting that the
biophysical properties of the lipids influence their trafficking in
this pathway. If this property were also important for the membrane
proteins, then fluidity considerations alone could account for the loss
of recycling efficiency, with the larger TR complexes being trapped in
the multivesicular body through losses in lateral mobility. Clearly,
there is evidence that the diffusion coefficients of membrane proteins
are higher in tubular extensions than in larger structures (Berk and
Hochmuth, 1992
). This is also consistent with the idea that differences
in lipid composition affect membrane protein trafficking.
Because our model suggests that polar residues in the TM promote
down-regulation of the TR complexes, we examined other TR TM sequences
to confirm the absence of polar residues, especially in the region of
interest, residues 11-19. As can be seen in Table 1, polar residues are lacking within this
region in all the TR sequences identified. Interesting, this lack of
polar residues appears to also be true for the low-density lipoprotein
as well, another transport receptor that efficiently recycles. However, when we examined the TM sequences for other cell surface proteins that
have an unusual number of polar residues, we find an interesting ensemble of proteins that traffic to late endosomal/lysosomal compartments (Table 2). This implies that
TM polar residues may represent a common, mechanistically simple way to
sort membrane proteins in the endocytic pathway without the specific
need of a cytoplasmic tail "lysosomal targeting signal." It is
interesting that one of the proteins identified in the search,
P-selectin, was also a protein in which a cytoplasmic tail lysosomal
targeting signal was difficult to localize (Straley et al.,
1998
). And finally in support of our proposed model, it is now clear
that receptor down-regulation requires multiple rounds of recycling
before lysosomal delivery occurs (Lai et al., 1989
; Felder
et al., 1992
), suggesting that down-regulation, rather than
being a distinctive all-or-nothing event, may simply reflect a loss of
recycling fidelity (Weissman et al., 1986
).
|
|
To correlate loss of recycling efficiency with protein half-life, we
developed a mathematical model for recycling in the endocytic pathway
(see MATERIALS AND METHODS for details of the calculation). In this
model, membrane proteins in the recycling pathway are found at the
plasma membrane or the endosome or between these compartments. For sake
of simplicity, we considered the plasma membrane and sorting endosome
as one compartment and the lysosome as a second compartment. The
protein half-life (t1/2) is defined as
the period of time required for recycling (p) multiplied by the ln of 0.5 divided by the ln of the recycling efficiency
(
). Because the half-life determination also requires
that the newly synthesized protein be delivered to the cell surface,
this transit time to the surface
(tsur) must be added to this equation
as well. From this,
|
(13) |
|
Our results suggest that protein down-regulation is not an efficient process per single round of endocytosis and recycling, but because the cycle occurs repeatedly, efficient clearance of surface proteins occurs with even small losses in recycling efficiency. Down-regulation of most proteins usually occurs over several hours, suggesting that a partial loss of recycling efficiency would be all that was necessary to explain down-regulation for most proteins. This also suggests that lysosomal targeting, at least from the cell surface, may not require specific cytoplasmic tail sorting signals for efficient delivery, but may reflect the biophysical properties of the proteins themselves in the sorting endosome. Protein sorting in the sorting endosome based on fluidity considerations alone would explain the lack of progress at identifying coat proteins at this site. Clearly, segregation of proteins occurs in the sorting endosome, and based on the studies presented herein, we propose that segregation of recycling and down-regulated receptors can be accomplished without the need of a specific cytoplasmic tail sorting determinant.
Note added in proof. A recent study by J.B. Ashman and J. Miller (J. Immunol. [1999]. 163:2704-2712) demonstrated that polar residues in the murine invariant chain are important for trimerization. This, coupled with our studies, suggests that the orientation of the polar residues within transmembrane domains can influence both subunit assembly and aggregation status. Interestingly, in the mouse sequence, position 11 has an alanine rather than a threonine, making difficult the burying of all the polar residues at subunit contact sites in the human invariant chain transmembrane domain, even in the context of a trimer. Our study agrees with theirs in that protein associations occur through polar residues in the transmembrane domain.
| |
ACKNOWLEDGMENTS |
|---|
We thank Doug Cyr and Elizabeth Sztul for critical reading of the manuscript and helpful discussions. We thank Dr. M. B. Khazaeli (University of Alabama at Birmingham Radiolabeling Shared Facility) for 125I iodination of Tf and Tf aggregates, Mike Carson for help in preparing the modeling figures, and Tobie Bogart for help with the sedimentation equilibrium experiments. This work was supported by a grant from the National Institutes of Health-National Institute of Diabetes and Digestive and Kidney Diseases (R29-DK47339) to J.F.C. J.F.C. is an Established Investigator of the American Heart Association.
| |
FOOTNOTES |
|---|
These authors contributed equally to
this work.
Corresponding author. E-mail address:
jcollawn{at}uab.edu.
| |
ABBREVIATIONS |
|---|
Abbreviations used: CEF, chicken embryo fibroblast; Ii, invariant chain; MHC, major histocompatibility complex; Tf, transferrin; TR, transferrin receptor; TM, transmembrane domain.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
B. Schaheen, H. Dang, and H. Fares Derlin-dependent accumulation of integral membrane proteins at cell surfaces J. Cell Sci., July 1, 2009; 122(13): 2228 - 2239. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Clancy and R. Duncan Reovirus FAST Protein Transmembrane Domains Function in a Modular, Primary Sequence-Independent Manner To Mediate Cell-Cell Membrane Fusion J. Virol., April 1, 2009; 83(7): 2941 - 2950. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Koguchi, T. J. Thauland, M. K. Slifka, and D. C. Parker Preformed CD40 ligand exists in secretory lysosomes in effector and memory CD4+ T cells and is quickly expressed on the cell surface in an antigen-specific manner Blood, October 1, 2007; 110(7): 2520 - 2527. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen and C. A. Enns The Cytoplasmic Domain of Transferrin Receptor 2 Dictates Its Stability and Response to Holo-transferrin in Hep3B Cells J. Biol. Chem., March 2, 2007; 282(9): 6201 - 6209. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Janvier and J. S. Bonifacino Role of the Endocytic Machinery in the Sorting of Lysosome-associated Membrane Proteins Mol. Biol. Cell, September 1, 2005; 16(9): 4231 - 4242. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Karsten, R. S. Hegde, A. P. Sinai, M. Yang, and K. A. Joiner Transmembrane Domain Modulates Sorting of Membrane Proteins in Toxoplasma gondii J. Biol. Chem., June 18, 2004; 279(25): 26052 - 26057. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hueffer, L. M. Palermo, and C. R. Parrish Parvovirus Infection of Cells by Using Variants of the Feline Transferrin Receptor Altering Clathrin-Mediated Endocytosis, Membrane Domain Localization, and Capsid-Binding Domains J. Virol., June 1, 2004; 78(11): 5601 - 5611. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sharma, F. Pampinella, C. Nemes, M. Benharouga, J. So, K. Du, K. G. Bache, B. Papsin, N. Zerangue, H. Stenmark, et al. Misfolding diverts CFTR from recycling to degradation: quality control at early endosomes J. Cell Biol., March 15, 2004; 164(6): 923 - 933. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hilgendorf, J. Lindberg, Z. Ruzsics, S. Honing, A. Elsing, M. Lofqvist, H. Engelmann, and H.-G. Burgert Two Distinct Transport Motifs in the Adenovirus E3/10.4-14.5 Proteins Act in Concert to Down-modulate Apoptosis Receptors and the Epidermal Growth Factor Receptor J. Biol. Chem., December 19, 2003; 278(51): 51872 - 51884. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sato, M. Sato, and A. Nakano Rer1p, a Retrieval Receptor for ER Membrane Proteins, Recognizes Transmembrane Domains in Multiple Modes Mol. Biol. Cell, September 1, 2003; 14(9): 3605 - 3616. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Fayadat and R. R. Kopito Recognition of a Single Transmembrane Degron by Sequential Quality Control Checkpoints Mol. Biol. Cell, March 1, 2003; 14(3): 1268 - 1278. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Ross, J. J. Schofield, C. J. Farr, and M. Bucan Mouse transferrin receptor 1 is the cell entry receptor for mouse mammary tumor virus PNAS, September 17, 2002; 99(19): 12386 - 12390. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zaliauskiene, S. Kang, K. Sparks, K. R. Zinn, L. M. Schwiebert, C. T. Weaver, and J. F. Collawn Enhancement of MHC Class II-Restricted Responses by Receptor-Mediated Uptake of Peptide Antigens J. Immunol., September 1, 2002; 169(5): 2337 - 2345. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||