![]() |
|
|
Vol. 11, Issue 8, 2743-2756, August 2000
and
*Department of Biology, Yonsei University, Seoul, Korea 120-749;
and
HHMI and Division of Biology, Caltech, California
91125
| |
ABSTRACT |
|---|
|
|
|---|
In the nematode Caenorhabditis elegans, there exist
two µ1 medium chains of the AP-1 clathrin-associated protein complex. Mutations of unc-101, the gene that encodes one of the
µ1 chains, cause pleiotropic effects (Lee et al.,
1994
). In this report, we identified and analyzed the second µ1 chain
gene, apm-1. Unlike the mammalian homologs, the two
medium chains are expressed ubiquitously throughout development. RNA
interference (RNAi) experiments with apm-1 showed that
apm-1 and unc-101 were redundant in
embryogenesis and in vulval development. Consistent with this, a hybrid
protein containing APM-1, when overexpressed, rescued the phenotype of an unc-101 mutant. However, single disruptions of
apm-1 or unc-101 have distinct
phenotypes, indicating that the two medium chains may have distinct
functions. RNAi of any one of the small or large chains of AP-1 complex
(
1,
1, or
) showed a phenotype identical to that caused by the
simultaneous disruption of unc-101 and
apm-1, but not that by single disruption of either gene.
This suggests that the two medium chains may share large and small
chains in the AP-1 complexes. Thus, apm-1 and
unc-101 encode two highly related µ1 chains that share
redundant and distinct functions within AP-1 clathrin-associated
protein complexes of the same tissue.
| |
INTRODUCTION |
|---|
|
|
|---|
Clathrin-coated pits and vesicles are ubiquitous organelles found
in all the eukaryotic cells that mediate intracellular protein trafficking (Keen, 1990
, Robinson, 1994
, Hirst and Robinson, 1998
). Clathrin-coated vesicles are composed of membrane fraction, selected membrane proteins, clathrin, and clathrin-associated proteins (APs).
While clathrin is a structural unit common to all the clathrin-coated vesicles, APs can vary depending on the localization of the vesicles at
the cellular and subcellular level (for example, Ahle et
al., 1988
, Dell'Angelica et al., 1997
), and are
thought to be important in selecting cargoes in the vesicles. There are
four AP complexes identified so far in various species. All four
complexes are similar in their composition and structure in that they
are hetero-tetramers of two large chains, one small chain, and one
medium chain. The medium chains of the clathrin AP complexes are known
to interact with the tyrosine or dileucine residues of their cargo
proteins (Ohno et al., 1995
, Rodionov and Bakke, 1998
,
Hofmann et al., 1999
). AP-1 complex contains
1 and
adaptin as large chains, µ1A or µ1B as a medium chain, and
1
(AP19) as a small chain. AP-2 has
- and
2 adaptin as large
chains, µ2(AP50) as a medium chain, and
2 (AP17) as a small chain.
AP-3 complex consists of
3A or
3B and
adaptins as large
chains, µ3A or µ3B as medium chains, and
3 as a small chain
(Dell'Angelica et al., 1997
, Simpson et al.,
1997
). AP-4 complex is a recently identified complex that consists of
4 and
adaptins as large chains, µ4 as a medium chain, and
4
as a small chain (Dell'Angelica et al., 1999a
, Hirst et al., 1999
). Some of the large chains share some
similarity in their amino acid sequence (for example, Kirchhausen
et al., 1989
, Robinson, 1989
), as do those of medium chains
and small chains (Kirchhausen et al., 1991
, Nakai et
al., 1993
, Nakayama et al., 1991
, Phan et
al., 1994
, Thurieau et al., 1988
). The localization of
the AP-1 and AP-2 complexes is well known. AP-1 is at the
trans-Golgi, AP-2 on the plasma membrane. The medium chains
of the mammalian AP-1 complexes show tissue-specific expression (Ohno
et al., 1999
). AP-3 complexes were reported to be present in
most cells, but some components of the AP-3 complexes were
tissue-specific (Dell'Angelica et al., 1997
, Pevsner
et al., 1994
). AP-4 was associated with the
trans-Golgi network or with an adjacent structure in all
cell types (Dell'Angelica et al., 1999a
, Hirst
et al., 1999
).
Genetic analysis of medium chains has been reported in many systems. In
yeast, mutations in µ1 is known to enhance the temperature-sensitive growth phenotype and the
-factor processing defect caused by a
temperature-sensitive allele of the clathrin heavy chain gene (Stepp
et al., 1995
). AP-3 is necessary for proper sorting of vacuolar alkaline phosphatase (Stepp et al., 1997
). These
phenotypes are mild in terms of viability of the organism. In the
mammalian system, two µ1 chains have been characterized; one of them,
µ1B, is expressed in epithelial cells and is required for basolateral targeting in these cells (Folsch et al., 1999
, Ohno et
al., 1999
).
-Adaptin was essential for embryonic development in
mice by analyzing knockout mice (Zizioli et al., 1999
).
3A was mutated in patients with human Hermansky-Pudlak syndrome
(HPS; Dell'Angelica et al., 1999b
) and in the mouse
hypopigmentation mutant pearl (Feng et al., 1999
),
indicating that AP-3 functions in protein sorting to lysosomes. In the
nematode C. elegans, one medium chain of AP-1, encoded by
unc-101, was identified (Lee et al., 1994
).
Genetic analysis of unc-101 showed that mutations in this
gene caused pleiotropic effects, including subviability, uncoordinated
movement, a defect in neuronal dye uptake, male spicule defect,
defecation defect, and suppression of a reduction-of-function mutation
in the epidermal growth factor receptor (let-23EGFR) gene
(Lee et al., 1994
). Interestingly, putative null mutations
of unc-101 do not cause 100% lethality, but only 50%
lethality
50% of progeny from a homozygous mother of
unc-101/unc-101 genotype will survive(Lee et al.,
1994
). This suggests that another gene, encoding the medium chain of
AP-1, can replace the essential function of unc-101 in individuals with defects in unc-101. Consistent with this,
unc-101 mutations do not cause vulval defect, while
unc-101 mutations have been isolated as extragenic
suppressors of the let-23(sy1) vulvaless phenotype. In
vulval tissues, there must therefore exist other genes that act
redundantly with unc-101 as negative regulators. One such
gene is sli-1. An unc-101; sli-1 double mutant
displays greater-than-wild-type vulval induction (Sternberg et
al., 1994
). It is conceivable that there may be more redundant
negative regulators of vulval development, because not all
unc-101;sli-1 double mutants show multivulval phenotypes
(Sternberg et al., 1994
).
Here we report identification of a homolog
of unc-101, which we named apm-1
(associated protein complex medium
chain-1). We show that unc-101 and
apm-1 are both ubiquitously expressed throughout development
and that apm-1 plays redundant roles with unc-101 in embryogenesis and vulval development. We show that apm-1
also has distinct functions from those of unc-101. Finally,
we report characterization of the functions of the two medium chains
and compare them to those of the other AP-1 complex subunits,
1,
1, and
.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains and Culture
The Bristol strain N2 was used as the standard wild-type strain.
The mutations used for apm-1 and unc-101
functional analysis are unc-101(sy108) (Lee
et al., 1994
) and let-23(sy1) (Aroian et al., 1990
). rol-6(su1006) DNA and
dpy-20(e1282) was used as selection markers for DNA
microinjection as described below. The culture of C. elegans
was previously described (Brenner, 1974
).
cDNA Screening
We used the cDNA clone CEED20 (accession number T00259)
from the GenBank database as a start point for cloning a full-length cDNA clones. We used the CEED20 DNA as probe in a cDNA screening for
full-length clones. We used a standard hybridization procedure (Sambrook et al., 1989
). We isolated three cDNA
clones from a C. elegans cDNA library (Barstead and
Waterston, 1989
), all of which contained inserts of the same length. We
determined the sequence of one of the clones, CEED20-3. Sequencing
reactions were performed using Sequenase 2.0 and reagents from United
States Biochemical (Cleveland, OH).
Sequence Analysis
Compiling of DNA and amino acid sequences were carried out using
the Macvector program (IBI, Oxford Molecular Group, Hunt Valley,
MD) and the GCG package v7.0, a software of the Genetics Computer Group (Madison, WI; Devereux et al.,
1984
). The BLAST program of the GCG software was used to search
and compare homologies of the sequences. The Pileup and Gap programs
were used to generate the comparisons of the amino acid sequences. The
clustal w program was used to analyze and calculate genetic distances
among the medium chain homologs. Tree view 1.5 (Win 32) version 1.5.2. (Page, 1998
) was used to construct the dendrogram of the medium
chain homologs. The sequences that were used in the sequence comparison and dendrogram were from C. elegans (CAPM-1, in this study;
UNC-101, CAPM-2, Lee et al., 1994
, CAPM-3, Cosmid F53H8.1,
C. elegans genome project), humans(µ1B, NP 005489.1;
µ2, sp P20172; µ3A, gb AAD43328.1; µ3B, sp P53677; µ4,
gb AAD43328.1), mouse(µ1B, gb AAD28085.1; AP47, sp P35585), rat
(p47A, sp P53676; p47B, sp P53678), fly(APM-1, emb CAA06918.1;
APM-2, emb CAA06785.1; APM-3, emb CAA08768.1), and from yeast(YAP54,
sp Q00776; APM-2, sp P38700; APM-3, emb CAA97989.1; APM-4,
sp Q99186).
Expression Studies
To construct an unc-101 GFP reporter gene, we used the pJL1 plasmid and the vector pPD95.77 from Andy Fire (Carnegie Institute of Washington, Baltimore, MD). We amplified unc-101 genomic DNA from the K11D10 cosmid, using two PCR primers, and produced the pJL271 plasmid by replacing the unc-101 genomic region of pJL1 with PCR product. The 5' and 3' subcloning sites were HindIII and BamHI. The two PCR primers were K11-1, 5' CTCGTCGACCTGAT CGGTGTGC 3' and 101-C, 5' GGGATCCGTATTCTCCATTTTGAG 3'. Next, the 1.8 kb gfp fragment from pPD95.77 was subcloned into pJL271. The 5' and 3' subcloning sites were BamHI and SpeI. To construct the apm-1 GFP reporter, we subcloned amplified 6.0 kb genomic DNA using two PCR primers into the Fire vector pPD95.79. The subcloning sites were SalI and BamHI. The two PCR primers were F55-1, 5' GTGAAACTGCTGAAGGAAGC 3' and CE19, 5' GGGATCCTCATTTGATAATCTCCG 3'.
Construction of Hybrid Genes
Construction of the unc-101 hybrid genes was
described (Lee et al., 1994
). To construct an APM-1 hybrid
gene, we amplified the APM-1 cDNA from nucleotide #325 through #1229
using two PCR primers. Both the 5' and 3' subcloning sites, NruI and
EcoRV, are conserved in APM-1. The two PCR primers are:
CE-6, 5'CGATAATTTCGTTATTATTTA TG3', and CE-7, 5'ATCCAGATTTCTCTATGAT
TTT3'. The amplified DNA was ligated to the 7.2kb NruI/EcoRV
fragment of pJL2. The resulting plasmid is the APM-1 hybrid gene. This
construct contains the 5' promoter region of unc-101, the 5'
coding region of unc-101 up to the unc-101 cDNA
nucleotide #388, the apm-1 cDNA from NruI site to
EcoRV site (corresponding nucleotides in unc-101
are #389 to #1281, the unc-101 3' region from #1282 to the
end of cDNA, and the untranscribed 3' region of unc-101. The
predicted protein from this construct contains 301 amino acid residues
from APM-1, and 123 amino acid residues from UNC-101. A positive
control construct, the unc-101 hybrid gene, contained all
amino acids for UNC-101. A negative control construct contains only 123 amino acids from UNC-101, and the remaining amino acids from APM-2.
Microinjection Experiments and Double Strand RNA Interference
Microinjection of DNA into the gonad of C. elegans
hermaphrodite adults was previously described (Mello et al.,
1991
). For expression studies, the GFP reporter constructs were
coinjected into N2 wild-type animals with the pRF4 plasmid containing a
dominant mutant gene for rol-6. The total concentration of
injected DNA was 140 µg/ml (reporter 100 µg/ml and pRF4 40 µg/ml). The transgenic animals were selected by their rolling
behaviors, and the animals were observed for GFP expression. For hybrid
constructs, we used unc-101(sy108); let-23(sy1);
dpy-20(e1282) animals as the host for microinjection. We
coinjected the hybrid genes with a dpy-20(+) clone as a
selection marker. The host animals have a dumpy body shape (Dpy
phenotype), and the selection marker DNA can rescue the Dpy phenotype
to wild-type body shape, enabling the selection of transgenic animals
containing the microinjected genes. Following microinjection, we
selected nonDpy transgenic animals, established stable lines that
inherited the transgenes, and examined the phenotype of vulval
differentiation. For RNAi, templates for RNA synthesis were produced by
PCR amplification of full-length cDNA using T3 and T7 primers. RNAs
were synthesized using a commercially available in vitro transcription
kit (Promega, cat.#P2075, P2083) with T3 and T7 RNA polymerases.
Unmodified RNA was resuspended for injection at 10 µg/ml to 500 µg/ml concentration in DEPC-treated water. Following microinjection
of double strand RNA, the injected animals (P0) were transferred to new
plates every 12 h and F1 progeny were counted and analyzed.
Microscopy
Differential interference contrast (DIC) microscopy (Nomarski optics) and fluorescence microscopy were used to observe the phenotypes and expression patterns. For DIC microscopy, we treated the worms with sodium azide at 1 mM concentration; for fluorescence microscopy, we treated the worms with levamisole at 100 ng/ml.
| |
RESULTS |
|---|
|
|
|---|
Molecular cloning of apm-1, a homolog of the unc-101 gene, encoding a medium chain of trans-Golgi clathrin-associated protein complex AP-1
A C. elegans cDNA sequencing project identified a cDNA
clone (CEED20) containing a partial sequence similar to
unc-101 (accession number T00259). We screened a cDNA
library with probes made from the cDNA of CEED20. We isolated three
full-length cDNA clones and determined the sequence of one of them. The
sequence would encode a putative protein of 426 amino acids. We named
this gene apm-1 (associated protein
complex medium chain-1). Comparison of the sequence of APM-1
with other medium chain homologs indicated that this protein is more
related to AP47 than to AP50 (Figure 1A).
APM-1 has the same degree of similarity to mammalian AP47 as it has to
UNC-101 in C. elegans (72% identity in both cases). Comparison of the amino acid sequences among the medium chain homologs
from yeast to humans showed that APM-1 and UNC-101 are clearly grouped
within the same subfamily of AP-1 medium chains (Figure 1B). DNA
sequence comparison between apm-1 and unc-101 showed that the discrepancies are biased toward the third bases of
codons (our unpublished results). There was minimal sequence identity
in the 5' nontranslated region or in the 3' nontranslated region (our
unpublished results), suggesting that these two genes might be subject
to different types of regulation. The genome project later revealed
that the genomic clone K11D2 (accession number Z83115) contained the
full length apm-1 gene. A comparison of the genomic
structures of the two genes showed that the boundaries of the first
three exons and the last exon are conserved between the two genes, but
the boundaries of the central exons are divergent (Figure 1C). The
number of exons is also different: apm-1 has nine exons
while unc-101 has only seven exons.
|
apm-1 and unc-101 Are Expressed Ubiquitously throughout Development
To determine the expression patterns of the medium chains, we
constructed GFP reporter constructs (see MATERIALS AND METHODS) and
examined the GFP expression patterns in transgenic animals containing
these reporter constructs. We found that unc-101 was expressed in most cells, if not all, at most embryonic and
postembryonic stages. The highest level of expression was observed in
muscles and pharyngeal regions (Figure
2B, G, K). While apm-1 was
also expressed ubiquitously throughout development, its expression was
stronger in neurons, as demonstrated by the bright fluorescence in the
nerve ring (Figure 2, D, H, L). When examining the apm-1 expression by lacZ reporter assays, we also observed high expression of
apm-1 in the intestine (our unpublished results). The
expression of both genes was strong in the vulval cells when vulval
tissues were undergoing morphogenesis (Figure 2, M-P). The
overlapping expression pattern of apm-1 and
unc-101 implied that these two medium chains were present in
the same cells, possibly interacting with both shared and distinct
cargo proteins during transport.
|
RNAi of the Medium Chain Genes Specifically Phenocopies Reduction-of-Function Mutations of Corresponding Genes
To dissect the functions of apm-1 compared with those
of unc-101, as well as other components of the AP-1 complex,
we wanted to examine the phenotypes associated with disruption of
apm-1 function. As there is no available mutation in the
apm-1 gene, we used double-strand RNAi to phenocopy
apm-1 reduction-of-function mutations. As APM-1 and
UNC-101 share approximately 72% identity at the amino acid
level, the possibility existed that the RNAi of one of these genes
might interfere with the function of the other gene. We examined
whether double-strand RNAs of apm-1 and unc-101
specifically and exclusively interfered with their respective targets.
As shown in Figure 3, unc-101
RNAi caused reduction of GFP expression driven by the
unc-101 gene while it did not cause any reduction in GFP
expression driven by the apm-1 gene (Figure 3, C and D).
Likewise, apm-1 RNAi interfered specifically with apm-1, not with unc-101 (Figure 3, E and F). In a
control experiment, RNAi of apm-2, the medium chain of AP-2
complexes in the nematode, did not cause any reduction of either
apm-1 or unc-101 expression (Figure 3, G and H).
We therefore concluded that we could specifically phenocopy
reduction-of-function mutations of either of these two medium chain
genes by RNAi using the complementary RNAi or phenocopy double
mutations of apm-1 and unc-101 by using
double-strand RNAs of both genes simultaneously.
|
Disruption of apm-1 Alone Causes Larval Lethality, and Simultaneous Disruption of apm-1 and unc-101 Causes Embryonic Lethality
We first examined the function of apm-1 during early
development by RNAi. In a control experiment, we injected
unc-101 double-strand RNA into N2 wild-type animals. At a
high concentration (500 µg/ml), double-strand RNA caused, at most,
50% larval lethality compared with the putative null mutation of
unc-101(sy108) animals, confirming that the null phenotype
of unc-101 would not lead to 100% lethality. The animals
showed arrest development at various stages of development. Most of the
surviving animals showed the uncoordinated (Unc) phenotype (as is the
case in unc-101 mutant animals) and did not show any embryonic lethality (Figure 4A). We then
injected a high concentration of apm-1 double-strand RNA
(200 µg/ml) into N2 animals and examined the phenotypes of the F1
progeny. We found that 100% of the F1 animals showed arrested
development as L1 larvae (Table 1, Figure 4B); also, they did not show any embryonic lethality. Most animals displayed the typical phenotype consisting of movement at first after
hatching, displacement over a short distance, then sudden arrest of
movement in any direction. In addition, they had bloated anterior
intestines, as if pumping was normal but that the ingested bacterial
stream had stopped at the anterior intestine. The arrested L1 animals
had very slow pumping motions with head and tail moving very little.
The shape of intestine was abnormal in the animals with arrested
development, with exaggerated curvature and uneven thickness of the
intestine tubes. In addition, animals with arrested development had
thinner posterior bodies than wild-type animals. Next, we injected the
same concentration of apm-1 double-strand RNA into
unc-101(sy108) animals to phenocopy double mutations of
apm-1 and unc-101 and found that the F1 animals
showed up to 100% embryonic lethality due to arrested development at
the twofold stage within the eggshells (Table 2, Figure
4C). Thus, removal of both of the AP-1 medium chains leads to a
synthetic embryonic lethal phenotype that cannot be achieved by the
removal of either one of the two genes. This indicates that one of the
two genes must be present for embryonic development, but that either
one of the two genes is redundant in the presence of the other. In contrast to the redundant functions of apm-1 and
unc-101 in embryogenesis, each medium chain may play a
distinct role after hatching, because most animals in which only one of
the two genes was disrupted could hatch but could not survive after the
early larval stages.
|
|
|
apm-1 and unc-101 Are Redundant Negative Regulators of an EGF-Mediated Signaling Pathway
Unc-101 mutations suppress the vulvaless phenotype of
let-23 EGFR reduction-of-function mutations, indicating that
the normal function of unc-101 might be negative regulation
of the EGF signaling pathway in vulval development (Lee et
al., 1994
). Because unc-101 single mutant animals do
not show any abnormal vulval induction (Lee et al., 1994
),
the existence of redundant negative regulators of vulval development,
acting in parallel with unc-101, has been suggested. One
such gene is sli-1 (Yoon et al., 1995
). Single mutants of either sli-1 or unc-101 do not exhibit
any vulval phenotype, but double mutants for unc-101 and
sli-1 have greater-than-wild-type vulval induction
(Sternberg et al., 1994
). We wished to examine if
apm-1 was another redundant negative regulator of the
signaling mediated by LET-23 EGFR.
We have previously shown that a hybrid construct, which contained the
unc-101 promoter region and most of the mammalian AP47, could rescue phenotypes associated with an unc-101 mutation
when introduced into the mutant animals by microinjection (Lee et
al., 1994
). To test whether APM-1 protein could complement
functions of UNC-101 protein when overexpressed, we constructed and
examined a hybrid gene (see MATERIALS AND METHODS). In the hybrid gene, we substituted two thirds of the UNC-101 protein from the C terminal end with APM-1. The rationale for this substitution was that the N-terminal region of the medium chains was required for interaction with the
chain, while the C-terminal region was important for interaction with target proteins(Aguilar et al., 1997
). We
comicroinjected this hybrid gene into the gonads of
unc-101(sy108); let-23(sy1); dpy-20(e1284) animals with
cloned DNA of dpy-20(+) as a selection marker. The resulting
nonDpy transgenic animals were examined for their ability to complement
the unc-101 mutations that result in suppression of the
vulvaless phenotype of the let-23(sy1) mutation. The
suppression of the vulvaless phenotype of the let-23(sy1) mutation by unc-101 mutations was rescued in the transgenic
animals containing extra copies of the hybrid gene as 4 out of 8 transgenic animals at the L3 molt stage, observed under Nomarski
optics, restored the vulvaless phenotype (Figure
5E). Our results indicate that
overexpressed APM-1 may complement the functions of UNC-101 in the
absence of functional, endogenous UNC-101 in the vulval cells.
|
We then asked whether apm-1 would act redundantly in the
vulval induction pathway by examining the vulval phenotype of
unc-101(sy108) animals injected with low concentrations of
apm-1 double strand RNA. If the two genes are indeed
redundant negative regulators of the pathway in vivo, we
would expect to see the greater-than-wild-type vulval induction
observed in unc-101; sli-1 double mutants. We used low
concentrations of apm-1 double strand RNA for this
experiment since a high concentration leads to 100% embryonic
lethality. Out of 67 F1 postRNAi survivors, 15 animals showed
greater-than-wild-type induction as observed using Nomarski optics (for
example, Figure 6B), whereas
unc-101(sy108) animals without the RNAi of apm-1 did not show increased induction compared with the wild-type (Figure 6A), indicating that apm-1 indeed acts redundantly with
unc-101 in negatively regulating the vulval induction
pathway. Next, we wished to determine whether the reduced function of
apm-1 can directly suppress the vulvaless phenotype caused
by the let-23(sy1) mutation even in the presence of the
wild-type gene activity of unc-101. We injected double
strand RNA of apm-1 into let-23(sy1) animals at
low concentration. We found that at 20 µg/ml microinjected double
strand RNA, 73% of F1 postRNAi survivors (n = 19) were suppressed
for the vulvaless phenotype, thus exhibiting morphologically wild-type
or greater-than-wild-type vulvae (for example, Figure 6C). 67% of F1
postRNAi survivors (n = 12) had functional vulvae, with which they
could lay eggs. In contrast, in the let-23(sy1) animals
without RNAi, only 10% showed morphologically wild-type vulvae, and
9% had functional vulvae (n = 231 and 222, respectively). These
data indicated that the apm-1 gene acts as another negative regulator of the vulval induction pathway. Surprisingly, we also observed greater-than-wild-type induction of vulval precursor cells
(VPCs) in transgenic N2 animals containing an
apm-1::GFP reporter construct (Figure 6D),
indicating that this reporter construct may have acted as a dominant
negative mutation and may have interfered with the wild-type function
of apm-1. This would have caused the VPCs to be induced
excessively compared with wild-type. Thus, we infer that
apm-1 and unc-101 are redundant negative
regulators of the vulval induction pathway in the nematode.
|
The Two Medium Chains Are Shared by Other Components of AP-1 Complex in the Nematode
Thorough database searches failed to identity more than one
homolog each for the large and small chains of AP-1 complexes in the
nematode. We identified only single homologs of
1,
1, and
chain genes. To determine if the two medium chains, APM-1 and UNC-101,
share other components when constituting the AP-1 complexes, we
examined the phenotypes caused by RNAi of other components of the AP-1
complex. The F1 progeny from wild-type animals injected with
double-strand RNA of the small chain
1 gene showed 100% embryonic
lethality at the concentration of 100 µg/ml (table 3, Figure 4D). At lower concentration, development of most F1 progeny was
arrested at the embryonic stage or at the larval stages (our
unpublished results). RNAi of the
1 or
chain displayed identical
phenotypes (our unpublished results and Figure 4, E and F). These
results clearly imply that the removal of the single small chain of the
AP-1 complex caused phenotypes as severe as those caused by the removal
of both of the medium chains.
|
To further confirm the result, we examined the effect of RNAi of
1,
the small chain of the AP-1 complex, on the expression patterns of
apm-1 and unc-101. It has been reported that loss of one component of the clathrin-associated protein complex led to
destabilization of the whole complex (Dell'Angelica et al., 1999b
, Zizioli et al., 1999
). We reasoned that the
stability of both APM-1 and UNC-101 proteins would be decreased by loss
of one of the components of the AP-1 complex if they indeed shared this
component. We microinjected low concentration of
1 double-strand RNA
into transgenic animals containing either an APM-1::GFP or an
UNC-101::GFP reporter gene and obtained RNAi-affected embryos and animals at different larval stages. RNAi of
1 caused reduction in expression of both apm-1 and unc-101 genes in
embryos and larvae (Figure 7, F, H, K,
L), while
2 RNAi did not result in any difference of expression
(Figure 7, M and N). This result indicates that the disruption of
1
destabilized both AP-1 complexes containing APM-1 or UNC-101 as their
medium chain. It is therefore conceivable that a
1-containing AP-1
complex can have either APM-1 or UNC-101 as its medium chain.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this article, we have identified a second homolog of AP47, the medium chain of the trans-Golgi clathrin-associated protein complex AP-1. Our functional analysis suggested that, on their own, apm-1 and unc-101 are dispensable for embryonic development as single disruption of either gene did not cause any embryonic lethality. However, when both of these genes are disrupted, embryogenesis is affected, indicating that the combined functions of APM-1 and UNC-101 proteins are essential for embryogenesis. Our results also indicated that the nematode AP-1 complexes can contain either UNC-101 or APM-1 as their medium chains along with other components, probably serving both shared and distinct functions. We propose that the AP-1 complex in the nematode can employ either one of the two medium chains as its medium chain for cargo transport.
Comparison of the genomic DNA sequences of the apm-1 and unc-101 genes revealed interesting structural features. The boundaries of the first three exons and the last one exon are conserved in both genes, whereas exon/intron boundaries as well as the number of central introns vary. It is possible that the genes were initially duplicated during evolution and that the introns in the central part of the genes were introduced later, at different loci, contributing to novel, distinct functions for each gene.
Mutations in the unc-101 locus cause pleiotropic effects,
suggesting that unc-101 is not equivalent to
apm-1 and that unc-101 has distinct functions
from those of apm-1. However, several previous observations
suggested that unc-101 may not be fully distinct from
apm-1. For example, the phenotypes of unc-101
putative null mutations are not identical in all animals although they
bear the same mutations in unc-101. The lethality associated
with the putative null mutations is not complete as only 50% of the
progeny of homozygous hermaphrodites actually die. The defecation
defect shows more variety even in a single animal model (Thomas, 1990
). Each defecation cycle in C. elegans is composed of an
anterior body muscle contraction (aBoc), a posterior body muscle
contraction (pBoc), and an expulsion (Exp) step. In an
unc-101 null mutant animal, the aBoc step is missing in half
of the defecation cycles, while in the other half of the defecation
cycles, the aBoc is normal. Therefore, it is conceivable that a gene
may exist that shares partial redundancy with unc-101. We
infer that apm-1 may be one such gene. In this report, we
have shown that apm-1 and unc-101 on their own
are redundant for embryonic development and for regulating an
EGF-mediated signaling pathway.
Concerning the extent of redundancy between apm-1 and
unc-101, one possibility is that unc-101 and
apm-1 have identical functions, and that full expression of
both the genes is required for production of a sufficient amount of
proteins. This is unlikely for the following reasons. Mutations in the
unc-101 locus were not dosage-dependent but were fully
recessive, indicating that the loss of one copy of unc-101
does not cause any defect. However, one still cannot exclude the
possibility that there exists a threshold level of expression of these
genes required for their proper functioning. Another prediction of the
above hypothesis is that the apm-1 mutant animals will have
the same phenotype as unc-101 mutant animals, but this is
not the case either. Animals affected by RNAi of apm-1 displayed different phenotypes from those with unc-101
mutations. A second possibility is that APM-1 and UNC-101 are expressed
in different types of cells, although they have the same functions. This possibility is unlikely either, since our expression studies did
not reveal any difference in the pattern of unc-101 and
apm-1 expression throughout development (Figure 2). A third
hypothesis, which we prefer, is that APM-1 acts as a counterpart
of UNC-101 (or vice versa) within the context of the AP-1
trans-Golgi clathrin-associated protein complex, and it may
interact with distinct sets of target proteins from those of UNC-101
depending on the tissue type and the stage of development. It is
possible that apm-1 can somehow compensate for the UNC-101
function when unc-101 is mutated. If this were the case,
single mutants of apm-1 would probably have different
phenotypes from those of unc-101 and double mutants for
unc-101 and apm-1 would be 100% lethal. As a
matter of fact, RNAi of apm-1 in the unc-101
background caused 100% embryonic lethality, while RNAi of
apm-1 in the wild-type background resulted in different
phenotypes from those of unc-101 mutants. As our results
clearly showed, RNAi of the small or large chain of the AP-1 complex
(
1,
1, and
) caused 100% embryonic lethality, indicating that
UNC-101 and APM-1 function as two alternative forms of the medium chain
in the AP-1 complex.
One interesting feature of apm-1 function is its role in
vulval development, which is mediated by the LIN-3 (EGF)-LET-23 (EGFR) signaling pathway. We propose that apm-1 is another negative
regulator of vulval development on the bases of the following
observations. First, a hybrid protein, composed of two thirds of the
apm-1 gene and one third of the unc-101 gene, can
complement a defective UNC-101 protein function in vulval development,
when expressed under the control of the unc-101 promoter.
Second, reduction in apm-1 function can suppress the
vulvaless phenotype of let-23 (sy1) even in the
unc-101 (+) background. This is also observed when
unc-101 mutations are introduced into the
apm-1(+) background. Third, disruption of both
apm-1 and unc-101 caused greater-than-wild-type vulval induction. The phenotypes observed after the disruption of
different sets of genes, let-23, unc-101, and/or
apm-1 are summarized in table 4. These
results suggest that apm-1 shares redundant functions with
unc-101 for normal vulval development in wild-type animals.
|
Why were apm-1 mutations not identified in the genetic
screen for suppressors of the vulvaless phenotype of the
let-23(sy1) mutation? A possible answer is that the screen
was not applied extensively enough to identify a reduction-of-function
allele of a gene whose null phenotype is complete lethality.
Nevertheless, a putative unc-101 null mutation was isolated
in a screen (Lee et al., 1994
). The fact that the
apm-1:GFP reporter construct, which presumably overexpressed
APM-1::GFP in the wild-type background, caused
greater-than-wild-type induction of VPCs indicates that apm-1 might play a more important role in the vulval
induction pathway than unc-101, although apm-1
was not isolated by a conventional genetic screen.
It is now clear that apm-1 and unc-101 play
redundant roles in embryogenesis and in vulval development. However, as
a single disruption of apm-1 or unc-101 clearly
showed, a decreased function in either gene led to distinct phenotypes
and therefore, the apm-1 and unc-101 genes have
distinct functions. As described in the RESULTS section,
apm-1 RNAi animals were arrested at the L1 larval stage with
abnormal anterior intestine bloating although the larvae seemed normal
after hatching. This indicates that apm-1 gene activity is
required even in the presence of wild-type unc-101 activity during larval development. The intestinal phenotype that appears only
in apm-1 RNAi animals may imply that APM-1 function is
important in intestine cells. A new µ1 gene (µ1B) has been
identified in mouse and humans and recent studies showed that the µ1B
medium chain is epithelial cell-specific and important for polarized transport of proteins(Ohno et al., 1999
, Folsch et
al., 1999
). It is possible that APM-1 may likewise have important
roles in polarized cells, such as in the intestinal cells of the
nematode. Another distinct function of apm-1 and
unc-101 was drawn from the behavioral phenotype associated
with a single disruption of each gene. While apm-1 RNAi
animals do not seem to be Unc (uncoordinated movement), as they move
for a short time after hatching, unc-101 mutant animals are
severe Unc, indicating that UNC-101 protein may have major functions in
the nervous system or muscles. Our RNAi results indicated that the Unc
phenotype of unc-101 mutants may be due to muscle defects,
since RNAi often does not interfere with neuronal gene activity
(Travernarakis et al., 2000
). Supporting this, GFP
fluorescence in the neurons persisted after apm-1 RNAi in
our RNAi experiment. Although apm-1 and unc-101
seem to be expressed in overlapping cells at all developmental stages,
they exhibited different phenotypes, suggesting that both APM-1 and UNC-101 proteins interact with distinct target proteins.
In summary, we showed in this report that there exist two medium chains of the AP-1 complex in the nematode. Both are expressed ubiquitously throughout development and play redundant roles in embryogenesis and vulval development, but they appear to have distinct functions during early larval stages after hatching. The two medium chains are shared by other components of AP-1 complexes as in mammals. An important future direction of research should be to characterize specific functions for these two AP-1 complexes in more detail. The medium chains of AP complexes are known to recognize tyrosine signals and dileucine signals in specific target proteins. In order to elucidate the distinct functions of AP-1 complexes, it will be crucial to identify the cargo proteins that interact with UNC-101 and/or APM-1 protein.
| |
ACKNOWLEDGMENTS |
|---|
We thank Drs. A. Fire, A. Coulson, and Y. Kohara, and the Caenorhabditis Genetics Center (St. Paul, MN) for providing the nematode vectors, strains, and genomic and cDNA clones. We also thank S. Yoo and Dr. D. Jeoung for the dendrogram of the medium chain homologs. This study was supported in part by the Korean /U.S. Cooperative Science Program (KOSEF 965-0504-001-2), by the Molecular Medicine Research Group Program (98-J03-01-01-A-05) from the Ministry of Science and Technology (Korea) to J.L., and by USPHS grant HD23690 to P.W.S. P.W.S. is an investigator with the H. H. M. I.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
leej{at}yonsei.ac.kr.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. A. Margeta, G. J. Wang, and K. Shen Clathrin adaptor AP-1 complex excludes multiple postsynaptic receptors from axons in C. elegans PNAS, February 3, 2009; 106(5): 1632 - 1637. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Han, P. Sundaram, H. Kenjale, J. Grantham, and L. Timmons The Caenorhabditis elegans rsd-2 and rsd-6 Genes Are Required for Chromosome Functions During Exposure to Unfavorable Environments Genetics, April 1, 2008; 178(4): 1875 - 1893. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Holmes, A. Flett, D. Coudreuse, H. C. Korswagen, and J. Pettitt C. elegans Disabled is required for cell-type specific endocytosis and is essential in animals lacking the AP-3 adaptor complex J. Cell Sci., August 1, 2007; 120(15): 2741 - 2751. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-K. Bae, H. Qin, K. M. Knobel, J. Hu, J. L. Rosenbaum, and M. M. Barr General and cell-type specific mechanisms target TRPP2/PKD-2 to cilia Development, October 1, 2006; 133(19): 3859 - 3870. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ohno Physiological Roles of Clathrin Adaptor AP Complexes: Lessons from Mutant Animals J. Biochem., June 1, 2006; 139(6): 943 - 948. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Touz, L. Kulakova, and T. E. Nash Adaptor Protein Complex 1 Mediates the Transport of Lysosomal Proteins from a Golgi-like Organelle to Peripheral Vacuoles in the Primitive Eukaryote Giardia lamblia Mol. Biol. Cell, July 1, 2004; 15(7): 3053 - 3060. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Kamikura and J. A. Cooper Lipoprotein receptors and a Disabled family cytoplasmic adaptor protein regulate EGL-17/FGF export in C. elegans Genes & Dev., November 15, 2003; 17(22): 2798 - 2811. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gokool {sigma}1- and {micro}1-Adaptin Homologues of Leishmania mexicana Are Required for Parasite Survival in the Infected Host J. Biol. Chem., August 8, 2003; 278(32): 29400 - 29409. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Boehm and J. S. Bonifacino Adaptins. The Final Recount Mol. Biol. Cell, October 1, 2001; 12(10): 2907 - 2920. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Aguilar, M. Boehm, I. Gorshkova, R. J. Crouch, K. Tomita, T. Saito, H. Ohno, and J. S. Bonifacino Signal-binding Specificity of the {micro}4 Subunit of the Adaptor Protein Complex AP-4 J. Biol. Chem., April 13, 2001; 276(16): 13145 - 13152. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||