![]() |
|
|
Vol. 11, Issue 9, 2873-2884, September 2000
-Factor Pheromone
Receptor Are Functional Units of Endocytosis
Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, Worcester, Massachusetts 01655
Submitted May 16, 2000; Revised June 22, 2000; Accepted June 23, 2000| |
ABSTRACT |
|---|
|
|
|---|
-Factor receptors from Saccharomyces cerevisiae
are G-protein-coupled receptors containing seven transmembrane
segments. Receptors solubilized with the detergent
n-dodecyl
-D-maltoside were found to
sediment as a single 8S species in glycerol density gradients. When the
membranes from cells coexpressing two differentially tagged receptors
were solubilized with detergent and subjected to immunoprecipitation,
we found that the antibodies specific for either epitope tag resulted
in precipitation of both tagged species. Coprecipitation was not a
consequence of incomplete detergent extraction because the abundant
plasma membrane protein Pma1 did not coprecipitate with the receptors.
Moreover, the receptor complexes were present prior to detergent
extraction because coimmunoprecipitation was not observed when cells
expressing the single tagged species were mixed prior to membrane
preparation. Treatment of cultures with
-factor had little effect on
the extent of oligomerization as judged by the sedimentation behavior
of the receptor complexes and by the efficiency of
coimmunoprecipitation. The ability of receptor complexes to undergo
ligand-mediated endocytosis was evaluated by using membrane
fractionation and fluorescence microscopy. Mutant receptors that fail
to bind
-factor (Ste2-S184R) or lack the endocytosis signal
(Ste2-T326) became competent for ligand-mediated endocytosis when they
were expressed in cells containing wild-type receptors.
Coimmunoprecipitation experiments indicated that the C-terminal
cytoplasmic domain and intermolecular disulfide bonds were unnecessary
for oligomer formation. We conclude that
-factor receptors form
homo-oligomers and that these complexes are subject to ligand-mediated
endocytosis. Furthermore, we show for the first time that unoccupied
receptors participate in these endocytosis-competent complexes.
| |
INTRODUCTION |
|---|
|
|
|---|
The G-protein-coupled receptors (GPCRs) comprise the largest and
most diverse superfamily of cell-surface receptors (Hebert and Bouvier,
1998
; Bockaert and Pin, 1999
). GPCRs mediate responses to a variety of
extracellular stimuli such as light, odorants, calcium, hormones, and
neurotransmitters. They contain a central core of seven putative
transmembrane domains, and signal transduction is mediated by a
heterotrimeric G-protein. Until recently, GPCRs have been assumed to
function as monomers. Examples of early observations suggesting
oligomerization of GPCRs include allelic complementation of coexpressed
mutant receptors (Konopka and Jenness, 1991
), and the presence of large
SDS-resistant receptor-protein aggregates on SDS-PAGE gels (Herberg
et al., 1984
; Blumer et al., 1988
; Konopka et al., 1988
; Ng et al., 1993
). More direct
evidence was obtained recently by using cross-linking and
coimmunoprecipitation approaches, suggesting oligomerization of the
2-adrenergic (Hebert et al., 1996
),
-opioid (Cvejic
and Devi, 1997
), D2 and D3
dopamine (Ng et al., 1996
; Nimchinsky et al.,
1997
), m3 muscarinic (Zeng and Wess, 1999
), metabotropic glutamate
(Romano et al., 1996
), and Ca2+-sensing receptors (Bai et al.,
1998
).
Although oligomerization is emerging as a common theme for GPCRs, our
understanding of this phenomenon is limited. The influence of agonists
on receptor oligomerization and the structural determinants of the
receptor that are important for oligomerization have been shown to vary
among the GPCRs investigated. For example, agonists appear to stabilize
dimers of
2-adrenergic receptors (Hebert et al., 1996
),
whereas agonist binding favors the monomeric state of
-opioid
receptors (Cvejic and Devi, 1997
) and fails to alter the oligomeric
state m3 muscarinic receptors (Zeng and Wess, 1999
). Transmembrane
region VI is thought to mediate the association of
2-adrenergic
receptors because peptides containing this sequence interfere with the
recovery of receptor dimers and interfere with signaling (Hebert
et al., 1996
). In contrast, 15 amino acids in the C-terminal
tail of
-opioid receptor are associated with dimerization (Cvejic
and Devi, 1997
), and the Ca2+-sensing receptor
and metabotropic glutamate receptor 5 oligomerize through disulfide
bonds (Romano et al., 1996
; Bai et al., 1998
).
Functional significance of GPCR oligomerization is currently unclear.
Functional interactions between oligomerized receptors have been
inferred from the cooperative binding of subtype-specific ligands to
receptor heterodimers containing
- and
-opioid receptors (Jordan
and Devi, 1999
). The relationship between oligomerization and signal
transduction is controversial. Although the transmembrane VI peptide
from the
2-adrenergic receptor interferes with detection of both
receptor dimers and receptor-signaling activity (Hebert et
al., 1996
), this region of the D1 dopamine
receptor inhibits receptor function without affecting oligomerization
(George et al., 1998
). For the
-opioid receptor,
ligand-induced dissociation of receptor oligomers is found to precede
ligand-mediated endocytosis (Cvejic and Devi, 1997
). This correlation
suggests that the dissociation of oligomers may be an essential step in
the endocytic pathway.
The
-factor pheromone receptor Ste2p is a GPCR that is present on
the surface of yeast haploid cells of the a mating type
(a cells). It binds the
-factor pheromone secreted by haploid
cells during mating of a cells and
cells. After
-factor binding, the receptor undergoes a conformational change (Bukusoglu and Jenness, 1996
), resulting in the activation of a
heterotrimeric G-protein and a protein kinase cascade. These intracellular signals inhibit cell division and promote transcription of mating-specific genes.
-Factor receptors are subject to
ligand-mediated endocytosis and degradation in the vacuole (Jenness and
Spatrick, 1986
; Schandel and Jenness, 1994
; Hicke, 1997
; Mulholland
et al., 1999
); endocytosis is associated with
phosphorylation and ubiquitination of the cytoplasmic C-terminal domain
of the receptor (Hicke and Riezman, 1996
; Hicke et al.,
1998
). Oligomerization of
-factor receptors in the plasma membrane
was first proposed by Jenness and Spatrick (1986)
because receptors
were found to be internalized more rapidly than bound
-factor at
subsaturating concentrations. We sought to determine whether yeast
-factor receptors form oligomers and whether oligomers are subject
to ligand-mediated endocytosis.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids
pJBK008 is a yeast centromeric plasmid that contains the
STE2 and URA3 genes (Konopka et al.,
1988
). pYe(CEN3)30 is a yeast centromeric plasmid that contains the
TRP1 gene (Fitzgerald-Hayes et al., 1982
).
Plasmid pNED1(-Cys) (provided by Pam Torrance and Jeremy Thorner,
University of California, Berkeley, Berkeley, CA) is a
derivative of plasmid pNED1 (David et al., 1997
); it encodes
a modified Ste2p that contains the Flag epitope and the 6His tags at
the C terminus, lacks Cys residues 59 and 252, and is expressed from
the TDH3 promoter. pDJ123 (provided by Kim Schandel, University of Massachusetts, Worcester, MA) was constructed by cloning the 4.3-kilobase (kb) BamHI fragment that contains
the STE2 gene into the BamHI site of plasmid
vector pYe(CEN3)30. pDJ323 (provided by Gul Bukusoglu, University of
Massachusetts, Worcester, MA) contains
ste2-S184R and was created by hydroxylamine
mutagenesis of plasmid pJBK008; the STE2-coding region was
confirmed by DNA sequencing. The yeast integrating plasmid pDJ320
contains the URA3 gene, and it directs synthesis of a fusion
protein that contains the
-factor receptor and the green fluorescent
protein (GFP) under the control of the STE2 promoter (Li
et al., 1999
). Integrating plasmid pDJ379 contains the
URA3 gene and the STE2 codons 302-431 fused to
the coding sequence for GFP (Li et al., 1999
). Cleavage of
pDJ379 with PstI followed by integration at the chromosomal STE2 locus results in production of full-length Ste2p tagged
at the C terminus with GFP. Integrating plasmid pDJ466 contains the TRP1 gene and STE2 codons 302-431 fused to the
coding sequence for the triple influenza hemagglutinin (HA) epitope.
Cleavage of pDJ466 with PstI followed by integration at the
chromosomal STE2 locus results in production of full-length
Ste2p tagged at the C terminus with the triple HA epitope. pDJ466 was
constructed in two steps: first, the 0.4-kb NsiI/SacII
fragment from pDJ320 (containing STE2 codons 302-431) was
subcloned into plasmid vector pRS304 (Sikorski and Hieter, 1989
) that
had been cut with PstI and SacII; and second, the
resulting plasmid was digested with SacI and
SacII and ligated with the
SacI/SacII-digested product of a polymerase chain
reaction (PCR) that contains the triple HA epitope DNA (from Mike
Tyers, Mount Sinai Hospital, Toronto, ONT) as template and
oligonucleotide primers PO-140
(CGTGCCGAGCTCCCATGGTCAAGCAGCGTAATCTGGAACGTCATA) and PO-177
(GGCTCCCCGCGGTCTTTTACCCATACGATGTTCCTGAC-TAT). Integrating plasmid
pDJ467 contains the URA3 gene and STE2 codons
156-326 fused to the GFP-coding sequence. Cleavage of pDJ467 with
ClaI followed by integration at the chromosomal
STE2 locus results in production of Ste2-T326 tagged at the
C terminus with GFP. pDJ467 was constructed by ligating the 4.5-kb
NsiI/SacII fragment (lacking STE2)
from pDJ320 with the PstI/SacII-digested product of a PCR reaction that contained STE2 DNA (pDJ320) as
template and oligonucleotide primers PO-141
(GCGAAACTGCAGGGCGACAACTTCAAAAGGATAGGTTT) and PO-147
(CCACACCTACGAGTTCAA). pDJ469 (provided by Padhma Radhakrishnan, University of Massachusetts, Worcester, MA) is a yeast
centromere plasmid that contains URA3 and directs synthesis
of Ste2-T326 tagged at the C terminus with GFP. pDJ469 was created by
cloning the ClaI-XbaI fragment (containing
STE2 codons 259-326 and GFP) from pDJ467 into
ClaI-SpeI sites in plasmid pDB02 (Dube and
Konopka, 1998
). Integrating plasmid pDJ470 contains TRP1 and
STE2 codons 156-326 fused to the triple HA-coding sequence.
Cleavage of pDJ470 with Eco47III followed by integration at
the chromosomal STE2 locus results in production of
Ste2-T326 tagged at the C terminus with the triple HA epitope. pDJ470
was created in two steps. In the first step, primers PO-177 and PO-186
(GCGAAAGGTACCGGCGACAACTTCAAAAGGATAGGTTT) were used to amplify DNA
encoding the triple HA epitope, and the PCR product was cloned between
the SacII and XbaI sites of plasmid pDJ467,
replacing the GFP gene. In the second step, a 0.6-kb sequence in this
plasmid (containing STE2 codons 156-326 and the triple HA
epitope) was PCR-amplified with oligonucleotide primers PO-140 and
PO-141, and the PstI/SacI-digested product was
cloned between the PstI and SacI sites of pRS304.
Yeast Strains
Yeast strains listed in Table 1
are congenic to strain 381G. Strains DJ1400-A, DJ1403-A, DJ1404-A,
DJ1405-A, DJ1406-A, DJ1408-A, DJ1414-A to DJ1417-A were derived from
DJ211-5-3; strains DJ1402-A, DJ1407-A, and DJ1418-A were derived from
AY1; strains DJ1410-A, DJ1411-A, and DJ1413-A were derived from strain
DJ1205-6-3 by transformation with the plasmids indicated in Table 1.
Plasmids pDJ379 and pDJ466 were digested with PstI and
plasmids pDJ467 and pDJ470 were digested with ClaI and
Eco47III, respectively, prior to transformation to target
the integration at the STE2 locus. pDJ320 was digested with
StuI to target the integration at the URA3 locus.
Production of relevant proteins was confirmed by Western blotting.
Yeast strains were transformed with plasmids by using standard
techniques (Soni et al., 1993
). Strain AY1 (provided by Amy
Yang, University of Massachusetts, Worcester, MA) was
constructed by subcloning the ste2-S184R allele into
integrating plasmid pDJ251 and then introducing it into the chromosomal
locus of strain DJ211-5-3 by using the two-step gene replacement
described previously (Schandel and Jenness, 1994
).
|
Media
Liquid and solid media were prepared as previously described
(Jenness et al., 1997
). YM-1 is a rich liquid medium
(Hartwell, 1967
). Minimal selective media lacking uracil (
Ura + CAA)
or lacking tryptophan (
Trp + CAA) are described elsewhere (Hirschman et al., 1997
).
Antisera and Reagents
Rabbit polyclonal antisera were specific for GFP (Seedorf
et al., 1999
), for Escherichia coli aspartate
transcarbamoylase (ATCase) (from Y.R. Yang and H.K. Schachman,
University of California, Berkeley, Berkeley, CA) or for the
carboxy-terminal portion of the
-factor receptor Ste2 (Konopka
et al., 1988
). Mouse monoclonal antibodies that recognize
the yeast plasma membrane ATPase (Pma1) were from clone C56 (Aris and
Blobel, 1988
; Schandel and Jenness, 1994
). Mouse monoclonal antibodies
that recognize the influenza HA epitope (HA.11) were from
Babco, Berkeley Antibody, Richmond, CA. Peroxidase-conjugated goat
anti-rabbit secondary antibodies were purchased from Life Technologies,
Baltimore, MD. Peroxidase-conjugated goat anti-mouse secondary
antibodies, purified mouse immunoglobulin and n-dodecyl
-D-maltoside were from Sigma Chemical, St.
Louis, MO. Purified bovine serum albumin (BSA) was purchased from
Boehringer Mannheim, Indianapolis, IN. Peroxidase-conjugated goat
anti-mouse and goat anti-rabbit F(ab')2 fragment
specific IgG were purchased from Jackson Immunoresearch, West Grove,
PA. The chemiluminescence kit Super Signal and Ultralink Immobilized
Protein A beads were from Pierce Chemical, Rockford, IL.
Renografin Density Gradients
Cultures were grown in
Ura + CAA or in
Trp + CAA medium
according to the plasmid markers used. Membranes were resolved in Renografin density gradients as previously described (Schandel and
Jenness, 1994
).
Immunoblotting, Quantitation, and Immunoprecipitation
Western blotting procedures and quantitation were carried out as
previously described (Hirschman et al., 1997
). Cell
lysates were prepared as described previously (Schandel and Jenness,
1994
). Membranes were collected by centrifugation (Beckman airfuge for 20 min, or SW50 rotor at 40,000 krpm for 90 min). The pellet
containing the membranes was suspended in ice-cold IP buffer (50 mM
Tris-Cl, pH 7.4, 150 mM NaCl, 5 mM EDTA, 2 mg/ml n-dodecyl
-D-maltoside, 10% glycerol, 100 µg/ml
phenylmethylsulfonyl fluoride, and 10 µg/ml pepstatin A) and
incubated on ice for 2 h with occasional mixing. The solution was
then centrifuged at 13,000 × g for 5 min to remove
insoluble material. In each experiment, an equivalent number of cells
was processed for each immunoprecipitation reaction; however, for the
experiments in which the cultures had been treated with
-factor; the
extracts were corrected for protein concentration. Bicinchoninic acid
protein assay (Pierce Chemical) was used according to manufacturer's
instructions. Precipitating antibodies were added to the supernatant,
and the mixture was incubated at 4°C with gentle agitation for 2 h. Protein A beads were added, and the mixture was incubated for 2 h at 4°C. The beads were allowed to settle for 5 min, and then
collected by centrifugation 1100 × g for 5 s.
Beads were washed four times with IP buffer and extracted with
concentrated SDS sample buffer for 10 min at 37°C. Samples were
centrifuged at 13,000 × g for 5 min. The proteins were
resolved on 10% SDS-PAGE gels and detected by using
immunoblotting methods. Peroxidase-conjugated goat
anti-mouse or goat anti-rabbit F(ab')2 fragment
was used as the secondary reagent. The results were quantified by using
laser-scanning densitometry (Molecular Dynamics, Sunnyvale, CA).
Glycerol Gradient Sedimentation
Cells (2 × 109) were collected from
exponentially growing cultures that had been untreated or treated with
10
7 M
-factor for 5 min. Crude membranes
were extracted with n-dodecyl
-D-maltoside as described in the previous
section. The extract was cleared by centrifugation for 15 min at
13,000 × g and mixed with 4.5 µg of BSA (4.3S), 5 µg of mouse IgG (7S), and 10 µg of ATCase (11.7S) as internal
marker proteins. The mixture was applied to an 8-30% glycerol
gradient in IP buffer and centrifuged in an SW50 rotor at 40,000 rpm
for 14 h at 4°C. Fourteen 350-µl fractions were collected
assayed for the presence of the tagged receptors and the marker
proteins by using SDS-PAGE and immunoblotting methods.
Fluorescence Microscopy
Cultures were grown overnight at 34°C to a density of 2 × 106 cells/ml in
Trp + CAA medium. These
conditions provided selection of the plasmids bearing the
TRP1 gene. Cells were collected and resuspended in the same
volume of YM-1 medium, and then cultured at 30°C to a density of
107 cells/ml. Cultures received cycloheximide (10 µg/ml) for 5 min and were then incubated at 30°C for 15 min in the
presence or in the absence of
-factor (10
7
M). Endocytosis was terminated by chilling the cells and adding the
metabolic poisons, NaN3 (10 mM) and KF (10 mM).
Cells were collected by centrifugation, washed with ice-cold
phosphate-buffered saline, and suspended in 1/10 volume of
phosphate-buffered saline. Epifluorescent images were obtained with a
Nikon microscope equipped with a cooled charge-coupled device camera.
| |
RESULTS |
|---|
|
|
|---|
Immunoprecipitation of Differentially-tagged Receptors
Interactions between
-factor receptors were evaluated by
performing coimmunoprecipitation experiments with differentially tagged
receptors that had been solubilized with nondenaturing detergent
n-dodecyl
-D-maltoside. We examined
cells that express
-factor receptors tagged with the influenza HA
epitope (Ste2-HA) as well as
-factor receptors tagged with the GFP
(Ste2-GFP). Both epitope tags were fused to the receptor after the
C-terminal residue. The genes encoding the two fusion proteins were
present in single copy and used the native STE2 promoter.
Crude membranes were prepared and extracted with the detergent.
Glycerol gradients were performed to evaluate the size and the
homogeneity of the complexes containing receptors. Both Ste2-HA and
Ste2-GFP sedimented as a single peak with sedimentation coefficient of
roughly 8S in glycerol density gradients (Figure
1A), although Ste2-HA sedimented slightly
faster than Ste2-GFP. The relatively small differences in the molecular
weights of the two tagged species are not expected to influence the
sedimentation rate. Similar results were obtained when the cultures had
been exposed to
-factor (Figure 1B). Both Ste2-HA and Ste2-GFP were
found to coimmunoprecipitate, when the receptors in the detergent
extract were precipitated with anti-HA antibodies and analyzed with
immunoblotting methods (Figure
2A, lane 3). The two tagged species were
resolved on the blot because Ste2-GFP is significantly larger than
Ste2-HA (80 vs. 55 kDa, respectively). No precipitation of Ste2-GFP was
detected in the analysis of the control cells that expressed only
Ste2-HA or only Ste2-GFP (Figure 2A, lanes 1 and 2, respectively).
Similar results were obtained by using two other detergents, 1% Triton
X-100 and 0.1% C12E8, suggesting that the interactions detected
between the receptors are not specific to n-dodecyl
-D-maltoside (our unpublished results).
|
|
Two protein species containing Ste2 were detected that had molecular
weights greater than 100 kDa (Figure 2A, lanes 1 and 3). Such
high-molecular-weight forms, designated "SDS-resistant dimers," are
commonly observed when analyzing Ste2 and other GPCR proteins (Blumer
et al., 1988
; Konopka et al., 1988
; Hebert
et al., 1996
). We found, however, that the proportion of
receptors that migrated as SDS-resistant dimers was variable among
different preparations. In earlier work, it has been unclear whether
this high-molecular-weight species reflects the aggregation of Ste2 with itself or with other proteins, and also it has been unclear whether it represents receptor dimers present in the membrane or dimers
that arise only after SDS extraction. Interestingly, we detected a
single high-molecular-weight protein from cells expressing Ste2-HA
alone (Figure 2A, lane 1), consistent with Ste2-HA dimers, whereas
cells expressing both Ste2-HA and Ste2-GFP produced bands consistent
with Ste2-HA/Ste2-GFP heterodimers in addition to Ste2-HA homodimers
(Figure 2A, lane 3). The absence of Ste2-GFP homodimers is expected
because the sample had been immunoprecipitated with anti-HA antibodies.
These observations indicate that an SDS-resistant dimer contains more
than one molecule of Ste2.
As a more defined method of evaluating coimmunoprecipitation of Ste2-HA
and Ste2-GFP, we performed reciprocal immunoprecipitation experiments.
Antibodies against one epitope were used to precipitate receptors from
the detergent extract, and then antibodies against the second epitope
were used to test for the presence of the second tagged species in the
immunoprecipitate. In Figure 2B, anti-HA antibodies precipitated 11%
of the Ste2-GFP from the extracts of cell expressing both receptors
(compare lanes 3 and 7), whereas no detectable Ste2-GFP was
precipitated from the control cells' extracts containing only Ste2-GFP
or only Ste2-HA (lanes 1 and 2, respectively). Similar results were
obtained when the cultures had been exposed to
-factor for 5 min
(lanes 4 and 8) or 15 min (our unpublished results) prior to the
analysis. Receptors are normally depleted from the plasma membrane
after 20 min (Schandel and Jenness, 1994
). In the reciprocal experiment
(Figure 2C), anti-GFP antibodies precipitated ~6% of the Ste2-HA
from the extracts of cell expressing both receptors (compare lanes 3 and 6), and no Ste2-HA was precipitated from either control extract
(lanes 1 and 2). Again, prior exposure to
-factor 5 or 15 min (our
unpublished results) had no discernable effect. In both experiments,
the antibody used for immunoprecipitation cleared all the antigen from
the supernatant (our unpublished results).
Coprecipitation of Ste2-HA and Ste2-GFP was not a consequence of incomplete membrane solubilization or nonspecific aggregation of membrane proteins. The coprecipitated Ste2-HA and Ste2-GFP were apparently part of the 8S complex because essentially all of Ste2-HA and Ste2-GFP extracted under these conditions sediment as 8S species (Figure 1A). Moreover, when the 8S peak in Figure 1A was pooled and analyzed according to the reciprocal immunoprecipitation method, we found that 5% of Ste2-GFP was precipitated with anti-HA antibody and that 5% of Ste2-HA was precipitated with anti-GFP (our unpublished results). In addition, the protein complexes containing Ste2 do not appear to result from nonspecific aggregation of membrane proteins because the more abundant transmembrane protein, plasma membrane ATPase (Pma1p), was not found in immunoprecipitates containing Ste2-HA (Figure 2E).
We considered the possibility that receptor complexes that we observed
were formed only after the proteins were extracted from the membrane
with detergent. To test this possibility, we mixed cells that only
expressed Ste2HA with cells that only express Ste2-GFP, and then
processed the mixture for immunoprecipitation as described above
(Figure 2D). We detected Ste2-GFP coprecipitate with Ste2-HA only when
both receptors were expressed in the same cells (Figure 2D, lane 3) but
not from the mixture of the two cultures expressing Ste2-HA and
Ste2-GFP receptors individually (Figure 2D, lane 4). We conclude that
-factor receptors are present in the plasma membrane as complexes
containing two or more receptor molecules. Although we were unable to
detect changes in the complexes induced by
-factor pretreatment, we
cannot rule out the possibility that
-factor influences higher order
states of aggregation that were not stable in the solvent conditions used.
Ste2-S184R Is Internalized with Wild-Type Receptors upon
-Factor
Exposure
Early work with
-factor receptor endocytosis suggested that
receptors are internalized as oligomeric units (Jenness and Spatrick, 1986
). When yeast cells are exposed to subsaturating concentrations of
-factor, the rate at which
-factor receptor sites are lost from
the plasma membrane is greater than the rate of
-factor uptake. This
observation suggests that unoccupied receptors are internalized
together with the occupied receptors. Three explanations (not mutually
exclusive) account for these phenomena: 1) binding of
-factor may be
necessary only to initiate the events that lead to the internalization,
i. e., receptor internalization may proceed even after
-factor
dissociates; 2) the invaginations of the plasma membrane that occur
during endocytosis may be large enough to include both occupied
receptors and neighboring unoccupied receptors; and/or 3) the occupied
and unoccupied receptors may exist as oligomeric units that remain
coupled during endocytosis. To determine whether
-factor binding is
required to initiate receptor internalization, we coexpressed wild-type
Ste2 and the
-factor-binding-defective mutant Ste2-S184R. In the
presence of
-factor, these two receptors represent occupied and
unoccupied receptors, respectively. If the internalization of the
unoccupied receptors requires prior occupancy, then endocytosis of
Ste2-S184R should not be induced by
-factor because it does not bind
-factor. Conversely, if internalization of unoccupied receptors
reflects cointernalization, then Ste2-S184R internalization should be
stimulated by
-factor.
Membrane fractionation was used to evaluate ligand-induced exit
of Ste2-S184R from the plasma membrane in the presence and in the
absence of the wild-type receptor. We created strains that coexpress
both wild-type Ste2 and mutant Ste2-S184R receptors. Genes encoding
both receptors were present in a single copy and contained the native
STE2 promoter. In each experiment, the chromosomal allele
directed synthesis of HA-tagged receptors and a plasmid-borne, allele-directed synthesis of untagged receptors. Exponentially growing
cultures were treated with cycloheximide to block new receptor
synthesis, incubated further either in the presence or in the absence
of
-factor, and then after 15 min, the membranes were resolved on
Renografin density gradients. Because essentially all of the receptors
were on the cell surface prior to treatment, receptors detected in
internal membrane fractions represent molecules that have exited the
plasma membrane. As shown previously (Schandel and Jenness, 1994
), the
cells that expressed only wild-type receptors internalized essentially
all their receptors in response to
-factor, as indicated by a shift
of the Ste2 protein from the denser plasma membrane fractions to the
more buoyant internal membrane fractions (Figure
3A). In contrast, cells expressing only
Ste2-S184R showed no
-factor-induced internalization (Figure 3B).
Upon
-factor exposure, a significant fraction of the tagged
Ste2-S184R receptors were internalized in cells containing untagged
wild-type receptors (Figure 3D). This observation suggests that
internalization of unoccupied receptors is not a consequence of prior
-factor occupancy because Ste2-S184R receptors do not bind
-factor. In the reciprocal experiment, internalization of tagged
wild-type receptors was not influenced by the presence of the mutant
Ste2-S184R receptors (Figure 3C).
|
As a second assay for endocytosis of occupied and unoccupied
receptors, we used fluorescence microscopy to monitor wild-type and
mutant receptors that had been tagged with GFP. Ste2-S184R-GFP was
coexpressed with untagged wild-type receptors to test whether internalization of the wild-type receptors would cause the
internalization of the Ste2-S184R-GFP receptors. To this end, cultures
that had been treated with cycloheximide were challenged with
-factor. In the absence of
-factor, the cells containing
GFP-tagged mutant and wild-type receptors exhibited fluorescence both
at the plasma membrane and in the vacuole (Figure
4). Our previous results (Li et
al., 1999
) indicate fluorescence in the vacuole reflects the free
GFP that remains after the Ste2-GFP fusion protein has been endocytosed
and the Ste2 portion of the protein degraded. In presence of
-factor, the wild-type Ste2-GFP was completely removed from the
plasma membrane and appeared as punctate structures presumably corresponding to endocytic vesicles (Figure 4, top row), whereas cells
expressing only the Ste2-S184R mutant receptors showed very little
internalization of cell-surface fluorescence (Figure 4, middle row). In
contrast, in cells expressing both Ste2-S184R-GFP and untagged Ste2,
the plasma membrane fluorescence was significantly reduced and a
greater proportion of the fluorescence appeared in internal punctate
structures (Figure 4, bottom row). When analyzed quantitatively, 32%
of the cells expressing both Ste2-S184R-GFP and Ste2 showed three or
more fluorescent foci after
-factor treatment, whereas only 7% of
the cells expressing Ste2-S184R-GFP alone showed more than three
fluorescent foci (Table 2). These observations are consistent with our results from the Renografin gradients, indicating that Ste2-S184R receptors are internalized with
the wild-type receptors in the presence of
-factor.
|
|
Two criteria were used to judge whether endocytosis of occupied
receptors results in the internalization of a significant portion of
surrounding plasma membrane and membrane proteins. First, essentially
all of the abundant plasma membrane protein ATPase Pma1 remained at the
plasma membrane when the cells containing wild-type receptors were
treated with
-factor (Figure 3). Second, the bulk endocytosis of
plasma membranes marked with the vital stain FM4-64 (Vida and Emr,
1995
) was not influenced by
-factor (our unpublished results). A
significant portion of the FM4-64 was internalized after only 2 min;
however, the staining pattern was indistinguishable for the cells that
were untreated or treated with
-factor. These results suggest that
the endocytosis of unoccupied receptors does not simply reflect an
increased rate of plasma membrane internalization in response to
-factor, and they are consistent with the hypothesis that unoccupied
receptors are endocytosed because they form oligomeric complexes with
occupied receptors.
Wild-Type Ste2 Causes Internalization of Endocytosis-defective
Receptors in the Presence of
-Factor
The C-terminal cytoplasmic tail of Ste2 contains sequence
elements that are essential for both basal and ligand-induced
endocytosis (Rohrer et al., 1993
; Schandel and Jenness,
1994
). The truncated receptor Ste2-T326 binds
-factor normally, even
though it lacks most of the C-terminal tail (Konopka et al.,
1988
). This domain contains the well-characterized endocytosis motif
DAKSS (Rohrer et al., 1993
). We wished to determine whether
the severe endocytosis defect associated with this mutant receptor
could be overcome by forming oligomers with wild-type receptors.
Coimmunoprecipitation of Ste2-HA and Ste2-T326 was observed (our
unpublished results) when detergent extracts were analyzed according to
the methods depicted in Figure 2. Renografin density gradients and
fluorescence microscopy were used to monitor endocytosis of Ste2-T326
tagged with GFP. Table 3 summarizes
-factor-induced internalization of receptors, as judged by
Renografin density gradients. Consistent with previous results
(Schandel and Jenness, 1994
), Ste2-T326-GFP showed no net
internalization when the mutant cells were treated with
-factor in
the absence of protein synthesis. In Table 3 and in the previous study
(Schandel and Jenness, 1994
), a small number of the truncated receptors
(17.6%) cofractionated with the internal membranes, and this quantity
decreased slightly (to 13.5%) in the cells that had been exposed to
-factor. However, under these conditions,
-factor resulted in a
nearly fivefold increase in the accumulation of Ste2-T326-GFP in the
internal membrane fraction when Ste2-T326-GFP and wild-type Ste2 were
coexpressed. This result is consistent with the endocytosis of
oligomeric complexes containing truncated and wild-type receptors. It
is currently unclear why some of the truncated receptors accumulate in
the internal membrane pool, and why this quantity decreases when
truncated and wild-type receptors are coexpressed. As has been proposed for CCR5 receptors (Benkirane et al., 1997
), it is possible
that the truncated
-factor receptors are partially retained in the endoplasmic reticulum and that the defect is overcome by forming oligomers with the wild-type receptors.
|
Internalization of Ste2-T326-GFP also was monitored by using
fluorescence microscopy. In the control cells exposed to
-factor, wild-type Ste2-GFP was depleted from the plasma membrane (Figure 5, top row), and all of the cells
examined contained fluorescent foci (Table
4). When expressed alone, the majority of
Ste2-T326-GFP was at the cell surface at all times, consistent with the
endocytosis defect of this mutant (Figure 5, middle row; Table 4).
However, when cells coexpressing both Ste2-T326-GFP and untagged
wild-type receptors were exposed to
-factor, plasma membrane
fluorescence was diminished, accompanied by intracellular accumulation
of fluorescent foci (Figure 5, bottom row; Table 4). These results are
in agreement with the Renografin density gradient experiments (Table 3)
and suggest that oligomeric complexes containing
internalization-defective truncated receptors and wild-type receptors
are internalized in an
-factor-dependent manner.
|
|
C-Terminal Cytoplasmic Tail and Cysteine Residues of Ste2 Are Not Required for Oligomerization
Coimmunoprecipitation experiments were used to test whether
specific structural features of the receptor play an essential role in
the formation of oligomers. To test whether the C-terminal cytoplasmic
tail of the receptor is dispensable for oligomerization, we coexpressed
two truncated forms of the receptor that were tagged differentially and
performed coimmunoprecipitation tests on the detergent-solubilized
receptors as described in Figure 1. We found coprecipitation of
Ste2-T326-GFP and Ste2-T326-HA when the precipitating antibodies were
either anti-GFP or anti-HA (Figure 6).
This result suggests that the C-terminal cytoplasmic tail of the
receptor is not required for oligomerization. This efficiency of
precipitation was unaltered when the cells were cultured for 5 min in
-factor prior to analysis. We also considered whether either of the
two cysteine residues in the receptor was essential for oligomer
formation. The Ca2+-sensing and metabotropic
glutamate receptors are proposed to dimerize through disulfide bonds
(Romano et al., 1996
; Bai et al., 1998
). Two
differentially tagged forms of the receptor were coexpressed under the
direction of the strong TDH3 promoter. Plasmid pNED1(-Cys)
encodes a mutant form the receptor (Ste2-C59S, C252A-Flag-His6) that
lacks both cysteines and contains the Flag epitope, and this plasmid
was introduced into strain 440-A that directs synthesis of wild-type
receptors containing the T7 epitope. We were able to precipitate
Ste2-C59S, C252A-Flag-His6 with the anti-T7 antibodies (our unpublished
results), indicating the presence oligomers even though one of the
receptors lacked cysteine residues. We conclude that the C-terminal
cytoplasmic domain and interchain disulfide bonds are unnecessary for
the formation of receptor oligomers.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study, we present evidence indicating that the
-factor
receptors from S. cerevisiae form oligomeric complexes in the plasma membrane. Protein complexes containing the receptor were
efficiently solubilized with the nondenaturing detergent n-dodecyl
-D-maltoside, and, on
glycerol density gradients, they sedimented as a monodisperse species
with a sedimentation coefficient of ~8S. When the complexes
containing differentially tagged receptors were solubilized under these
conditions and subjected to immunoprecipitation, both tagged species
were precipitated with antibodies specific for either of the two tags.
The efficiency of coprecipitation was not influenced by the presence of
-factor in the culture prior to extraction. Membrane fractionation
and fluorescence microscopy indicated that oligomeric receptor
complexes were subject to endocytosis and that unoccupied receptors
could participate in these complexes. First, tagged mutant receptors
that lacked the DAKSS endocytosis signal and were unable to undergo
constitutive and ligand-induced endocytosis became competent for
endocytosis when they were coexpressed with untagged wild-type
receptors. Second, unoccupied receptors were able to enter these
endocytosis-competent complexes because tagged mutant receptors that
were unable to bind
-factor also showed ligand-dependent endocytosis
when they were coexpressed with untagged wild-type receptors. A
recently published independent study also reports evidence for
oligomerization of
-factor receptors (Overton and Blumer, 2000
).
These authors used fluorescence resonance energy transfer between
differentially tagged receptors in whole cells as an indicator for
oligomerization. They also showed that tagged receptors lacking the
DAKSS endocytosis signal were endocytosed when coexpressed with
wild-type receptors; however, they did not explore the endocytosis of
unoccupied receptors, and they did not identify complexes in a
membrane-free detergent-soluble system.
Little is known about the size and the structure of the oligomeric
complexes that contain GPCRs. Although detergent-solubilized
-factor
receptors (48 kDa) sedimented faster than the IgG marker protein (160 kDa), we do not know the extent to which detergent, shape, hydration,
and other proteins contribute to the sedimentation rate. Two
observations indicate that at least a portion of the
-factor-receptor complexes contain more than one receptor molecule. First, the HA-tagged receptors sediment slightly faster than the GFP-tagged receptors even though the GFP-tagged receptors are larger.
One interpretation is that oligomers containing Ste2-HA are more stable
than those containing Ste2-GFP; however, we have no direct
corroborating evidence for a difference in affinity. Second, 6-11%
coprecipitation of the differentially tagged receptors indicates that a
minimum of 12-22% of these complexes are in oligomers (assuming two
receptors per complex). This value is likely to be an underestimate
because some complexes may disaggregate during analysis and because
tighter associating forms (i.e., Ste2-HA) may tend to reassociate into
relatively stable homo-oligomers leaving the weaker interacting species
(i.e., Ste2-GFP) to form less stable oligomers. Based on the extensive
cointernalization of mutant and wild-type receptors, it is likely that
most of the receptors are in the oligomeric form in vivo. The
structural determinants that bind
-factor receptors together are
also unclear. Although metabotropic glutamate and
Ca2+-sensing receptors require the disulfide
bonds of cysteines for oligomerization and
-opioid receptors
oligomerize through sequences in the C-terminal domain, we find that
neither of these structural features play an essential role in the
oligomerization of
-factor receptors. Although transmembrane segment
VI of
2-adrenergic receptors and D1 dopamine
receptors are thought to play an essential role in aggregation, this
possibility has not yet been explored for the
-factor receptor. Our
data do not exclude the possibility that a bridging protein mediates
the association of receptor molecules.
Functional consequences of GPCR oligomerization are not well
understood. The ability of one receptor to influence the activity of
another receptor in the same oligomeric complex has been inferred from
the cooperative binding of type-specific agonists to cells that
coexpress
- and
-opioid receptors. Although the hypersensitivity phenotype of truncated
-factor receptors is reversed when they are
coexpressed with wild-type receptors (Konopka et al., 1988
; Reneke et al., 1988
), this phenomenon is most readily
explained by competition of the mutant and wild-type receptors for a
common pool of G-proteins (Dosil et al., 2000
) rather than
by direct aggregation of the two receptor forms. The functional
consequences of disrupting GPCR oligomerization in vivo have been
investigated by exposing cells to peptides corresponding to single
transmembrane segments of the receptor. A peptide that comprises
transmembrane VI of
2-adrenergic receptors inhibits both
oligomerization and signal transduction activities of these receptors,
suggesting that oligomerization may be essential for signaling (Hebert
et al., 1996
). However, the significance of this argument
has recently been called into question because, for
D1 dopamine receptors, a peptide containing
transmembrane segment VI inhibits signaling without inhibiting
oligomerization (George et al., 1998
). It is possible that
variations in the amount of oligomerized GPCRs mediate the response to
agonists because the oligomeric state of some GPCRs is either increased
or decreased by ligand binding (Hebert et al., 1996
; Cvejic
and Devi, 1997
). For the
-opioid receptor, the dimer-to-monomer
transition has been associated with endocytosis because the natural
agonists induce monomers prior to endocytosis and because morphine does
not induce receptor internalization and does not alter the oligomeric
state (Cvejic and Devi, 1997
). Disaggregation of
-factor receptors
does not appear to control ligand-mediated endocytosis because the
aggregation state is unaffected by the
-factor and because
endocytosis-defective mutant receptors are internalized when they are
associated with wild-type receptors.
-Factor receptors provide a
genetically tractable model to study the role that oligomerization
plays in the GPCR function.
| |
ACKNOWLEDGMENTS |
|---|
We thank Gul Bukusoglu, Amy Yang, Kimberly Schandel, Padhma Radhakrishnan, Tara Pellegrino, Pam Torrance, Jeremy Thorner, and Mike Tyers for providing plasmids and strains, and Pam Silver, Y.R. Yang, and H.K. Schachman for providing antibodies. We also thank Kimberly Schandel and Ching-Hung Shen for comments on the manuscript. This work was supported by Public Health Service research grant GM34719 from the National Institute of General Medical Sciences.
| |
FOOTNOTES |
|---|
* Corresponding author: E-mail address: duane.jenness{at}umassmed.edu.
| |
REFERENCES |
|---|
|
|
|---|
32.
J. Biol. Chem.
272, 30603-30606
-factor receptor of Saccharomyces cerevisiae.
J. Biol. Chem.
263, 10836-10842
-factor pheromone receptor.
Mol. Cell. Biol.
16, 4818-4823
opioid receptor: implication for a role in receptor internalization.
J. Biol. Chem.
272, 26959-26964
-factor receptor (Ste2p), a 7-transmembrane-segment G protein-coupled receptor.
J. Biol. Chem.
272, 15553-15561
-factor receptor contributes to the formation of preactivation complexes with its cognate G protein.
Mol. Cell. Biol.
20, 5321-5329
-factor receptor.
Mol. Cell. Biol.
18, 7205-7215
2-adrenergic receptor transmembrane domain inhibits both receptor dimerization and activation.
J. Biol. Chem.
271, 16384-16392
-factor receptor is required for its ubiquitination and internalization.
J. Biol. Chem.
141, 349-358
complex of the yeast pheromone response pathway. Subcellular fractionation and protein-protein interactions.
J. Biol. Chem.
272, 240-248
-factor pheromone receptors.
Mol. Cell. Biol.
17, 6236-6245
-factor pheromone receptor in S. cerevisiae.
Cell
46, 345-353[Medline].
-pheromone receptor.
Cell Regul.
2, 439-452[Medline].
-pheromone receptor mediates an adaptive response to pheromone.
Cell
54, 609-620[Medline].
-factor receptor is a regulatory domain.
Cell
55, 221-234[Medline].
-pheromone receptor in yeast.
Mol. Biol. Cell
4, 511-521[Abstract].
-factor pheromone receptor.
Mol. Cell. Biol.
14, 7245-7255This article has been cited by other articles:
![]() |
R. A. Arkowitz Chemical Gradients and Chemotropism in Yeast Cold Spring Harb Perspect Biol, August 1, 2009; 1(2): a001958 - a001958. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. U. Gehret, A. Bajaj, F. Naider, and M. E. Dumont Oligomerization of the Yeast {alpha}-Factor Receptor: IMPLICATIONS FOR DOMINANT NEGATIVE EFFECTS OF MUTANT RECEPTORS J. Biol. Chem., July 28, 2006; 281(30): 20698 - 20714. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Overton, S. L. Chinault, and K. J. Blumer Oligomerization of G-Protein-Coupled Receptors: Lessons from the Yeast Saccharomyces cerevisiae Eukaryot. Cell, December 1, 2005; 4(12): 1963 - 1970. [Full Text] [PDF] |
||||
![]() |
S. Wilson, G. Wilkinson, and G. Milligan The CXCR1 and CXCR2 Receptors Form Constitutive Homo- and Heterodimers Selectively and with Equal Apparent Affinities J. Biol. Chem., August 5, 2005; 280(31): 28663 - 28674. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T. Cao, A. Brelot, and M. von Zastrow The Composition of the {beta}-2 Adrenergic Receptor Oligomer Affects Its Membrane Trafficking after Ligand-Induced Endocytosis Mol. Pharmacol., January 1, 2005; 67(1): 288 - 297. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Milligan G Protein-Coupled Receptor Dimerization: Function and Ligand Pharmacology Mol. Pharmacol., July 1, 2004; 66(1): 1 - 7. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Chinault, M. C. Overton, and K. J. Blumer Subunits of a Yeast Oligomeric G Protein-coupled Receptor Are Activated Independently by Agonist but Function in Concert to Activate G Protein Heterotrimers J. Biol. Chem., April 16, 2004; 279(16): 16091 - 16100. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Lin, K. Duell, and J. B. Konopka A Microdomain Formed by the Extracellular Ends of the Transmembrane Domains Promotes Activation of the G Protein-Coupled {alpha}-Factor Receptor Mol. Cell. Biol., March 1, 2004; 24(5): 2041 - 2051. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Overton, S. L. Chinault, and K. J. Blumer Oligomerization, Biogenesis, and Signaling Is Promoted by a Glycophorin A-like Dimerization Motif in Transmembrane Domain 1 of a Yeast G Protein-coupled Receptor J. Biol. Chem., December 5, 2003; 278(49): 49369 - 49377. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hirota, K. Tanaka, K. Ohta, and M. Yamamoto Gef1p and Scd1p, the Two GDP-GTP Exchange Factors for Cdc42p, Form a Ring Structure that Shrinks during Cytokinesis in Schizosaccharomyces pombe Mol. Biol. Cell, September 1, 2003; 14(9): 3617 - 3627. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Overton and K. J. Blumer The Extracellular N-terminal Domain and Transmembrane Domains 1 and 2 Mediate Oligomerization of a Yeast G Protein-coupled Receptor J. Biol. Chem., October 25, 2002; 277(44): 41463 - 41472. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Parrish, M. Eilers, W. Ying, and J. B. Konopka The Cytoplasmic End of Transmembrane Domain 3 Regulates the Activity of the Saccharomyces cerevisiae G-Protein-Coupled {alpha}-Factor Receptor Genetics, February 1, 2002; 160(2): 429 - 443. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-J. Cheng and L. J. Miller Agonist-dependent Dissociation of Oligomeric Complexes of G Protein-coupled Cholecystokinin Receptors Demonstrated in Living Cells Using Bioluminescence Resonance Energy Transfer J. Biol. Chem., December 14, 2001; 276(51): 48040 - 48047. [Abstract] [Full Text] [PDF] |
||||
![]() |
G Milligan Oligomerisation of G-protein-coupled receptors J. Cell Sci., January 4, 2001; 114(7): 1265 - 1271. [Abstract] [PDF] |
||||
![]() |
M. McVey, D. Ramsay, E. Kellett, S. Rees, S. Wilson, A. J. Pope, and G. Milligan Monitoring Receptor Oligomerization Using Time-resolved Fluorescence Resonance Energy Transfer and Bioluminescence Resonance Energy Transfer. THE HUMAN delta -OPIOID RECEPTOR DISPLAYS CONSTITUTIVE OLIGOMERIZATION AT THE CELL SURFACE, WHICH IS NOT REGULATED BY RECEPTOR OCCUPANCY J. Biol. Chem., April 20, 2001; 276(17): 14092 - 14099. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Sloper-Mould, J. C. Jemc, C. M. Pickart, and L. Hicke Distinct Functional Surface Regions on Ubiquitin J. Biol. Chem., August 3, 2001; 276(32): 30483 - 30489. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Burchett, A. Scott, B. Errede, and H. G. Dohlman Identification of Novel Pheromone-response Regulators through Systematic Overexpression of 120 Protein Kinases in Yeast J. Biol. Chem., July 6, 2001; 276(28): 26472 - 26478. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Venkatesan, A. Petrovic, D. I. Van Ryk, M. Locati, D. Weissman, and P. M. Murphy Reduced Cell Surface Expression of CCR5 in CCR5Delta 32 Heterozygotes Is Mediated by Gene Dosage, Rather Than by Receptor Sequestration J. Biol. Chem., January 11, 2002; 277(3): 2287 - 2301. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Blanpain, J.-M. Vanderwinden, J. Cihak, V. Wittamer, E. Le Poul, H. Issafras, M. Stangassinger, G. Vassart, S. Marullo, D. Schlondorff, et al. Multiple Active States and Oligomerization of CCR5 Revealed by Functional Properties of Monoclonal Antibodies Mol. Biol. Cell, February 1, 2002; 13(2): 723 - 737. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||