![]() |
|
|
Vol. 11, Issue 9, 2933-2947, September 2000


§
and
*Department of Cell Biology, University of Virginia Health Sciences
Center; and
Department of Chemistry, University of
Virginia, Charlottesville, Virginia 22908
| |
ABSTRACT |
|---|
|
|
|---|
Secretory carrier membrane proteins (SCAMPs) are integral membrane
proteins found in secretory and endocytic carriers implicated to
function in membrane trafficking. Using expressed sequence tag database
and library screens and DNA sequencing, we have characterized several
new SCAMPs spanning the plant and animal kingdoms and have defined a
broadly conserved protein family. No obvious fungal homologue has been
identified, however. We have found that SCAMPs share several structural
motifs. These include NPF repeats, a leucine heptad repeat enriched in
charged residues, and a proline-rich SH3-like and/or WW domain-binding
site in the N-terminal domain, which is followed by a membrane core
containing four putative transmembrane spans and three amphiphilic
segments that are the most highly conserved structural elements. All
SCAMPs are 32-38 kDa except mammalian SCAMP4, which is ~25 kDa and
lacks most of the N-terminal hydrophilic domain of other SCAMPs. SCAMP4
is authentic as determined by Northern and Western blotting, suggesting
that this portion of the larger SCAMPs encodes the functional domain. Focusing on SCAMP1, we have characterized its structure further by
limited proteolysis and Western blotting with the use of isolated secretory granules as a uniformly oriented source of antigen and by
topology mapping through expression of alkaline phosphatase gene
fusions in Escherichia coli. Results show that SCAMP1 is degraded sequentially from the N terminus and then the C terminus, yielding an ~20-kDa membrane core that contains four transmembrane spans. Using synthetic peptides corresponding to the three conserved amphiphilic segments of the membrane core, we have demonstrated their
binding to phospholipid membranes and shown by circular dichroism
spectroscopy that the central amphiphilic segment linking transmembrane
spans 2 and 3 is
-helical. In the intact protein, these segments are
likely to reside in the cytoplasm-facing membrane interface. The
current model of SCAMP1 suggests that the N and C termini form the
cytoplasmic surface of the protein overlying a membrane core, which
contains a functional domain located at the cytoplasmic interface with
little exposure of the protein on the ectodomain.
| |
INTRODUCTION |
|---|
|
|
|---|
Secretory carrier membrane proteins (SCAMPs) are a family of
membrane proteins that were initially discovered as components of
regulated secretory carriers in exocrine, neural, and endocrine cells
(Brand et al., 1991
). Further characterization has indicated that the distribution extends more broadly to include most, if not all,
membranes that recycle between the cell surface and internal compartments, including early and late endosomes, Golgi-derived vesicles, membranes that circulate various transporters, and secretory granules and vesicles in hematopoietic cells (Brand and Castle, 1993
;
Laurie et al., 1993
; Brumell et al., 1995
; Haass
et al., 1996
; Singleton et al., 1997
; Wu and
Castle, 1997
, 1998
; Guo et al., 1998
). Although the function
of SCAMPs has not yet been identified, their concentration in recycling
carriers suggests that they serve a role in membrane trafficking or its
regulation. This possibility is supported by recent reports that
genetic ablation of SCAMP1 affects exocytosis and possibly endocytosis
(Fernandez-Chacon et al., 1999
, 2000
) and that conserved,
SCAMP-derived peptides are potent inhibitors of exocytosis (Guo
et al., 1998
).
SCAMPs have been classified as integral membrane proteins on the basis
that they are not extracted from membranes by alkaline sodium carbonate
and that they bind Triton X-114 detergent micelles and sediment during
phase separation (Brand et al., 1991
). Furthermore, hydropathy analysis has suggested that the SCAMPs may have four closely
spaced transmembrane spans that are located centrally in the sequence
(Brand and Castle, 1993
; Singleton et al., 1997
). Finally,
the mAb originally used to identify the SCAMPs, SG7C12, has a
cytoplasmically oriented epitope that is cleaved from purified intact
secretory granules by trypsin and also is quite effective for organelle
isolation by immunoadsorption (Brand et al., 1991
; Laurie
et al., 1993
).
In view of the growing interest in SCAMPs as prospective components of the membrane trafficking machinery, we have conducted a number of studies to define SCAMP organization within membranes in more detail and to identify what portions of the structure deserve closest scrutiny as prospective function-encoding domains. We have deduced the primary structures of several new SCAMPs, documenting their phylogenetic conservation across the plant and animal kingdoms and identifying highly conserved sequences that are hallmarks of the family. Among these new SCAMPs, we have demonstrated the existence of mammalian SCAMP4, a shorter (~25 kDa) SCAMP that is presumed to share the function of the longer (32-38 kDa) SCAMPs. Focusing on mammalian SCAMP1 as the prototype, we have used limited proteolysis and Western blotting to demonstrate the cytoplasmic orientation of its N- and C-terminal segments, the sequential cleavage within these segments that probably relates to protein folding, and the presence of a protease-resistant membrane core. We have gone on to map four transmembrane spans within the membrane core and have used synthetic peptides to evaluate the membrane binding of three cytoplasmically oriented amphiphilic segments that are also within the membrane core: one immediately preceding the first transmembrane span, one within the linker between transmembrane spans 2 and 3, and one immediately after the last transmembrane span. In combination, our data led to a model of the SCAMPs in which the N and C termini, particularly the extended N termini of longer SCAMPs, form a cytoplasmic surface overlying the membrane core with little exposure on the ectodomain. Because the membrane core alone is present in all family members, we infer that it is the functional domain and that its highly conserved amphiphilic segments may carry out an interfacial activity.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Expressed Sequence Tags from Genome Sequencing Projects and Full-Length cDNAs
Genomic sequencing projects have resulted in the submission of
several SCAMP homologues from a variety of eukaryotes. Novel SCAMP
homologues, in addition to the paralogues that we identified and
characterized previously (Singleton et al., 1997
), include SCAMPs in pig (SCAMP1; Wen et al., 1998
) and pea (Krajinski
et al., 1998
). Homologues in other species were
identified by using the rat SCAMP1 protein sequence as a query for
BLAST homology searches against the nonredundant nucleotide and
expressed sequence tag (EST) divisions of GenBank. A possible SCAMP
homologue was identified in chromosome I in Caenorhabditis
elegans, and a full-length cDNA was isolated from a C. elegans early embryo cDNA library constructed in
GT11.
Additional cDNAs encoding potential SCAMP homologues were identified as
EST sequences in Arabidopsis thaliana, Oryza
sativa (rice), Drosophila melanogaster, and Mus
musculus. These were sequenced in their entirety to identify
complete ORFs and are summarized in Table
1. Also, partial homologues were identified by sequence similarity from flounder, zebrafish,
Xenopus, and various plant EST databases (our unpublished
observations). Two additional SCAMP homologues were also identified
from the A. thaliana genome sequencing project. The
predicted reading frames identified by computer analysis of the BAC
clones for the GenBank entries indicated in Table 1 differ from those
presented in this work. The genomic nucleotide sequence was compared
with the cDNA sequence for the available Arabidopsis clone
to identify intron/exon boundaries resulting in an ORF more similar to
the previously obtained SCAMP sequences. The deduced protein sequences
from these sources were used for multiple sequence alignments by the
Pileup and Lineup programs in the GCG package (Genetics Computer Group, Madison, WI).
|
Antibodies
mAb 7C12 was generated and characterized as described previously
(Brand et al., 1991
; Brand and Castle, 1993
). Preparation and characterization of rabbit polyclonal anti-SCAMP1 antibodies against specific peptide sequences 1
(SDFDSNPFADPDLNN-NorLeu(C)), 1
(KKVHGLYRTTGASFEK), and 1
((C)TSAAQNAFKGNQM) were described previously (Wu and Castle, 1997
, 1998
). Rabbit polyclonal antibodies 1
, 1
, and 4
against the peptide sequences (C)KPTEEHPAYTQITK, CFYQDFSVDIPVEFQKTVK, and (C)LPE-YPTVPTVPSYS, respectively, were prepared by the same procedures as for 1
and 1
. The
peptides were conjugated to maleimide-activated keyhole limpet
hemocyanin (Imject, Pierce Chemical, Rockford, IL); injection and
antiserum collection were performed by Covance (Denver, PA); and
antibodies were affinity purified from sera on columns containing the
cysteinyl peptides coupled to Sulfolink resin (Pierce Chemical). In the case of the epitope peptide of 1
, which did not include a cysteinyl residue, the peptide was immobilized by succinimide ester-mediated coupling to Affigel (Bio-Rad, Richmond, CA). Standard low-pH elution procedures were used in all cases. A rabbit antibody against bacterial alkaline phosphatase was purchased from Eppendorf-5' (Boulder, CO).
RNA Preparation and Northern Analysis
Total RNA was prepared from NIH 3T3 cells with the use of Trizol (Life Technologies/BRL, Grand Island, NY). The RNA was electrophoresed on formaldehyde-impregnated agarose, transferred to reinforced nylon, and probed with the use of 32P-labeled cDNA in aqueous hybridization buffer and washed under normal stringency.
N-terminal Truncations of SCAMP1 Fused to GST and Epitope Analysis
Nested deletions were constructed by PCR with the use of an
N-terminal EcoRI/HindIII fragment encoding amino
acids 1-150 of the full-length rat SCAMP1 cDNA. The following sense
strand oligonucleotides were used to generate N-terminally truncated
versions of SCAMP1:
1, GGGAATTCTAAGAAATGTGCCACCG;
2,
GGGAATTCTAAGAACGCCTCCACCA;
3, GGGAATTCTAAA-AATGCCTAATGTA; and
4, GGGAATTCTAAAGCCGACCGAGGAG. In each case, the oligonucleotide was
designed to introduce an EcoRI site at the 5' end of the
product; the antisense oligonucleotide for PCR was in the polylinker of
the vector. PCR products encoding SCAMP truncations beginning with
residues R28, R44, K52, and K65 were subcloned downstream of GST in the
fusion protein vector pGEX-KG (Guo and Dixon, 1991
), and the resulting
plasmids were used to transform a protease-deficient strain of
Escherichia coli (BL21 DE3). Bacteria expressing the
N-terminal domain of SCAMP1 and the four truncations fused to GST were
prepared by standard procedures, which included a 2-h induction with 1 mM isopropylthio-
-galactoside followed by sonication in Tris buffer,
pH 8, containing proteinase inhibitors (1 mM PMSF, 1 mM
4-(2-aminoethyl)benzenesulfonylfluoride, 100 µM leupeptin, and
2 mM EDTA). Equal fractions of the purified fusion proteins were
subjected to SDS-PAGE and Western blotting on nitrocellulose (Singleton
et al., 1997
; Wu and Castle, 1997
).
ELISA of 7C12; Competition by SCAMP Peptides
Ninety-six-well plates were coated with 100 ng of SCAMP1 N-terminal domain and washed with PBS, 0.05% Tween 20. Stock solutions (1.1 mM) and serial dilutions of each SCAMP-derived peptide were prepared in blocking buffer (PBS, 0.05% Tween 20, 0.5 mg/ml gelatin, 0.2 mg/ml BSA, goat serum [final dilution, 12.5×], and 0.25 mM PMSF). Aliquots of the serial dilutions were mixed with 1 ng of 7C12 antibody, transferred to coated wells, and incubated for 2 h at room temperature. After washing, goat anti-mouse immunoglobulin G-peroxidase was used as secondary antibody, and peroxidase activity with the use of 2,2'-azino-bis(3-ethyl)benzthiazoline-6-sulfonic acid substrate was read at an absorbance of 414 nm.
Subcellular Fractionation and Proteolysis of Purified Secretory Granules
Secretory granules from rat parotid glands (8-12 glands from
four to six overnight-fasted rats per experiment) were purified with
the use of isoosmotic self-forming Percoll gradients as described previously (Zastrow and Castle, 1987
; Wu and Castle, 1997
). After collecting the granules from the bottom of the gradients, the samples
were diluted with three volumes of 0.3 M sucrose containing 2 mM MOPS,
1 mM EDTA, pH 6.7, pelleted (2000 × g, 25 min), and resuspended
in the same sucrose solution. An aliquot was immediately assayed for
protein content with the use of the bicinchoninic acid procedure
(Pierce Chemical) to standardize the amount of proteolytic enzyme to be
added to each digest. Aliquots of the granule suspension were incubated
with serial dilutions of proteolytic enzymes (trypsin or proteinase K)
for 2 h on ice. At the end of the incubation, proteinase
inhibitors (0.2 mg/ml lima bean trypsin inhibitor and 0.25 mM PMSF,
final concentrations) were added and the granules were pelleted by
centrifugation. Protein in the resulting supernatants and resuspended
pellets was assayed to calculate granule intactness after digestion.
Where appropriate, the protein values were corrected for added trypsin
inhibitor. Granules in the resuspended pellets were lysed by dilution
in hypoosmotic medium (50 mM NaHCO3, 1 mM EDTA,
0.25 mM PMSF), and the membranes were pelleted, resuspended, and
solubilized in sample buffer for electrophoresis. An equal fraction of
the total of each sample was subjected to SDS-PAGE and Western blotting
on nitrocellulose. Bound antibody was detected with the use of
peroxidase-conjugated secondary antibodies and enhanced chemiluminescence.
Generation and Analysis of SCAMP-PhoA Fusions
PCR-generated truncations of rat SCAMP1 coding sequence were subcloned into an expression vector encoding bacterial alkaline phosphatase (AP) as a C-terminal fusion partner. Briefly, pSM969 (a gift of Dr. S. Michaelis, Johns Hopkins University Medical School, Baltimore, MD) contains a lac promoter immediately upstream of the coding sequence for the Saccharomyces cerevisiae membrane protein STE6p, which is flanked by unique 5' BamHI and 3' NheI restriction sites. The coding sequence for AP (minus its signal sequence) lies ~10 codons downstream and is in frame with the NheI junction. Native SCAMP1 cDNA has unique BamHI and NheI sites 27 and 877 nucleotides downstream, respectively, from the start codon. Previously, we doubly mutagenized the cDNA to abrogate the endogenous BamHI site and to add a new one immediately upstream of the start codon (our unpublished results). This modified DNA was used as a template for PCR-based generation of 11 truncations of the coding sequence as well as one product encoding the full-length protein (truncations are identified in RESULTS). All products included the upstream BamHI site afforded by a common forward primer. The 10 shortest truncations were generated by reverse primers (all primers were from Operon Technologies, Alameda, CA), which placed an NheI site immediately downstream of the last codon. The eleventh truncation (residues 1-290) and full-length SCAMP1 (minus the stop codon) were engineered to contain an XbaI site downstream of the final codon, allowing eventual subcloning into the NheI site of pSM969. PCR products were ligated into either pCR-II TOPO (TOPO-TA) or pCR-II (TA) vectors (Invitrogen, Carlsbad, CA). All products were sequenced with the use of PCR/dye terminator chemistry followed by automated electrophoresis and analysis on an ABI PRISM TM 377 DNA Sequencer at the University of Virginia Biomolecular Research Facility (Charlottesville, VA). Upon confirmation of correct nucleotide sequences, PCR products were subcloned into the BamHI-NheI remnant of pSM969.
For evaluation of AP activity, all constructs were expressed in
E. coli strain UT5600 (number 7092, Yale E. coli
Genetic Stock Center, New Haven, CT), which is deficient in the
membrane-associated protease ompT. Our method was adapted from
previously described procedures (Manoil, 1991
; Geller et
al., 1996
). Cultures of transformants expressing the 12 SCAMP1/AP
constructs, as well as untransformed UT5600, were grown overnight at
37°C (16-18 h). Aliquots of each were diluted 50 times into fresh
medium, grown at 30°C until OD600
0.6 (~2.5 h), and then grown for another 2 h at 30°C in the presence of isopropylthio-
-galactoside (1 mM final concentration). Cultures were then chilled and maintained on ice. Aliquots were withdrawn for measurement of final OD600 and for
SDS-PAGE/Western blotting. For AP assay, 1-ml samples of each culture
were pelleted (three min at 2800 × g), washed once
with 1 ml of 10 mM Tris, pH 8.0, 10 mM MgSO4, 1 mM iodoacetic acid (IAA), washed twice with 1 ml of 1 M Tris, pH 8.0, 1 mM IAA, and then resuspended in 1 ml of the same buffer. Aliquots made
up to 1 ml and containing 1 M Tris, pH 8.0, 0.1 mM
ZnCl2, 1 mM IAA were mixed with 50 µl of 1%
SDS, incubated for 5 min at 37°C (to permeabilize cell walls), chilled to add 100 µl of 0.4% p-nitrophenylphosphate, 1 M
Tris, pH 8.0, and then incubated at 37°C until sufficient color
development was observed (usually 30 min). Reactions were stopped by
chilling and adding 120 µl of 1 M
K2HPO4 pH 8.0, 0.1 M EDTA,
and the samples were spun for 5 min at 12,000 × g
before reading OD420 on the supernatants.
Relative AP activities were calculated according to Brickman and
Beckwith (1975)
, normalizing for assay time. The relative AP values
were further normalized for differences in protein expression with the
use of quantitative densitometric data obtained from the Western blots
with the use of 125I-labeled secondary antibody,
phosphorimaging, and analysis with ImageQuant software (Molecular
Dynamics, Sunnyvale, CA).
Peptide Synthesis
A series of peptides based on the three amphiphilic
cytoplasmically localized segments that belong to the membrane core of SCAMP were synthesized and purified by the Biomolecular Research Facility at the University of Virginia, and the identity of each peptide was confirmed by mass spectrometry. The sequences of these peptides are listed in Table 2. Peptides
corresponding to the cytoplasmic segments preceding the first and
succeeding the last transmembrane helices were also synthesized with a
C-terminal cysteine residue. This facilitated the derivatization of
each peptide segment with the cysteine-specific methanethiosulfonate spin-label (MTSSL) shown in Scheme
1 to produce a series of
peptides with the labeled side chain R1.
|
|
Lipid Vesicle Preparation
1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphatidylcholine (PC) and
1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphatidylserine (PS) were
obtained from Avanti Polar Lipids (Alabaster, AL). Lipid mixtures
containing the desired molar ratio of PC and PS were produced by mixing
the appropriate lipid solutions in chloroform, removal of the solvent
by vacuum desiccation overnight, and hydration of the lipid film in a
buffer solution containing 100 mM KCl, 10 mM MOPS, pH 7. For electron
paramagnetic resonance (EPR) binding measurements, unilamellar vesicles
were then formed by freeze-thawing the suspension five times followed
by extrusion of the mixture through polycarbonate filters with a
0.1-µm pore diameter (Poretics, Livermore, CA) with the use of a
hand-held extruder (Avestine, Ottawa, Canada). For circular dichroism
(CD) measurements, the mixture was sonicated with the use of a probe
sonicator at 4°C for ~30 min to produce small 300-Å unilamellar
vesicles as described previously (Castle and Hubbell, 1976
).
Partition Coefficients Determined by EPR
The membrane binding of the SCAMP-derived peptides was
determined by EPR with the use of a procedure similar to that described previously (Archer et al., 1991
). Briefly, membrane-bound
and aqueous EPR spectra of a spin-labeled macromolecule exhibit
dramatically different line shapes because of the altered rotational
rates for the macromolecule in the two environments. If the
spin-labeled macromolecule partitions between the aqueous and membrane
phases, the resulting EPR spectrum is a sum arising from the spectra of membrane-bound and aqueous spin populations. As a result, the partitioning can then be determined accurately by quantitating the
aqueous and membrane populations from the composite EPR spectrum. This
method has been shown numerous times to be an accurate and reliable
approach to determine the membrane binding of peptides (Lewis and
Cafiso, 1999
; Victor et al., 1999
).
EPR spectra were obtained with the use of a Varian (Palo Alto, CA)
E-line Century series spectrometer fitted with a standard rectangular
TE102 X-band cavity with a microwave power of 10 mW and modulation amplitude of 1 gauss. Samples (100 µL) contained identical peptide concentrations (typically 20 µM) with varied concentrations of unilamellar lipid vesicles in buffer (100 mM KCl, 10 mM MOPS, pH 7.0). The peak-to-peak amplitude of the
mI=
1 resonance was recorded, and for each
spectrum the fraction of membrane-bound peptide was determined as
described previously (Cafiso and Hubbell, 1981
). The molar partition
coefficient K (units of M
1) was then
determined by fitting the data to the relationship:
|
(1) |
CD Spectroscopy
CD spectra of the three SCAMP peptides were obtained with the use of a Jasco (Easton, MD) J-720 spectropolarimeter with a 1-mm path length sample cell. Unless indicated otherwise, the following instrumental parameters were used: bandwidth, 2.0 nm; sensitivity, 100 mdeg; response time, 0.25 s; scan speed, 50 nm/s. Spectra were obtained over the range of 190-300 nm and were typically the sum of 10-20 scans. Sonicated lipid samples were used for these measurements to minimize the effects of light scattering, and peptides were added to a concentration of 20-40 µM.
| |
RESULTS |
|---|
|
|
|---|
Conserved Primary Structure of SCAMPs
Previously, we reported the amino acid sequences that were
conceptually translated from cDNAs for rat SCAMP1 and human SCAMPs 1-3
(Brand and Castle, 1993
; Singleton et al., 1997
). These
efforts provided the first indication that there are multiple
paralogues of SCAMPs within individual mammalian species, each deriving
from separate but related genes, and that sequence identity/similarity is >90% for particular paralogues compared between different mammals but ~60% between distinct paralogues of the same species. The multiple genome sequencing projects and databases of ESTs have now made
it possible to search for SCAMPs in several different organisms
spanning the plant and animal kingdoms. A representative set of those
we have characterized is presented in Figure
1. We have obtained a variety of cDNAs
from the EST sources and have used them either directly for sequencing
or for library screening to obtain cDNAs encoding full-length
polypeptides for sequencing. Pairwise multiple sequence alignment
produces a dendrogram that recapitulates the evolutionary relationship
between the individual species in which SCAMP homologues have been
identified (Figure 1A). Multiple SCAMP paralogues have been found in
vertebrate species, and the A. thaliana genome and various
plant sequencing projects suggest that individual types of plants also
have multiple SCAMPs. However, invertebrate genome sequencing projects
(C. elegans and D. melanogaster) have indicated only a
single SCAMP locus in each species. Significantly, no homologous
sequences have been identified so far in fungi from the completed
S. cerevisiae genome and the essentially completed
Schizosaccharomyces pombe and Candida
albicans genomes.
|
Aligned sequences demonstrate the highly conserved domain structure of
the SCAMP family (Figure 1, B and C). All SCAMP family members share a
common central core domain that includes four predicted transmembrane
spans of similar length and conserved amino acid sequence (Figure 1C,
blocks TM1-TM4). Loops between the transmembrane spans are also
conserved in length, and the amino acid sequence linking spans 2 and 3 (Figure 1C, block E, sequence [199]FVCWYRPLYGAFRSDSS[215] in rSC1)
is especially conserved in all SCAMP homologues examined. In addition,
sequences preceding and succeeding the first and last transmembrane
spans (Figure 1C, blocks D and F, respectively) are quite similar
across the different SCAMPs, particularly in their amphiphilic
character, and contribute to the conserved core domain. Preceding block
D is a proline-rich segment having a resemblance to both an SH3-binding motif (PXXP) and a WW domain-binding motif (PPXY) (Sudol, 1996
) (Figure 1C, block C) that is again highly conserved in all SCAMPs. With
the exception of the shorter mSC4 (and a newly identified rodent SCAMP5
[GenBank accession numbers AAF64491 and AAF64466] and a zebrafish
EST), all homologues have two other types of conserved segments (Figure
1C, blocks A and B) that are located in the N-terminal domain upstream
from the conserved core. Block A indicates that longer SCAMPs all have
either two or three NPF repeats that begin near the N terminus and are
potential binding sites for EH domain-containing proteins (Salcini
et al., 1997
; Paoluzi et al., 1998
). Block B identifies a predicted helical segment that is characterized by a
heptad repeat of aliphatic amino acids and intervening charged residues
that appear organized in positive and negative rows along the surface
(Brand and Castle, 1993
). The C-terminal domain succeeding the
conserved core of the SCAMPs is shorter than the N-terminal domain
preceding the core. Beyond block F (Figure 1C), the primary structure
is more variable (as for the segment between blocks A and B), although
several of the homologues (human, rodent [except mSC4], fly,
nematode, and plant) have an alanine-rich segment (Figure 1C, block G)
either immediately before (animal) or at (plant) the C terminus.
Authenticity of SCAMP4
The attenuated N-terminal domain of mSC4 that was deduced by
conceptual translation of the cognate cDNA differed from that of the
other SCAMPs that we have characterized more thoroughly. Therefore, we
sought to confirm that this SCAMP was both authentic and expressed. As
shown in Figure 2A, we detected an
~2.1-kilobase (kb) RNA by Northern blotting of total RNA from mouse
NIH 3T3 cells. The cDNA used to probe the Northern blot was ~1.8 kb,
consistent with the possibility that it encodes a full-length SCAMP
polypeptide. Using an antibody raised to a peptide that corresponds to
a unique segment near the C terminus of the deduced sequence of SCAMP4, we identified a polypeptide of Mr ~ 25,000 by Western blotting (Figure 2B). The polypeptide is widely
expressed, and its size matches that deduced by conceptual translation
of the cDNA.
|
Location of the Epitope for mAb 7C12
Trypsinization of intact secretory granules abolished detection of
SCAMPs 1 and 2 by Western blotting with the use of mAb 7C12, suggesting
the presence of the epitope in one of the two extended hydrophilic
domains forming N- and C-terminal segments of the full-length
polypeptide (Brand and Castle, 1993
). To locate the epitope, we
inserted portions of the SCAMP1 cDNA corresponding to the first 149 amino acids and the final 53 amino acids into the pGEX-KG vector and
expressed the GST fusion proteins in E. coli (BL21 DE3).
Western blotting of bacterial lysates indicated that the epitope was
present in the N-terminal segment. We then prepared a series of
N-terminal truncations of SCAMP1 in the GST chimeras, which initiated
the SCAMP1 sequence at residues R28, R44, K52, and K65 (Figure 1).
Western blots of bacterial lysates showed that the 7C12 epitope was
detected in the chimeras beginning at the authentic N terminus and at
R28 but not in the shorter residues (Figure
3A). The level of expression of each of
the chimeras was normalized by blotting with an anti-peptide antibody
(1
) whose epitope is made up of residues 65-78 (KPTEEHPAYTQITK) of SCAMP1. Use of 125I-labeled secondary antibodies
and quantitation of antibody binding by phosphorimaging demonstrated
that the ratio of 7C12/1
binding decreased by 65-70% as a result
of the first N-terminal deletion. Thus, we concluded that the epitope
of the mAb was likely to include portions of the sequence between
residues 1-28 and 28-43 but nothing closer to the C terminus.
|
To characterize the epitope further, we examined the ability of
selected synthetic peptides to compete the binding of 7C12 antibody to
the N-terminal (149-residue) segment of SCAMP1 as detected by ELISA.
Four peptides proved to be useful for this purpose. Peptide 1 (SDFDSNPFADPDLNN) contains residues 2-16 at the N terminus of SCAMP1.
Peptide 2 (VPPGLDEYNPFSDSR) corresponds to residues 30-44, the peptide
determined above to contain the most distal portion of the epitope.
Peptide 3 (LDEYNPFSDSR) is a truncation of peptide 2 lacking the
N-terminal VPPG residues. Peptide 4, residues 65-78 of SCAMP1, is the
epitope of anti-peptide antibody 1
(identified above) and
served as a control. As shown in Figure 3B, peptides 1, 2, and 3 all
competed antibody binding to immobilized antigen with half-maximal
decreases in peroxidase activity at concentrations of 8, 3.5, and 2 µM, respectively, whereas the fourth peptide did not
compete. Comparison of the sequences indicates that NPFXD is the common
element in peptides 1-3 and is likely to be largely responsible for
competing antibody binding. This possibility would also explain the
results shown in Figure 3A in that the removal of two of the three
NPFXD motifs would reduce antibody binding by two-thirds. However, the
epitope may be more complex than the simple linear sequence for at
least two reasons. First, 7C12 does not bind to nonmammalian SCAMPs (e.g., C. elegans SCAMP) that contain NPFXD motifs
(our unpublished results). Second, the original antigen used to
generate 7C12 was a preparation of purified granule membranes that were
treated with sodium carbonate but were not otherwise denatured (Brand et al., 1991
). Thus, the epitope may involve higher-order
structure within the N-terminal NPFXD-containing region. For the
purpose of these studies, however, the important observation is that
the peptide segment between residues 30 and 44 of SCAMP1 defines the C-terminal limit of the antibody's epitope.
Organization of SCAMP1 as Examined by Limited Proteolysis and Western Blotting
In addition to mAb 7C12, which binds mammalian SCAMPs 1-3
(Singleton et al., 1997
), we have generated a series of five
antibodies against peptides that correspond to sequences in SCAMP1. The
antibodies are identified as 1
, 1
, 1
, 1
, and 1
; the
epitopes of the first three are located in the N-terminal hydrophilic
domain of SCAMP1 preceding the first putative transmembrane domain, and those for the last two are located in the C-terminal hydrophilic domain
succeeding the last putative transmembrane domain. Their positions and
the deduced location of the 7C12 epitope are indicated in the cartoon
shown in Figure 4 (bottom panel). To
determine how the hydrophilic terminal domains of SCAMP1 are positioned in relation to the membrane, we conducted a limited proteolysis study
on purified parotid secretory granules, a source of SCAMP1 that is
expected to be uniformly oriented with respect to the membrane. The
purified secretory granules were resuspended in buffered isoosmotic
sucrose, assayed for protein, and incubated with enzymes as specified
in MATERIALS AND METHODS. After digestion and subsequent addition of
proteinase inhibitors, the samples were processed further by pelleting
granules to determine intactness and by lysis to prepare membranes for
SDS-PAGE and Western blotting. Blotting with the antibodies 1
, 7C12,
1
, 1
, and 1
was performed on separate blots of the digestion
series for each antibody. Antibody 1
worked poorly for Western
blotting and was used only for immunoadsorption to confirm the presence
of the epitope in the trypsin-insensitive domain of membrane-associated
SCAMP1.
|
The essential results of the enzymatic digestion study are shown in
Figure 4 and were reproduced in four experiments conducted with
different preparations of granules. Digestion of SCAMP1 with trypsin
appeared to proceed stepwise beginning with the N terminus. As the
amount of enzyme was increased in orders of magnitude from 10
5 to 10
2 mg/mg
granule protein, the epitopes of 1
, 7C12, and 1
(Figure 4, A-C,
respectively) were cleaved in order, generating a descending ladder of
lower Mr fragments. The epitope of
1
at the C terminus of SCAMP1 mostly persisted on an
Mr ~21,000 fragment after almost complete cleavage of the N terminus with 10
3 mg
trypsin/mg protein (Figure 4E). However, this epitope was removed by
10
2 mg trypsin/mg protein, leaving an
Mr 19,000-20,000 fragment detected by
1
that appears refractory to further trypsin cleavage (Figure 4D).
This trypsin-insensitive portion of SCAMP1 could be immunoadsorbed by
1
after solubilization from the digested sample in RIPA buffer and
was detected by immunoblotting with 1
(Figure 4F).
Thus, the trypsin-resistant core of SCAMP1 corresponded to the putative transmembrane domains and flanking peptide segments. Using the primary
sequence of SCAMP1 and the apparent molecular weight changes for each
cleavage product, we have deduced six successive sites of
trypsinization, which are identified as T1-T6 in the
bottom panel of Figure 4. The probable cleavage sites are: T1 at R28, T2 at either K52 or K65, T3 at KR89/90, T4 at K117, T5 at K311, and T6
at K298. The trypsin-resistant core, residues 118-298, has a
calculated Mr of 20,946, in agreement
with the final trypsin-resistant band observed in Figure 4D. Two other
observations are noted from the trypsin digestion series. First, SCAMP2
(apparent Mr 39,000), which is also
present in secretion granule membranes, was detected only by 7C12
(Figure 4B). The relative resistance of the N terminus of SCAMP2 to
trypsinization compared with SCAMP1 is likely to reflect the absence of
appropriate K and R residues in the N-terminal domain in SCAMP2, which
is more acidic than SCAMP1 (Singleton et al., 1997
). Second,
in the 1
and 1
trypsin series (Figure 4, A and E), a small
fraction of SCAMP1 appeared to be refractory to digestion, as detected
by our strongest antibodies. We assume that this antigen is associated
with vesicular contaminants in the granule fraction (possibly having
inside-out orientation, as discussed below) in which the SCAMP is inaccessible.
Digestions with proteinase K (PK) supported and extended the results
obtained with trypsin. At moderate levels of PK (0.4 µg/mg granule
protein), the same-sized cleavage product
(Mr 19,000-20,000) containing the
1
epitope but not the 1
, 1
, and 1
epitopes, as with the
largest amount of trypsin tested, was observed (Figure 4, A and D).
More significantly, 2.5-fold more PK (10
3 mg/mg
protein) abolished binding to the 1
epitope (Figure 4D). For all of
the digested samples except for 10
3 mg PK/mg
protein, granule intactness after digestion ranged from 90 to 94%, the
same as in control samples that were incubated without enzymes. At
10
3 mg PK/mg protein, granule integrity
decreased to 84-85%, which, although lower, still suggested that to a
good approximation all cleavages occurred from the cytoplasmic side of
the granule membrane. This deduction was also supported indirectly by
other experiments in which efforts to digest SCAMPs on the ectoplasmic
surface during cycling to the plasma membrane of insulin-stimulated
adipocytes were uniformly unsuccessful (T. Wu and D. Castle,
unpublished results). Together, the results obtained with the use of
proteolytic digestion suggest that the N-terminal hydrophilic domain of
SCAMP1 forms the cytoplasmic surface of the folded protein, extending over much of the C-terminal hydrophilic domain, which is
cytoplasmically oriented, and the protease-resistant core, which
includes the putative transmembrane spans and flanking sequences.
Presence of Four Transmembrane Spans in SCAMP1
The identification of cytoplasmically oriented N and C termini for
SCAMP1 by limited proteolysis indicated that as an integral membrane
component, the polypeptide must have an even number of transmembrane
spans. To explore the topology further, we assumed that the original
hydropathy plot (Brand and Castle, 1993
) correctly predicted four
transmembrane spans, and we attempted to tag the putative ectodomain
loops between transmembrane spans 1/2 and 3/4 of SCAMP1 by myc epitope
insertion (Borjigin and Nathans, 1994
). However, in both cases, the
SCAMP expressed from the recombinant DNAs appeared to accumulate in the
endoplasmic reticulum and nuclear envelope as judged by
immunofluorescent staining, suggesting that tagging at these internal
sites in the primary structure induced misfolding. As an alternative
approach, we chose to map the transmembrane topology with the use of AP
gene (PhoA) fusions expressed in E. coli (Manoil,
1991
). Prokaryotic AP correctly folds and is active only when exported
to the periplasm, and in chimeras with integral membrane proteins, AP
activity is observed with odd numbers of transmembrane spans. This
approach has been used widely to map the topology of prokaryotic and
eukaryotic membrane proteins that span the bilayer multiple times
(reviewed by Traxler et al., 1993
), and it reproduces the
topologies determined in eukaryotic cells (Geller et al.,
1996
).
We constructed 12 chimeras in which cDNAs encoding N-terminal segments
of SCAMP1 of increasing length were fused upstream of PhoA in place of
sequence encoding the AP signal sequence. The C-terminal residue of the
SCAMP1 portion of each chimera is identified in Figure
5A, illustrating its position in relation to the putative transmembrane spans. The chimeras include fusion sites
near the C-terminal end of each hydrophilic domain (Boyd et
al., 1993
) of SCAMP1 as well as more proximal fusion sites within
each hydrophilic segment. After transformation and induction of
expression, the relative steady-state levels of each chimera were
assessed by quantitative Western blotting with the use of 125I-labeled secondary antibody. As shown in
Figure 5B, chimeric polypeptides of the appropriate size were detected
in each sample, and steady-state levels of expression in almost all
cases differed by a factor of 4 or less. The exceptions are chimeras
241 and 250, in which the levels were 13-fold and 7-fold less,
respectively, than the maximum (chimera 338). Comparable relative
levels of expression (all within a factor of 5) were quantitated from a separate Western blot with the use of anti-AP antibody in place of
anti-SCAMP. The results of the AP assays, after subtracting the
background activity of nontransformed cells (1% of maximum activity
observed) and normalizing for level of expression, are shown in Figure
5C. Enzyme activity is either very high or essentially background.
Because of this clear outcome and the relatively similar steady-state
levels observed for all of the chimeras, we believe that our results
are not likely to be affected by any differences in stability among the
chimeras in E. coli. Therefore, we have normalized activity
to the steady-state level and not to the rate of biosynthesis (Calamia
and Manoil, 1990
; Geller et al., 1996
) in Figure 5C.
|
The two peaks of enzyme activity flanked by three background levels
observed in Figure 5C indicate a four-transmembrane topology for SCAMP1
in which the N- and C-terminal segments and the loop between
transmembrane spans 2 and 3 are protoplasmic (cytoplasmic) and the
loops between spans 1 and 2 and between spans 3 and 4 are periplasmic
(ectoplasmic). Only one chimera (286) resulted in an orientation of AP
that was opposite what was predicted. We believe that this outcome
occurred because the SCAMP1 portion of this chimera terminated after a
hydrophobic segment and thereby lacked the basic amino acids needed to
create a strong topogenic signal that would maintain the subsequent AP
in the protoplasm. Indeed, chimera 290, four residues more distal,
gives the expected orientation, which is in agreement with the
cytoplasmic orientation of the antibody 1
epitope (which includes
residues 286 and 290) that was observed by limited proteolysis (Figure
4). Also, there is precedence for the anomalous orientation of AP
fusions when chimeras are made immediately C terminal to hydrophobic
segments (Calamia and Manoil, 1990
). Therefore, our data strongly
support a four-transmembrane-span topology of SCAMP1, as diagrammed in Figure 5A.
Membrane Binding and Secondary Structure of Synthetic Peptides Corresponding to Conserved Amphiphilic Segments within SCAMP1's Membrane Core
The three cytoplasmically oriented segments
just preceding the
first transmembrane span, linking transmembrane spans 2 and 3, and just
succeeding the last transmembrane span
within the conserved core of
SCAMP have sequences that include nonpolar and polar residues and are
consistent with forming amphiphilic structures that associate with the
membrane interface. To test whether these segments have an affinity for
membranes independent of their adjacent transmembrane tethers, we
examined membrane binding of the corresponding synthetic peptides
(Table 2) that were derivatized by spin-labeled side chain R1 (see
MATERIALS AND METHODS) by EPR spectroscopy. Shown in Figure
6A are plots of the fraction of peptide
bound as a function of the accessible lipid concentration, along with fits of the data to Equation 1 (above). Because the peptides are unlikely to be membrane permeable, the accessible lipid concentration is taken as the external vesicle lipid concentration (or one-half the
total lipid concentration of the extruded vesicles). A summary of the
binding constants obtained is given in Table
3. Although all three peptides bind to
lipid bilayers, peptide E, which forms the linker between the second
and third transmembrane segments, shows the greatest membrane affinity.
In the presence of PC alone, the peptide has a modest membrane affinity
that increases by approximately 2 orders of magnitude in the presence
of PS. The binding of peptide E is estimated to be at least
104 M
1 in the presence of
25 mol% PS, and >90% of the peptide is bound at lipid concentrations
of ~1 mM. This increase in affinity in the presence of PS is
consistent with an electrostatic attraction of the basic peptide to the
acidic phospholipid surface, and similar binding increases have been
seen for other basic peptides that interact with membranes containing
acidic lipid (see, for example, Buser et al., 1994
).
|
|
Compared with peptide E, peptides D and F show a more modest membrane affinity, with peptide F achieving 50% binding at ~20 mM lipid and peptide D reaching 50% binding at ~50 mM lipid in PC/PS mixtures. Unlike peptide E, neither peptide D nor peptide F shows a strong preference for PC/PS- versus PC-containing membranes. This is consistent with the low net charge on peptide D, but it is somewhat surprising for peptide F, which has a net valence of +4 and should have a significant electrostatic attraction in the presence of PS.
The CD spectrum for peptide E was examined in buffer as well as in the
presence of PC and PC/PS. Although peptide E assumes a largely random
configuration in buffer, binding of the peptide to lipid vesicles is
accompanied by an increase in helical content (Figure 6B). In the
presence of PC/PS under conditions in which the peptide is almost
completely membrane-associated, peptide E is estimated to have between
20 and 30% helical content based on the molar ellipticity at 222 nm
(Luo and Baldwin, 1997
). Peptides D and F are also in a random
configuration in buffer, but they exhibit CD spectra that are
indicative of
-structure in the presence of lipid bilayers (our
unpublished observations). However, the decreased membrane affinity of
these peptides makes a structural assessment by CD difficult, because
the lipid concentration required to achieve substantial peptide binding
results in severe light scattering.
Given the high membrane affinity of peptide E and its attachment to two
transmembrane spans in the full-length polypeptide, it is almost
certainly an interfacial segment in intact SCAMP. When modeled as a
helix, the segment is highly amphipathic, and the isolated peptide has
significant helical content when membrane bound. Thus, we believe that
the behavior of the isolated peptide provides strong evidence that this
segment of SCAMP has an interfacial location and helical configuration.
For peptides D and F, our information is not adequate to make
structural predictions with regard to intact SCAMP; however, these
segments are also likely to have an interfacial location. Because they
are tethered to the membrane interface in the intact protein, they
experience a greater effective membrane concentration in the intact
protein than they do as isolated peptide fragments. As a result, the
modest membrane affinities for the isolated peptides are significant in
the context of the intact protein. With the use of a simple "ball-and-chain" model (Kim et al., 1994
), it is easy to
show that these tethered segments will experience a membrane
surface-to-aqueous volume ratio that is several orders of magnitude
greater than the vesicle surface-to-aqueous volume ratio at the highest
lipid concentrations used in these experiments. Thus, peptides D and F
will be bound within the interface if they are not complexed within the
protein. Such interfacial association is consistent with our trypsin
digestion study (Figure 4), in which peptides D and F were not cleaved
from the membrane core despite containing lysine residues at their
junctions with the transmembrane spans.
| |
DISCUSSION |
|---|
|
|
|---|
Our studies have substantially extended current knowledge about
the broad distribution of SCAMPs in the animal and plant kingdoms and
have identified the structural features within the polypeptide that
serve as signatures for the family. SCAMPs are expressed in a range of
metazoans including nematodes, insects, fish, frogs, and mammals, and
in both monocot and dicot plants. Furthermore, our studies mostly in
mammals have indicated that SCAMPs are detected in every cell type
examined except mature erythrocytes. Conservation of this magnitude
raises the possibility that SCAMPs perform a ubiquitous role in
vesicular trafficking in post-Golgi compartments, where they are mostly
concentrated. Interestingly, intersectin and
-synergin, proteins
thought to function in endocytosis and trafficking from the
trans-Golgi network, respectively (Hussain et
al., 1999
; Page et al., 1999
), have been identified
recently as prospective binding partners for SCAMP1 (Fernandez-Chacon
et al., 2000
). Although it is tempting to view these
interactions, which appear to involve binding to the NPF repeats of
SCAMP1, as a possible reflection of a general role in trafficking, we are reminded that this interaction might relate more to the binding and
relocation of selected SCAMPs, in analogy with the role of NPFXD as a
trafficking ligand for selected receptors in yeast (Tan et
al., 1996
). At present, we are hesitant to suggest that SCAMP
function is essential for two reasons. First, unlike other proteins
that are currently regarded as essential for the operation of vesicular
trafficking, we have been unable to identify a prospective SCAMP
homologue from the genome-sequencing projects in three different types
of yeast. The absence of an obvious yeast homologue may suggest that
SCAMPs serve a regulatory function that is observed only in
multicellular eukaryotes (Sugita et al., 1999
). On the other
hand, there are well-known cases in which proteins that have the same
function in vesicular trafficking in yeast and mammals have no
detectable primary sequence identity in the two organisms (e.g.,
phosphatidylinositol transfer protein [Phillips et
al., 1999
]). Thus, a functional homologue of SCAMPs may still be
identified in yeast. Second, genetic ablation of SCAMP1 is not lethal
(Fernandez-Chacon et al., 1999
), even though this SCAMP is
by far the most prevalent SCAMP detected in brain tissue (Singleton
et al., 1997
). Again, however, it is possible that a yet to
be characterized SCAMP (e.g., SCAMP4, SCAMP5) or some other functional
homologue may cover for the loss of SCAMP1, and neither of the negative
findings rule out the possibility that SCAMPs may perform a key role in trafficking.
As a part of this study, we have now confirmed the original prediction
(Brand and Castle, 1993
) that SCAMP1 is an integral protein that spans
membranes four times with cytoplasmically oriented N- and C-terminal
domains. This topology is the same as that of at least three other
mammalian membrane protein families: the tetraspanin superfamily
(Maeker et al., 1997
), the physins (synaptophysin, synaptoporin, pantophysin, and synaptogyrin), and connexins (Kumar and
Gilula, 1986
; Knaus et al., 1990
; Kanter et al.,
1994
; Leube, 1994
; Stenius et al., 1995
). However, at
several levels, the structural organization of the SCAMPs sets them
apart from each of these other families. First, the transmembrane spans
are spaced very differently. In SCAMPs, they are quite closely bunched
with interconnecting segments that are all less than 20 residues long.
Tetraspanins have one and physins and connexins each have two
ectodomain loops connecting the transmembrane spans that are
30
residues long. Although the single endodomain loop between
transmembrane spans 2 and 3 in tetraspanins and physins is short, as it
is in SCAMPs, the loop in connexins is very extended. Second, the
closely linked transmembrane spans in SCAMPs are situated between
extended N- and C-terminal domains. All three of the other families
have much shorter N-terminal domains, and the C-terminal domains of
tetraspanins and one of the physins, pantophysin, also are shorter.
Although the C-terminal domains of synaptophysin, synaptoporin,
synaptogyrin, and the connexins are extended like those of SCAMPs, the
primary structures are not similar, especially in the case of the
physins, which have several repeats rich in D, P, and Y residues.
Third, SCAMPs are not glycosylated and do not contain disulfide bonds in ectodomains. Tetraspanins and physins are predicted to contain both
of these features (Johnston et al., 1989
; Johnston and
Sudhof, 1990
; Maeker et al., 1997
), and both ectodomain
loops of connexins contain multiple cysteines, which would be
compatible with the formation of disulfide bonds. Additionally, the two
ectodomain loops of the SCAMPs are likely to be situated close to or
within the membrane interface, the first loop being extremely short and the second being amphiphilic.
Although the structural organization of SCAMPs contrasts substantially
with that of tetraspanins, physins, and connexins, it appears much more
similar to the organization of the yeast proteins Sft2p and Got1p
(Conchon et al., 1999
). Both yeast proteins have the same
membrane topology as the SCAMPs, and like SCAMPs, their transmembrane
spans are concentrated within <130 residues of the entire sequence and
encompass the most conserved portion of the primary structure.
Furthermore, the length and composition of the transmembrane spans of
SCAMPs and Sft2p and Got1p are fairly similar. Although the segments
connecting the transmembrane spans in both Sft2p and Got1p are
predicted to be even shorter than in the SCAMPs, the cytoplasmic
segment connecting spans 2 and 3 shares a similar positively charged
and amphiphilic character with a segment that is highly conserved in
the SCAMPs. The close succession of transmembrane spans within the
primary structure implies that the spans, which by their length are
probably helices, are closely situated to one another within the
membrane interior. This organization would result in a rather compact
structure for the membrane core (as envisioned in our model of SCAMP1;
Figure 7). Interactions among
transmembrane spans or the flanking segments may contribute to the
oligomerization of SCAMPs (Wu and Castle, 1997
), including SCAMP4 (our
unpublished observations). The possible resemblance of SCAMPs to Sft2p
and Got1p leads us to suggest that the function of SCAMPs may be more
similar to that of these yeast proteins than to the functions of
tetraspanins, physins, and connexins. Both Sft2p and Got1p interact
genetically with syntaxin family proteins (Banfield et al.,
1995
; Conchon et al., 1999
), and they are thought to promote
fusion in endosome/Golgi and ER/Golgi transport, respectively (Conchon
et al., 1999
). Quite strikingly, a similar role has been
proposed for SCAMP1 based on the results of a gene knockout in mice in
which a potential defect in achieving a stable fusion pore during
exocytosis was identified (Fernandez-Chacon et al., 1999
).
Thus, although both Got1p and Sft2p are similar to each other and to
homologues of higher eukaryotic (including mammalian) polypeptides
(Conchon et al., 1999
), the SCAMPs, which may be more
distantly related, may either substitute or collaborate in the same
process.
|
We have used the results of the present studies to construct a
speculative model of the structure of SCAMPs (Figure 7). The N-terminal
segment, which is readily and progressively proteolyzed by trypsin
(Figure 4), constitutes the most accessible portion of the cytoplasmic
surface of the protein. The C-terminal cytoplasmic segment, although
exposed on the surface, contains tryptic sites that may be occluded by
the more proteolytically accessible N terminus. The clustered
transmembrane spans, their linkers, and the interfacial segments that
flank the spans on the cytoplasmic surface together make up most of the
protease-resistant core of SCAMP (Figure 4). We regard this core as
SCAMP's functional domain based on the extensive conservation of
sequence and spacing within this region (Figure 1) and especially on
the existence of SCAMP4, an authentic SCAMP (Figure 2) that is mainly
made up of the core (Figure 1). If SCAMP's core is indeed the
functional domain of the protein, it seems quite reasonable to regard
the N-terminal domain found on most SCAMPs as a regulatory domain. The
conserved NPF repeats at its surface are prospective ligands for an EH
domain-containing protein (Salcini et al., 1997
; Paoluzi
et al., 1998
), and binding at these sites, e.g., by
intersectin,
-synergin, or other EH domain-containing proteins, may
be required to activate the function of SCAMPs. In the inactive state,
we envision that SCAMPs may be tightly folded such that the conserved
and highly charged leucine heptad repeat interacts with the conserved
amphiphilic helices located at the membrane interface. Thus, activation
would entail binding to NPF repeats and unfolding the compact
structure, thereby freeing the functional domain. Because SCAMP4 lacks
most of the N-terminal domain, we speculate that it may be a
constitutively active SCAMP. Alternatively, its activity (as well as
that of the other SCAMPs) may be controlled by protein interactions at the conserved proline-rich SH3-like (and/or WW domain) binding site
that precedes the SCAMP core. This model serves as a basis for several
structural and functional predictions that need to be tested in future
studies, particularly with respect to interactions with membrane fusion
machinery and facilitation of interactions and reorganization of the
lipid bilayers during the fusion event.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to Erin Code for generating and initially characterizing the GST-SCAMP chimera encoding the full N terminus of SCAMP1. We are also grateful to Dr. Susan Michaelis for providing E. coli strain UT5600, the phoA-encoding plasmid, and for helpful advice in conducting the topology analysis by means of the gene fusion approach. We thank Dr. Anna Castle for helpful advice and assistance with experiments, Dr. Yongde Bao (University of Virginia Biomolecular Research Facility) for exceptional efforts in DNA sequencing, and Amy Huang for help in preparing illustrations. These studies were supported by grant DE09655 from the National Institutes of Health (NIH), and D.S. gratefully acknowledges postdoctoral support initially from NIH training grant T32 DK07646 and subsequently from an a National Research Service award (F32 DE05680) from the NIH.
| |
FOOTNOTES |
|---|
Present addresses:
Department of Pathology,
University of Virginia Health Sciences Center, Charlottesville, VA
22908;
§Department of Biophysics, University of
California at Irvine, Irvine, CA 92717.
Corresponding author. E-mail address:
jdc4r{at}virginia.edu.
| |
REFERENCES |
|---|
|
|
|---|
-galactosidase gene fusions.
Methods Cell Biol.
34, 61-75[Medline].
-Synergin: an EH domain-containing protein that interacts with
-adaptin.
J. Cell Biol.
146, 993-1004This article has been cited by other articles:
![]() |
G. H. Diering, J. Church, and M. Numata Secretory Carrier Membrane Protein 2 Regulates Cell-surface Targeting of Brain-enriched Na+/H+ Exchanger NHE5 J. Biol. Chem., May 15, 2009; 284(20): 13892 - 13903. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. L. Aoh, A. M. Castle, C. H. Hubbard, O. Katsumata, and J. D. Castle SCAMP3 Negatively Regulates Epidermal Growth Factor Receptor Degradation and Promotes Receptor Recycling Mol. Biol. Cell, March 15, 2009; 20(6): 1816 - 1832. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Han, T. Chen, M. Yang, N. Li, H. Liu, and X. Cao Human SCAMP5, a Novel Secretory Carrier Membrane Protein, Facilitates Calcium-Triggered Cytokine Secretion by Interaction with SNARE Machinery J. Immunol., March 1, 2009; 182(5): 2986 - 2996. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhao, X. Zheng, X. Yuan, L. Wang, X. Wang, Y. Zhong, Z. Xie, and T. Tully ben Functions with Scamp during Synaptic Transmission and Long-Term Memory Formation in Drosophila J. Neurosci., January 14, 2009; 29(2): 414 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Chen, P. J. Ulintz, E. S. Simon, J. A. Williams, and P. C. Andrews Global Topology Analysis of Pancreatic Zymogen Granule Membrane Proteins Mol. Cell. Proteomics, December 1, 2008; 7(12): 2323 - 2336. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gonzalez-Aguero, L. Pavez, F. Ibanez, I. Pacheco, R. Campos-Vargas, L. A. Meisel, A. Orellana, J. Retamales, H. Silva, M. Gonzalez, et al. Identification of woolliness response genes in peach fruit after post-harvest treatments J. Exp. Bot., May 3, 2008; (2008) ern069v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liao, J. Zhang, S. Shestopal, G. Szabo, A. Castle, and D. Castle Nonredundant function of secretory carrier membrane protein isoforms in dense core vesicle exocytosis Am J Physiol Cell Physiol, March 1, 2008; 294(3): C797 - C809. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Muller, O. Wiborg, and J. Haase Subcellular Redistribution of the Serotonin Transporter by Secretory Carrier Membrane Protein 2 J. Biol. Chem., September 29, 2006; 281(39): 28901 - 28909. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Liu, H. Liao, A. Castle, J. Zhang, J. Casanova, G. Szabo, and D. Castle SCAMP2 Interacts with Arf6 and Phospholipase D1 and Links Their Function to Exocytotic Fusion Pore Formation in PC12 Cells Mol. Biol. Cell, October 1, 2005; 16(10): 4463 - 4472. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Castle and D. Castle Ubiquitously expressed secretory carrier membrane proteins (SCAMPs) 1-4 mark different pathways and exhibit limited constitutive trafficking to and from the cell surface J. Cell Sci., August 15, 2005; 118(16): 3769 - 3780. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. C. Lin, W. P. Williams, Y. Luu, R. S. Molday, J. Orlowski, and M. Numata Secretory carrier membrane proteins interact and regulate trafficking of the organellar (Na+,K+)/H+ exchanger NHE7 J. Cell Sci., May 1, 2005; 118(9): 1885 - 1897. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Baluska, J. Samaj, P. Wojtaszek, D. Volkmann, and D. Menzel Cytoskeleton-Plasma Membrane-Cell Wall Continuum in Plants. Emerging Links Revisited Plant Physiology, October 1, 2003; 133(2): 482 - 491. [Full Text] [PDF] |
||||
![]() |
L. Liu, Z. Guo, Q. Tieu, A. Castle, and D. Castle Role of Secretory Carrier Membrane Protein SCAMP2 in Granule Exocytosis Mol. Biol. Cell, December 1, 2002; 13(12): 4266 - 4278. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Guo, L. Liu, D. Cafiso, and D. Castle Perturbation of a Very Late Step of Regulated Exocytosis by a Secretory Carrier Membrane Protein (SCAMP2)-derived Peptide J. Biol. Chem., September 13, 2002; 277(38): 35357 - 35363. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||