![]() |
|
|
Vol. 11, Issue 9, 2961-2971, September 2000
Institut für Physiologische Chemie der Universität München, Goethestrasse 33, 80336 München, Germany
Submitted March 3, 2000; Revised June 20, 2000; Accepted July 6, 2000| |
ABSTRACT |
|---|
|
|
|---|
Mmm1p is a protein required for maintenance of mitochondrial morphology in budding yeast. It was proposed that it is required to mediate the interaction of the mitochondrial outer membrane with the actin cytoskeleton. We report the cloning and characterization of MMM1 of the filamentous fungus Neurospora crassa, an organism that uses microtubules for mitochondrial transport. Mutation of the mmm-1 gene leads to a temperature-sensitive slow growth phenotype and female sterility. Mutant cells harbor abnormal giant mitochondria at all stages of the asexual life cycle, whereas actin filament-depolymerizing drugs have no effect on mitochondrial morphology. The MMM1 protein has a single transmembrane domain near the N terminus and exposes a large C-terminal domain to the cytosol. The protein can be imported into the outer membrane in a receptor-dependent manner. Our findings suggest that MMM1 is a factor of general importance for mitochondrial morphology independent of the cytoskeletal system used for mitochondrial transport.
| |
INTRODUCTION |
|---|
|
|
|---|
Each type of eukaryotic cell possesses a characteristic
three-dimensional structure. Maintenance of its architecture and
duplication during cell division depend on active transport of
organelles along the cytoskeleton (Warren and Wickner, 1996
).
Mitochondria are essential organelles that are often located at sites
of high energy consumption in the cell. They cannot be formed de novo, and have to be inherited from the mother to the daughter cell during
cell division (Bereiter-Hahn, 1990
; Bereiter-Hahn and Vöth, 1994
). There is mounting evidence that positioning and transport of
mitochondria are controlled by the cytoskeleton. However, only little
is known about the molecular components mediating these processes
(Yaffe, 1999
).
Fungi are excellent model organisms to study transport of mitochondria
because biochemical and genetic approaches can be combined. All three
major cytoskeletal classes appear to play a role in mitochondrial
inheritance in fungi (Steinberg, 1998
). The actin cytoskeleton is of
major importance for mitochondrial movement in the budding yeast
Saccharomyces cerevisiae (Simon and Pon, 1996
; Simon
et al., 1997
; Hermann and Shaw, 1998
). Temperature-sensitive actin mutants are defective in mitochondrial inheritance (Drubin et al., 1993
; Lazzarino et al., 1994
; Smith
et al., 1995
); mutations that destabilize actin cables, such
as mutation of the MDM20 gene, result in the loss of
directional mitochondrial movement (Hermann et al., 1997
);
and isolated mitochondria exhibit an actin-dependent motor activity
(Simon et al., 1995
). In addition, an intermediate filament-like protein, Mdm1p, was found to be important for
mitochondrial distribution and morphology in S. cerevisiae
(McConnell and Yaffe, 1993
). In the fission yeast
Schizosaccharomyces pombe, mitochondrial distribution is
mediated by microtubules (Kanbe et al., 1989
; Yaffe et
al., 1996
). Similarly, cytoplasmic microtubules are required for
transport of mitochondria in many filamentous fungi. These include
Neurospora crassa (Steinberg and Schliwa, 1993
),
Fusarium acuminatum (Howard and Aist, 1980
), and
Nectria hematococca (Aist and Bayles, 1991
; Wu et
al., 1998
). In Aspergillus nidulans, however, mitochondrial movement is thought to depend on the actin cytoskeleton (Oakley and Rinehart, 1985
; Suelmann and Fischer, 2000
).
The MMM11 gene1 of S. cerevisiae was isolated in a screen for mutants defective in
maintenance of mitochondrial
morphology (Burgess et al., 1994
). This
component appears to be of primary importance for the understanding of
mitochondrial morphogenesis. Mutations in MMM1 lead to
formation of mitochondria with drastically altered structure. The
tubular mitochondrial network is located below the cell cortex in
wild-type yeast cells (Hoffmann and Avers, 1973
). In mmm1
mutants it is collapsed into large spherical organelles (Burgess
et al., 1994
). Yeast cells disrupted in the MMM1
gene are not viable on nonfermentable carbon sources. The Mmm1 protein is integrated in the mitochondrial outer membrane (Burgess et al., 1994
). Its topology in the membrane, however, is not clear. On the one hand, it was shown that the C terminus of the protein is
exposed to the cytosol (Burgess et al., 1994
). On the other hand, Mmm1p was identified as a potential interactor of the
mitochondrial inner membrane protein, Tim54p (Kerscher et
al., 1997
). Mitochondria isolated from an mmm1 mutant
strain show no actin-binding activity in vitro, and mitochondrial
motility is severely reduced in vivo (Boldogh et al., 1998
).
It was proposed that Mmm1p and another mitochondrial outer membrane
protein, Mdm10p, are required for docking of mitochondrial
actin-binding proteins and coupling of the organelle to the actin
cytoskeleton (Boldogh et al., 1998
).
Herein, we report the cloning and characterization of the mmm-1 gene of N. crassa. Loss-of-function mutants of mmm-1 exhibit a temperature-sensitive growth defect and female sterility. Mutant cells harbor giant mitochondria and are defective in mitochondrial distribution, implying that MMM1 is of general importance for mitochondrial morphology independent of the major cytoskeletal system used for mitochondrial transport. We show that the MMM1 protein has a single transmembrane segment in the mitochondrial outer membrane with a large C-terminal domain exposed to the cytoplasm. Implications of the mutant phenotype and the topology of the protein on the function of MMM1 are discussed.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Recombinant DNA Techniques, Cloning of the mmm-1 Gene, and Plasmid Constructions
Standard methods were used for the manipulation of DNA (Sambrook
et al., 1989
). Polymerase chain reaction (PCR) was performed by using Pfu DNA polymerase (Promega, Madison, WI) or
DyNAzyme II DNA polymerase (Finnzymes, Espoo, Finland) according to the manufacturer's instructions. DNA sequencing was performed by using automated fluorescent sequencing technology (Toplab, Martinsried, Germany). Genomic DNA of Neurospora was isolated as
described (Lee et al., 1988
).
A fragment of the mmm-1 gene was amplified by PCR from a N. crassa cDNA library (kind gift of Dr. F. Nargang, University of Edmonton, Canada) by using the degenerate primers MMM1-1 (5' GAGTCICTIGAYTGGTTYAAYGT) and MMM1-2 (5' GGCTTGGGWAGTTIAGIARIARYTTXGT). An amplificate of the expected size was cloned into vector pCRII-TOPO (Invitrogen, Carlsbad, CA). The sequence of the insert was determined, and the fragment was labeled by using the DIG DNA Labeling and Detection kit (Roche, Mannheim, Germany). This fragment was used as a probe for subsequent Southern blot and colony hybridization experiments. To construct a subgenomic DNA library, genomic DNA of Neurospora was digested with HindIII, the mmm-1-containing fragment was detected by Southern blot analysis, and DNA fragments of the corresponding size (2.3 kilobases) were cloned into vector pGEM3 (Promega). This subgenomic library and the cDNA library were screened for full-length genomic and cDNA clones by colony hybridization, and the DNA sequence of the isolated clones was determined.
To obtain a plasmid for repeat-induced point mutation (RIP)
mutagenesis, the HindIII insert of the plasmid isolated from
the subgenomic library was cloned into the hygromycin
resistance-conferring vector pCSN43 (Staben et al., 1989
),
yielding pgMMM1-1.
To construct plasmids for expression of epitope-tagged versions of MMM1
we first amplified the qa-2 promoter of the quinic acid gene
cluster of N. crassa (Geever et al., 1989
) by PCR
with oligos Apa-qa2 (5' CGAGGGCCCGGCATCATCAA) and qa2-Cla (5'
TGATATCGATTGGTACCTCTGGTTGGGTGCGA) and cloned it into the
ApaI/ClaI sites of pCB1179 (Sweigard et al., 1997
), yielding vector pqa-2Hyg. To obtain an MMM1 version with an N-terminal HA epitope (HA-MMM1) the gene was amplified from
genomic DNA with oligos HA-MMM1 (5'
AAAGAATTCATGTACCCCTACGACGTCCCCGACTACGCCATGGCCGACA-TTTGCCC) and MMM1-Bam (5' AAAGGATCCTCAGGGCATAGAACCGGG) and cloned into the
EcoRI/BamHI sites of pqa-2Hyg. To obtain an MMM1
version with a C-terminal HA epitope (MMM1-HA) the gene was amplified
from genomic DNA with oligos Eco-MMM1 (5'
AAAGAATTCATGGCCGACATTTGCCCATC) and MMM1-HA (5'
AAAGGATCCTCAGGCGTAGTCGGGGACGTCGTAGGGGTAGGGCATAGAACCGGG) and cloned into the EcoRI/BamHI sites
of pqa-2Hyg.
To obtain constructs for in vitro transcription, the mmm-1
open reading frame and truncated versions thereof were amplified by PCR
from cDNA and cloned into vector pGEM4 (Promega). The full-length open
reading frame was amplified by using oligos Eco-MMM1 (see above) and
MMM1-Hind (5' AAAAAGCTTTCAGGGCATAGAACCGGG) and cloned with
EcoRI and HindIII. The
N-MMM1 version was
obtained with oligos
TM1-MMM1 (5' AAAGAATTCATGGGTGATCCTCCCTCGC) and
MMM1-Bam (see above) and cloned with EcoRI and
BamHI. The MMM1-
C version was obtained with oligos
Eco-MMM1 (see above) and
TM2-MMM1 (5' AAAAAGCTTCACCTCTTGGGATAGTTGAG) and cloned with EcoRI and
HindIII.
Strains, Growth Conditions, Isolation of Neurospora Mutants, and Drug Treatment
Standard genetic and microbiological techniques were used for
the growth and manipulation of Neurospora strains (Davis and de Serres, 1970
). Neurospora wild-type strains used were St.
Lawrence 74A (Fungal Genetics Stock Center, Kansas City, KS)
and K93-5a (isogenic to strain 74A).
Neurospora was grown in Vogel's minimal medium under
continuous aeration and illumination with white light at 25°C (if not
indicated otherwise) (Davis and de Serres, 1970
). The HA-MMM1- and
MMM1-HA-expressing strains were grown on 0.3% quinic acid as a carbon
source to induce expression from the qa-2 promoter. Growth
in "race tubes" was performed on Vogel's agar at the indicated
temperatures. Transformation of Neurospora was carried out
as described (Vollmer and Yanofsky, 1986
; Staben et al.,
1989
).
For the isolation of mmm-1RIP mutants,
plasmid pgMMM1-1 was transformed into strain St. Lawrence
74A. Homokaryotic microconidia (Ebbole and Sachs, 1990
) of
the resulting strain were used for mating with strain
K93-5a. From this cross, 60 ascospores were isolated,
germinated, and examined for aberrant mitochondria by staining with the
dye 3,3'-dihexyloxacarbocyanine iodide (DiOC6) and fluorescence microscopy (see below). Two of four strains with aberrant mitochondrial morphology were chosen for further analysis. The
mmm-1 alleles of these two strains were amplified by PCR and sequenced. To control that RIP mutagenesis only affected the
mmm-1 gene, the mmm-1RIP mutants
were complemented by transformation with plasmid pgMMM1-1.
For the examination of the effect of actin filament-depolymerizing drugs, 20 µg/ml latrunculin B (LAT-B) (Calbiochem, La Jolla, CA) was added to freshly germinated conidia that were then incubated for 30 to 60 min at 37°C under agitation. After this time, changes in hyphal morphology due to drug treatment were already observed. Filamentous actin was completely absent after LAT-B treatment as shown by indirect immunofluorescence. To further control for the effectiveness of drug treatment, cultures and mock-treated control cultures were incubated overnight; complete inhibition of growth of drug-treated cells was observed the next morning. As little as 4 µg/ml LAT-B was found to inhibit growth almost completely. Mitochondria of cells treated for up to 3 h with 20 µg/ml LAT-B had an appearance indistinguishable from nontreated wild-type cells.
Microscopic Analysis of Neurospora Cells
Conidia, freshly germinated conidia, or older hyphae were
harvested from liquid cultures and subjected to standard fluorescence and phase contrast microscopy by using an Axioplan 2 microscope equipped with a Plan-Neofluar 100×/1.30 Ph3 oil objective and a 100-W
mercury lamp (Carl Zeiss Jena GmbH, Jena, Germany). Mitochondria in living cells were stained by 2-min incubation at room temperature in
the presence of 0.175 µM DiOC6 (Pringle
et al., 1989
) (Molecular Probes) or 0.5 µM rhodamine B
hexyl ester (Molecular Probes). After staining, the cells were
immediately subjected to fluorescence microscopy. For
DiOC6-stained mitochondria, a 450-490-nm band pass filter was used, and emitted light was detected with a 520-nm-long pass filter (beamsplitter 510 nm) (Zeiss filter set 09). For
rhodamine B hexyl ester-stained mitochondria, a 546-nm band pass
filter was used, and emitted light was detected with a 590-nm-long pass filter (beamsplitter 580 nm) (Zeiss filter set 15). Images were recorded with a SPOT-cooled color digital camera (Diagnostic
Instruments, Sterling Nights, MI) and processed with Lite
MetaMorph imaging software (Universal Imaging Corporation, West
Chester, PA).
Immunolocalization of actin was performed as described by Tinsley
et al. (1998)
. The C4 monoclonal antiactin IgG antibody (ICN
Biochemicals, Inc., Costa Mesa, CA) was used at a 1:400 dilution.
Isolation and Subfractionation of Mitochondria
Mitochondria were isolated by differential centrifugation
essentially as described (Sebald et al., 1979
). To reduce
proteolytic degradation of the HA epitope during preparation, the
protocol was modified for strains expressing MMM1-HA and HA-MMM1.
Hyphae were ground with quartz sand for only 1 min instead of 4 min, and cell debris was sedimented by one centrifugation step for 10 min at
5000 × g, and mitochondria were harvested from the
supernatant by one centrifugation step for 10 min at 12,500 × g. Mitochondria were resuspended at a concentration of 10 mg/ml in SEM buffer (250 mM sucrose; 1 mM EDTA; 10 mM
3-(N-morpholino)propanesulfonic acid (MOPS)/KOH, pH 7.4).
Protease treatment was performed with 100 µg/ml proteinase K for 15 min on ice in the presence or absence of 0.25% Triton X-100.
Import of Proteins into Mitochondria In Vitro
Protein import into mitochondria was performed essentially as
described (Mayer et al., 1993
). Import reactions were
performed by incubation of isolated mitochondria (1 mg/ml) with 1%
reticulocyte lysate containing
[35S]methionine-labeled precursor protein for
20 min at 20°C in import buffer (250 mM sucrose; 0.25 mg/ml bovine
serum albumin; 80 mM KCl; 5 mM MgCl2; 10 mM
MOPS/KOH, pH 7.2). Mitochondria were reisolated by centrifugation for
10 min at 12,500 × g at 2°C and resuspended in 2.4 M
sucrose in EMK buffer (1 mM EDTA; 10 mM MOPS/KOH, pH 7.4; 80 mM KCl).
One milliliter of this suspension was placed on the bottom of a
centrifuge tube and overlayed with 1 ml of 1.4 M sucrose in EMK buffer
and 1 ml of 250 mM sucrose in EMK buffer. Mitochondria were floated by
centrifugation for 1 h at 480,000 × g in a Beckman
SW60 rotor. Mitochondria were harvested from the 1.4/0.25 M sucrose
interphase, diluted with EMK buffer, reisolated by centrifugation for
10 min at 12,500 × g, and resuspended in 250 mM
sucrose in EMK buffer. Protease treatment and carbonate extraction of
mitochondria were performed as described (Mayer et al.,
1993
). After SDS-PAGE, blotting to nitrocellulose, and autoradiography,
imported protein was quantified by densitometry (Ultroscan XL;
Pharmacia, Uppsala, Sweden).
Miscellaneous
SDS-PAGE and blotting of proteins to nitrocellulose were
performed according to standard methods. The enhanced chemiluminescence detection system (Amersham Pharmacia Biotech, Uppsala, Sweden) was used for Western blotting. High-Tris urea gels (Künkele
et al., 1998
) were used for the separation of
low-molecular-weight protein fragments.
| |
RESULTS |
|---|
|
|
|---|
mmm-1 Gene of N. crassa
The mmm-1 gene of N. crassa was cloned by a
PCR-based approach. We designed degenerate primers complementary to
sequences encoding regions that are conserved between S. cerevisiae Mmm1p (Burgess et al., 1994
) and a putative
homolog from S. pombe (GenBank CAA20322). With these
primers, a DNA fragment of the mmm-1 gene was amplified from
N. crassa cDNA. Using this fragment as a probe, we isolated
the complete gene both from a cDNA and a subgenomic DNA library. DNA
sequencing revealed that the mmm-1 gene has the capacity to
encode a polypeptide with 415 amino acids and a predicted molecular
weight of 46 kDa. The protein sequence shares 30% identity with Mmm1p
of S. cerevisiae, and 31% identity with the predicted protein of S. pombe (Figure
1). The coding sequence of
mmm-1 is interrupted by an 87-base pair (bp) intron at
nucleotide position 36 with respect to the translation start. The
genomic sequence of the mmm-1 gene, including 386 bp of the
promoter region and 330 bp of the terminator region (accession number
AF238480), and the cDNA sequence (accession number AF239620) are
deposited in GenBank.
|
|
Mutation of mmm-1 Results in a Temperature-Sensitive Slow Growth Phenotype and Female Sterility
To gain insight into a possible role of the MMM1 protein in
mitochondrial biogenesis in N. crassa, we constructed mutant
strains with inactivated mmm-1 genes by RIP. During the
sexual cycle of Neurospora, both linked and unlinked
duplicated DNA sequences present in either of the nuclei of the mating
pair are mutated by a variable number of G:C-to-A:T transitions
(Selker, 1990
). First, we cloned a 2.3-kilobase fragment containing the
mmm-1 gene together with flanking regions on both sides into
a hygromycin resistance-conferring vector. Plasmid DNA from this clone
was transformed into the N. crassa wild-type strain St.
Lawrence 74A. Homokaryotic microconidia, which now contained
a duplication of the mmm-1 fragment, were isolated
and used for mating with an isogenic wild-type strain. From this cross,
60 individual ascospores were isolated and further examined for the
presence of mmm-1RIP mutants by staining
with the mitochondria-specific vital dye DiOC6
and fluorescence microscopy. Four strains exhibited slow growth and an
abnormal mitochondrial morphology (see below). Two strains were chosen
for further analysis. The mmm-1 alleles of these strains
were amplified by PCR, and the nucleotide sequences were determined.
Both alleles, mmm-1RIP23 and
mmm-1RIP24, contained several missense and
nonsense mutations (Figure 2A). Because
mmm-1RIP23 harbors a mutation resulting in
a stop codon after only 118 codons (i.e. less than one-third of the
coding region) we consider it very likely that this is a complete
loss-of-function mutant. Both mutants behaved identically under all conditions.
We asked whether an intact mmm-1 gene would be required for wild-type growth of N. crassa. Glass tubes containing solid growth medium (race tubes) were inoculated at one end of the tube with mycelia from the wild-type strain, both mmm-1RIP mutant strains, and the mmm-1RIP23 mutant complemented with the wild-type mmm-1 gene. The race tubes were incubated at 21, 30, and 40°C, and the distance the mycelia had progressed along the agar surface was measured each day. Both mmm-1 mutant strains showed a slow growth phenotype at low and standard temperatures and were inviable at elevated temperature (Figure 2B). The growth defect was reversed by complementation with the wild-type gene, indicating that it is specific for the mmm-1 mutation (Figure 2B). Slow growth of the mutant and strong reduction of aerial hyphae also were observed on agar plates (Figure 2C). We conclude that an intact mmm-1 gene is required for normal growth of Neurospora. The fact that respiration is essential for growth of Neurospora together with the observation that the mmm-1RIP mutants are viable suggests that mmm-1 is not essential for respiratory functions of mitochondria.
Under conditions of nitrogen limitation, vegetative hyphae of
Neurospora undergo a rather complex sexual sporulation
pathway. Hyphal balls called protoperithecia form that function as
female reproductive structures. Upon fertilization with cells of the opposite mating type protoperithecia develop into perithecia, macroscopic black structures. Meiosis occurs within these structures leading to the formation of ~200 asci each containing 8 ascospores. Mature ascospores are eventually ejected from the ascus through an
ostiole in a beak-like structure of the perithecium (Springer, 1993
).
We observed that mutation of mmm-1 leads to female
sterility. Fertilization of wild-type mycelia with conidia of the
mmm-1RIP mutants resulted in normal
development of perithecia and formation of viable ascospores. However,
when mmm-1RIP protoperithecia were
fertilized with wild-type conidia perithecial development was blocked.
The macroscopic appearance of mutant perithecia was normal. However,
when ~100 perithecia were inspected more closely under the
microscope, it was found that they were devoid of the normal beak-like
structure and lacked ascospores (Figure 2D). We conclude that
mmm-1 is required for the sexual cycle of
Neurospora, presumably during a developmental stage prior to
ascospore formation.
MMM1 Is Required for Normal Mitochondrial Morphology in Neurospora
We asked whether mutation of mmm-1 would result in
aberrant mitochondrial morphology in Neurospora. To address
this question, we stained conidia, germinating conidia, and older
hyphae of wild-type and mmm-1RIP strains
with the mitochondria-specific dye DiOC6. In
wild-type cells, we observed numerous, relatively small thread-like
organelles that were evenly distributed throughout the cell in conidia
(Figure 3A) as well as in hyphal tips
(Figure 3B) and hyphal cells distant from the tip (Figure 3C). Similar
results were obtained after staining with Rhodamine B hexyl ester
(our unpublished observations). In the
mmm-1RIP mutants, mitochondrial morphology
was strongly altered. Mitochondria were collapsed into large spherical
structures at the conidial stage of the life cycle (Figure 3E). Newly
germinated hyphae (Figure 3, F and H) and hyphal cells distant from the
tip (Figure 3G) contained enlongated giant mitochondria (Figure 3F) and
exhibited large mitochondria-free zones that were always away from the
hyphal tip (Figure 3, G and H). In no case could any fine mitochondrial structures be resolved. We conclude that the MMM1 protein plays an
essential role in maintenance of normal mitochondrial morphology and
distribution in Neurospora.
|
It was proposed that Mmm1p in yeast is required for docking of
actin-binding proteins on mitochondria, implying that the absence of
functional Mmm1p would lead to the loss of coupling of the organelle to
the actin cytoskeleton (Boldogh et al., 1998
). In fact,
mitochondrial movement is severely compromised in mmm1 yeast mutants similar to yeast cells treated with actin
filament-depolymerizing drugs (Boldogh et al., 1998
). Thus,
it is possible that a lack of an interaction with actin filaments might
be the primary reason for the observed collapse of mitochondria into
spherical organelles in mmm1 mutant cells. This prompted us
to investigate whether depolymerization of actin filaments in
Neurospora would have an effect on mitochondrial morphology
similar to that of the mmm-1 mutation. Germinated conidia of
the wild-type strain were incubated for 30 min in the presence of up to
20 µg/ml LAT-B, a very potent drug that disrupts microfilament
organization without obvious effects on the microtubular system
(Spector et al., 1983
). The concentration of LAT-B in our
experiments was high enough to completely inhibit growth of the hyphae,
and filamentous actin was completely depolymerized under these
conditions as shown by indirect immunofluorescence (Figure 3, I and J).
Mitochondria, however, were still small and thread-like (Figure 3D),
indistinguishable from mock-treated wild-type cells. Because
mitochondria in mmm-1RIP mutants have an
appearance rather different from mitochondria in LAT-B-treated cells,
we consider it likely that the MMM1 protein of Neurospora
has functions other than or in addition to mitochondrial alignment
along actin cables.
MMM1 Is an Integral Protein of the Mitochondrial Outer Membrane with an Nin-Cout Topology
Mmm1p in yeast was shown to be an integral protein of the
mitochondrial outer membrane (Burgess et al., 1994
).
Furthermore, an epitope tag fused to the C terminus of the protein was
protease sensitive in isolated mitochondria, indicating that it faces
the cytosol (Burgess et al., 1994
). Only circumstantial
evidence exists, however, for the topology of the N-terminal part of
the protein. Based on hydropathy predictions it was suggested that
Mmm1p in yeast has a single membrane-spanning domain near the N
terminus (Burgess et al., 1994
). However, hydropathy
analysis of MMM1 of Neurospora revealed a second hydrophobic
region in the C-terminal half of the protein. Similar hydrophobic
regions can be found in the S. cerevisiae and S. pombe MMM1 homologs (Figure 4A).
With the TMpred program (Hofmann and Stoffel, 1993
) both hydrophobic regions are predicted to form
-helical transmembrane segments. These
predictions suggest three different possible topologies: 1)
Nin and Cout with a single
transmembrane domain near the N terminus, 2) Nin
and Cout with a single transmembrane domain in the C-terminal half, and 3) Nout and
Cout with two transmembrane domains.
|
To discriminate between these different topologies, we constructed two epitope-tagged variants of MMM1, MMM1-HA with a C-terminal HA epitope tag and HA-MMM1 with an N-terminal HA epitope tag. Both constructs were expressed in the mmm-1RIP23 background and microconidia were isolated to make the strains homokaryotic. Both epitope-tagged versions complemented the temperature-sensitive growth defect of the mutant, indicating that they were fully functional (our unpublished observations). When isolated mitochondria harboring the MMM1-HA protein were treated with protease, no protected fragment could be observed, confirming that the C terminus is exposed to the outside of mitochondria (Figure 4B). Protease treatment of isolated mitochondria harboring the HA-MMM1 protein resulted in a protected fragment of ~8 kDa (Figure 4B). The size of the fragment is consistent with a peptide composed of the HA epitope plus the N-terminal 37 amino acids of MMM1, including the first predicted transmembrane segment. The fragment was accessible to protease when the mitochondrial membranes were opened by detergent (Figure 4B) or by sonication. These data indicate that the N terminus of MMM1 is located in the intermembrane space, i.e. MMM1 has a Nin-Cout topology with a single transmembrane domain near the N terminus (Figure 4C).
In Vitro-Translated MMM1 Is Imported into the Outer Membrane in a Receptor-Dependent Manner
To examine the in vitro import of MMM1, the protein was
synthesized in reticulocyte lysate in the presence of
[35S]methionine and incubated with isolated
mitochondria. After the import reaction, mitochondria were floated in a
sucrose gradient and then subjected to carbonate extraction. Virtually
all of the mitochondria-associated protein was recovered in the
carbonate pellet, indicating insertion of the protein into the
membrane. The inserted protein was sensitive to proteinase K, and no
protected domains large enough to be observed with the gel system used
could be detected (Figure 5A).
Pretreatment of mitochondria with trypsin to cleave import receptors on
the mitochondrial surface strongly reduced the amount of imported
protein, suggesting that MMM1 uses protease-sensitive import receptors
for its insertion into the outer membrane (Figure 5B). Next, we
examined the import of two truncated versions of MMM1. MMM1-
C lacks
the C-terminal 179 amino acids. This construct contains only the
potential N-terminal transmembrane domain and lacks the second
hydrophobic region. In the other construct,
N-MMM1, the N-terminal
39 amino acids were replaced by a methionine. This construct lacks the
predicted N-terminal transmembrane segment and contains only the
hydrophobic region in the C-terminal half of the protein. Upon import,
all constructs bound to mitochondria with similar efficiency (Figure
5C, lane
PK). They were accessible to protease, indicating that they
were not completely translocated across the outer membrane (Figure 5C,
lane +PK). No protease-protected fragments could be observed.
Upon import, MMM1-
C was partitioned into the membrane fraction
similar to the full-length construct (Figure 5C, lane
CO32-, P). This indicates that
the first hydrophobic region is sufficient for membrane insertion. In
contrast, most of the mitochondria-associated
N-MMM1 was extracted
by carbonate (Figure 5C, lane
CO32-, S). This suggests that
the second hydrophobic region is not able to insert the protein into
the membrane with the same efficiency as the first hydrophobic region.
These results are consistent with an
Nin-Cout topology of MMM1
in the mitochondrial outer membrane.
|
| |
DISCUSSION |
|---|
|
|
|---|
In the fungal kingdom, different species use different
cytoskeletal tracks to inherit and position mitochondria. Actin
filaments appear to be of major importance in the budding yeast
S. cerevisiae (Simon and Pon, 1996
; Simon et al.,
1997
; Hermann and Shaw, 1998
). The mitochondrial outer membrane protein
Mmm1p was proposed to act as a mitochondrial receptor for actin-binding
proteins (Boldogh et al., 1998
). In contrast, cytoplasmic
microtubules mediate mitochondrial movement in the filamentous fungus
N. crassa (Steinberg and Schliwa, 1993
). Herein, we report
the identification and characterization of MMM1 from
Neurospora. Similar to mmm1 mutants in yeast,
mmm-1RIP mutant strains of
Neurospora exhibit abnormal giant mitochondria and large
mitochondria-free zones at all stages of the asexual life cycle.
Moreover, mmm-1 mutants are female sterile, suggesting that
maintenance of normal mitochondrial morphology is an essential process
during the rather complex cell differentiation processes, such as
development of vegetative cells to crozier-like structures and
eventually to mature ascospores. Thus, MMM1 appears to be a factor of
general importance for mitochondrial morphology in fungi, independent
of the major cytoskeletal system used for mitochondrial transport.
What might be the molecular mechanism of MMM1 action? It was originally
proposed that Mmm1p keeps mitochondria in an elongated shape by
mediating binding to a specific cytoskeletal element (Burgess et
al., 1994
). Furthermore, it was suggested that Mmm1p acts as a
receptor for actin-binding proteins because mitochondria isolated from
mmm1 mutants did not bind to actin filaments in a
cosedimentation assay (Boldogh et al., 1998
). However,
mitochondria with an appearance rather different from mitochondria of
mmm1 mutants are observed in yeast cells treated with
actin-depolymerizing drugs (Boldogh et al., 1998
), or yeast
mutants affecting actin (Drubin et al., 1993
; Lazzarino
et al., 1994
) or MDM20, a gene necessary for
mitochondrial inheritance and organization of the actin cytoskeleton
(Hermann et al., 1997
). In Neurospora the
majority of filamentous actin is localized in patches concentrated at
the hyphal tips (Barja et al., 1991
; Bruno et
al., 1996
) and no cytoplasmic actin cables are observed (Steinberg
and Schliwa, 1993
; Figure 3I). Therefore, it is difficult to envision
that filamentous actin is the major determinant of mitochondrial
morphology in Neurospora. Consistent with this
interpretation, we observed that treatment of Neurospora
cells with the actin filament-depolymerizing drug LAT-B had no effect
on mitochondrial morphology. In contrast, mutation of mmm-1
resulted in a dramatic change of mitochondrial shape. These
inconsistencies of actin filament organization and effects of mutation
of mmm-1 on mitochondrial morphology indicate that MMM1 has
another or an additional role apart from connecting mitochondria to the
actin cytoskeleton. This may include a function in a putative
"mitoskeleton" (Burgess et al., 1994
), or an interaction with intermediate filament-like structures that have been reported to
be important for mitochondrial inheritance in yeast (McConnell and
Yaffe, 1992
, 1993
). Another possibility is that MMM1 fulfills its
function by interacting with different partners in different organisms.
It may be speculated that MMM1 is part of a general motor
protein-receptor complex on mitochondria that interacts with
microtubule-binding proteins in Neurospora and actin-binding proteins in yeast.
Interestingly, mutational alteration or deletion of some components of
the mitochondrial protein import machineries also result in abnormal
mitochondrial morphology. Mutations of the mitochondrial outer membrane
import receptor TOM70 result in enlarged mitochondria in
Podospora anserina (Jamet-Vierny et al., 1997
)
and N. crassa (Grad et al., 1999
). This effect
might be explained by the assumption that TOM70 is the protein import
receptor mediating the insertion of MMM1, or similar proteins, into the
outer membrane. Indeed, we observed that insertion of MMM1 into the
mitochondrial outer membrane is dependent on protease-sensitive
receptors on the mitochondrial surface. Thus, inactivation of TOM70
might result in a reduced level of MMM1 in the outer membrane and
consequently lead to abnormal mitochondrial morphology.
Tim54p, a component of the TIM22 protein translocase complex of the
mitochondrial inner membrane, was identified as a protein potentially
interacting with Mmm1p in a yeast two-hybrid screen. In this screen, an
Mmm1p fragment starting with amino acid residue 123 was used as a bait
(Kerscher et al., 1997
). Herein, we show that the
corresponding part of Neurospora MMM1 is exposed to the cytosol. An interaction of a cytosolic part of an outer membrane protein with an inner membrane protein, however, cannot be easily explained.
The precise role of MMM1 in mitochondrial biogenesis is still unclear. Its function, however, likely depends on homo- and/or heterooligomeric interactions with other proteins. Using an epitope-tagged MMM1-HA protein expressed under control of the qa-2 promoter, we observed that this protein assembles into a higher-molecular-weight complex of ~300 kDa. Similar results were obtained with in vitro-imported protein (our unpublished observations). The availability of the MMM1 protein from Neurospora, an organism amenable to biochemical procedures, will enable the purification of the MMM1 complex. The identification of its interacting partners may help to reveal its molecular role in mitochondrial biogenesis.
| |
ACKNOWLEDGMENTS |
|---|
We thank Heiko Germroth and Gabi Ludwig for excellent technical assistance. We also thank students Carsten Bornhövd and Jutta Szillis for their assistance and Dr. Johannes Herrmann for critically reading the manuscript. This work was supported by the Sonderforschungsbereich 413 (Teilprojekt B3) of the Deutsche Forschungsgemeinschaft, a grant of the Bundesministerium für Bildung und Forschung (MITOP), and the Fonds der Chemischen Industrie.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: benedikt.westermann{at}bio.med.uni-muenchen.de.
1 In the following, MMM1 designates the wild-type gene of S. cerevisiae, mmm1 designates mutant versions of MMM1, Mmm1p designates the yeast protein, mmm-1 designates the wild-type gene of N. crassa, mmm-1RIP designates mutant alleles of mmm-1, and MMM1 designates the Neurospora protein.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Becker, S. Pfannschmidt, B. Guiard, D. Stojanovski, D. Milenkovic, S. Kutik, N. Pfanner, C. Meisinger, and N. Wiedemann Biogenesis of the Mitochondrial TOM Complex: Mim1 PROMOTES INSERTION AND ASSEMBLY OF SIGNAL-ANCHORED RECEPTORS J. Biol. Chem., January 4, 2008; 283(1): 120 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Dimmer, S. Jakobs, F. Vogel, K. Altmann, and B. Westermann Mdm31 and Mdm32 are inner membrane proteins required for maintenance of mitochondrial shape and stability of mitochondrial DNA nucleoids in yeast J. Cell Biol., January 3, 2005; 168(1): 103 - 115. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fuchs and B. Westermann Role of Unc104/KIF1-related Motor Proteins in Mitochondrial Transport in Neurospora crassa Mol. Biol. Cell, January 1, 2005; 16(1): 153 - 161. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Vasiljev, U. Ahting, F. E. Nargang, N. E. Go, S. J. Habib, C. Kozany, V. Panneels, I. Sinning, H. Prokisch, W. Neupert, et al. Reconstituted TOM Core Complex and Tim9/Tim10 Complex of Mitochondria Are Sufficient for Translocation of the ADP/ATP Carrier across Membranes Mol. Biol. Cell, March 1, 2004; 15(3): 1445 - 1458. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kondo-Okamoto, J. M. Shaw, and K. Okamoto Mmm1p Spans Both the Outer and Inner Mitochondrial Membranes and Contains Distinct Domains for Targeting and Foci Formation J. Biol. Chem., December 5, 2003; 278(49): 48997 - 49005. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Herlan, F. Vogel, C. Bornhovd, W. Neupert, and A. S. Reichert Processing of Mgm1 by the Rhomboid-type Protease Pcp1 Is Required for Maintenance of Mitochondrial Morphology and of Mitochondrial DNA J. Biol. Chem., July 18, 2003; 278(30): 27781 - 27788. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hanekamp, M. K. Thorsness, I. Rebbapragada, E. M. Fisher, C. Seebart, M. R. Darland, J. A. Coxbill, D. L. Updike, and P. E. Thorsness Maintenance of Mitochondrial Morphology Is Linked to Maintenance of the Mitochondrial Genome in Saccharomyces cerevisiae Genetics, November 1, 2002; 162(3): 1147 - 1156. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Dimmer, S. Fritz, F. Fuchs, M. Messerschmitt, N. Weinbach, W. Neupert, and B. Westermann Genetic Basis of Mitochondrial Function and Morphology in Saccharomyces cerevisiae Mol. Biol. Cell, March 1, 2002; 13(3): 847 - 853. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fuchs, H. Prokisch, W. Neupert, and B. Westermann Interaction of mitochondria with microtubules in the filamentous fungus Neurospora crassa J. Cell Sci., January 5, 2002; 115(9): 1931 - 1937. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Klanner, H. Prokisch, and T. Langer MAP-1 and IAP-1, Two Novel AAA Proteases with Catalytic Sites on Opposite Membrane Surfaces in Mitochondrial Inner Membrane of Neurospora crassa Mol. Biol. Cell, September 1, 2001; 12(9): 2858 - 2869. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||