![]() |
|
|
Vol. 11, Issue 9, 3137-3153, September 2000




¶
*Wellcome Trust Centre for Molecular Mechanisms in Disease,
University of Cambridge, Addenbrooke's Hospital, Cambridge CB2 2XY,
United Kingdom;
Department of Physiology and Biophysics,
University of Iowa, Iowa City, Iowa 52242;
Department of
Physiology, University of Queensland, Brisbane, Queensland 4068, Australia; §Lysosomal Diseases Research Unit, Department
of Chemical Pathology, Women's and Children's Hospital, North
Adelaide, South Australia 5006, Australia; and
Institute
of Molecular and Cellular Biology, University of Queensland, Brisbane,
Queensland 4068, Australia
| |
ABSTRACT |
|---|
|
|
|---|
Protein traffic from the cell surface or the
trans-Golgi network reaches the lysosome via a series of
endosomal compartments. One of the last steps in the endocytic pathway
is the fusion of late endosomes with lysosomes. This process has been
reconstituted in vitro and has been shown to require NSF,
and
SNAP, and a Rab GTPase based on inhibition by Rab GDI. In
Saccharomyces cerevisiae, fusion events to the
lysosome-like vacuole are mediated by the syntaxin protein Vam3p, which
is localized to the vacuolar membrane. In an effort to identify the
molecular machinery that controls fusion events to the lysosome, we
searched for mammalian homologues of Vam3p. One such candidate is
syntaxin 7. Here we show that syntaxin 7 is concentrated in late
endosomes and lysosomes. Coimmunoprecipitation experiments show that
syntaxin 7 is associated with the endosomal v-SNARE Vamp 8, which
partially colocalizes with syntaxin 7. Importantly, we show that
syntaxin 7 is specifically required for the fusion of late endosomes
with lysosomes in vitro, resulting in a hybrid organelle. Together,
these data identify a SNARE complex that functions in the late
endocytic system of animal cells.
| |
INTRODUCTION |
|---|
|
|
|---|
Endocytosed proteins that do not recycle to the plasma membrane or
the trans-Golgi network are ultimately delivered to the lysosome. As one of the primary sites for protein degradation, lysosomes are also the recipients of phagocytosed material and autophagized proteins. There are ample data to support the view that
all of these pathways converge in a late endocytic compartment before
fusion with the lysosome (Futter et al., 1996
; Mellman, 1996
; Storrie and Desjardins, 1996
; Bright et al., 1997
).
However, little is known about the molecular mechanisms that mediate
this fusion process.
The process of fusion between late endosomes and lysosomes has been
examined both in vivo and in vitro. This process is characterized by
the formation of a hybrid organelle with intermediate properties of
both compartments, implying that continued efflux of material from this
hybrid is required for the ultimate reformation of dense lysosomes
(Bright et al., 1997
; Mullock et al., 1998
; Luzio
et al., 2000
; Pryor et al., 2000
). An alternative
hypothesis is that late endosomes transfer their cargo to lysosomes by
an abbreviated "kiss-and-run" scenario (Storrie and Desjardins,
1996
). Both of these models, unlike the notion that lysosomes
"mature" from endocytic compartments, rely on a highly specific
fusion event with preexisting lysosomes (Mellman, 1996
). Previous
studies have identified a few molecular players involved in late
endosome and lysosome fusion, such as NSF and a Rab GDI-sensitive
GTPase. However, a better understanding of this overall process will
require more detailed characterization of the proteins that mediate
this specific fusion event (Mullock et al., 1998
).
During the last few years, the SNARE hypothesis has provided a
compelling mechanistic model for a number of fusion events throughout
the secretory and endocytic pathways (Rothman and Warren, 1994
; Rothman
and Wieland, 1996
), with particular combinations of SNAREs mediating
distinct fusion events in vivo (Bennett, 1995
). The SNARE proteins form
a very stable parallel array of coiled-coil domains forming a
four-helix bundle; it is thought that the formation of this complex may
provide some of the energy that drives vesicle fusion (Hanson et
al., 1997
; Poirier et al., 1998
; Sutton et
al., 1998
; Weber et al., 1998
). Because both v-SNARE
and t-SNARE proteins have been found in transport vesicles and target
organelles, it can be more useful to categorize v- and t-SNAREs as R-
and Q-SNAREs, respectively, according to their structural composition
(Fasshauer et al., 1998
; Sutton et al., 1998
).
Although the stoichiometry of the core complex may differ depending on
the particular set of SNARE proteins (Carr et al., 1999
;
Ungermann et al., 1999
), in general, v-SNAREs contribute a
critical arginine residue in the interior of the bundle that is aligned
with glutamine residues contributed by each of the three helices from
the t-SNAREs to form a core complex (Sutton et al., 1998
).
What remains unclear about SNARE-mediated transport steps, however, is
exactly which steps are mediated by some of the more recently described
SNARE proteins as well as what regulates the specificity of these
steps, especially throughout the endocytic pathway, where the role of vesicular transport is less certain.
In Saccharomyces cerevisiae, the process of vacuolar
biogenesis parallels that of lysosomal biogenesis in mammalian cells (Bryant and Stevens, 1998
). Many of the t-SNARE proteins that act at
discrete trafficking steps along the mammalian secretory pathway
display the greatest level of identity with the yeast t-SNARE that
functions in an analogous step (i.e., Sed5p is most similar to syntaxin
5, and Sso1p/Sso2p are most similar to syntaxins 1-4) (Aalto et
al., 1993
; Banfield et al., 1994
; Rowe et
al., 1998
). It is likely that similar parallels will be found in
the endocytic pathway. The yeast syntaxin Vam3p has been localized to
the yeast vacuole and is required for the delivery of vacuolar proteins
that follow a variety of membrane trafficking pathways (Darsow et
al., 1997
; Piper et al., 1997
; Wada et al.,
1997
). Vam3p is required for homotypic vacuole fusion (Nichols et
al., 1997
; Ungermann et al., 1998
), fusion of endosomal
compartments and prevacuolar autophagic organelles with the vacuole
(Darsow et al., 1997
), and fusion of a new type of transport
intermediate that carries the membrane protein alkaline phosphatase to
the vacuole (Piper et al., 1997
; Rehling et al.,
1999
). Recently, a Vam3-related protein was identified in
Arabidopsis thaliana that is likely to have similar
functions to the yeast Vam3p, given its localization to the plant
vacuole. Because of the prominent role of Vam3p in a variety of fusion
events with the vacuole, we sought to identify a t-SNARE from mammalian
cells that may functionally correspond to Vam3p. With this aim, we
identified mammalian syntaxin 7 with the highest level of homology to
S. cerevisiae and A. thaliana Vam3 proteins.
Syntaxin 7 (Syn7) was originally proposed to participate in traffic
from the trans-Golgi network to the endocytic system based
on its sequence similarity to Pep12p (Wang et al., 1997
);
and partial colocalization of Syn7 with markers of early endosomes
suggested a role in fusion events within the early endocytic system
(Wong et al., 1998b
). Our studies, however, show that Syn7
is concentrated in late endosomes and lysosomes and can be isolated in
a complex with Vamp 8. Importantly, we find that Syn7 is required for
the fusion of late endosomes with lysosomes with the use of an in vitro
content-mixing assay. Together, these data suggest that Syn7 plays a
pivotal role in the final steps of lysosomal biogenesis.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials
Enzymes used in DNA manipulations were from New England Biolabs (Beverly, MA), Boehringer Mannheim Biochemicals (Indianapolis, IN), Bethesda Research Laboratories (Gaithersburg, MD), or United States Biochemical (Cleveland, OH). Radioactive materials were purchased from New England Nuclear (Boston, MA), and nitrocellulose membranes were from Micron Separations Inc. (Westborough, MA). All tissue culture reagents were from Life Technologies (Gaithersburg, MD). Bicinchoninic acid protein reagent was from Pierce (Rockford, IL). Glutathione-agarose beads were from Pharmacia (Uppsala, Sweden). Fixed Staphylococcus aureus cells (IgG Sorb) were purchased from the Enzyme Center (Walden, MA). All other chemicals were of high-purity commercial grade. Oregon Green- and Texas Red-conjugated goat anti-rabbit and anti-mouse secondary antibodies, biotinylated anti-rabbit antibodies, and Alexa 488-conjugated streptavidin were purchased from Molecular Probes (Eugene, OR). FITC- and Texas Red-conjugated donkey anti-rabbit and anti-goat secondary antibodies were purchased from Jackson Laboratories (West Grove, PA). HRP-conjugated goat anti-rabbit immunoglobulin G (IgG) and ECL detection kits were from Amersham (Arlington Heights, IL).
DNA and Plasmid Constructions
DNA manipulations and DNA-mediated transformation were performed
by routine procedures (Sambrook et al., 1989
). A BLAST
search through the Merck/Washington University expressed sequence tag database revealed several putative ORFs that encoded proteins related
to Vam3p (Altschul et al., 1990
). We amplified one of these
(H33185) with the oligonucleotides CCATTTCCAGAGTATCGGGTGGC and
TCTATGCTCTCAATAACATCTCC. This PCR fragment was used to probe a mouse
3T3-L1 cDNA library as described previously (Tellam et al.,
1997
). A full-length clone was isolated and sequenced to reveal an ORF
of 266 amino acids (GenBank accession number AFO56323). Sequence
comparison analysis was performed with the DNASTAR (Madison, WI)
MegAlign software with the use of the Clustal algorithm.
The plasmid pGSTSyn7a encoding a GST-Syn7 fusion protein was made by
PCR amplifying codons 2-242 of the Syn7 ORF and subcloning the
fragment into the BamHI-EcoRI sites of pGEX-3X
with the use of the oligonucleotides CACAGGATCCAGTCTTACACTCCGGGGATTGG
and CTCCAATTCTAAGTTTTCCTGGATTTGCGCTGA (Smith and Johnson, 1988
). The
plasmid pCWS002 encoding a GST-Vamp 8 protein was made by reverse
transcription-PCR amplifying codons 1-76 of the mouse Vamp 8 ORF and
subcloning the fragment into the BamHI-Xho sites
of pGEX-4T3 with the use of the oligonucleotides CCGGGATCCATGGAGGAGGCCAGTGGG and CCGCTCGAGTTACATCTTCACATTCTTCCA. Northern analysis on whole RNA was conducted as described previously with the use of the entire cDNA as probe or with a
glyceraldehyde-3-phosphate dehydrogenase cDNA probe as an internal
control (Tellam et al., 1997
).
An expression plasmid (pRCP316) that expressed a hemagglutinin (HA) epitope-tagged Syn7 was made by amplifying the complete ORF of mouse Syn7 with the oligonucleotides ATGTATCCTTACGACGTACCAGATTACGCATACCCCATATGATGTTCCTGACTATGCGTCTTACACTCCGGGGATTGGT and TCAGCCTTTCAGTCCCCATACGA and subcloning the resulting fragment into pCDNA-V5-6XHIS (Invitrogen, Carlsbad, CA). Both strands of the resulting construct were sequenced for orientation and fidelity of amplification. The resulting plasmid expressed the Syn7 ORF preceded by two tandem repeats of the HA epitope (YPYDVPDYAG).
A GST-syntaxin 13 (Syn13) fusion construct encoding amino acids 1-243 of rat Syn13 was kindly provided by Dr. Rohan Teasdale (Monash Medical Center, Melbourne, Australia).
Antibodies
Polyclonal anti-GST antibodies and polyclonal and monoclonal anti-Syn7 antibodies were raised against the GST-Syn7 fusion protein encoded by pGSTSyn7a. Anti-Vamp 8 antibodies were raised against the GST-Vamp 8 fusion protein encoded by pCWS002.
The bacterial fusion proteins were purified over glutathione-agarose
and eluted with 25 mM glutathione as reported previously (Smith and
Johnson, 1988
). Two rabbit polyclonal antibodies (#1 and #2) and one
goat polyclonal antibody to Syn7 were raised and were purified
similarly. Rabbit immunizations were performed as described previously
(Roberts et al., 1989
). Serum from immunized animals was
subjected to a series of affinity purification steps to yield specific
antibodies to GST and Syn7. Serum was first passed over an Affigel
column (Affigel 10 and Affigel 15, Bio-Rad, Hercules, CA) to which GST
was attached. Anti-GST antibodies were eluted in 0.2 M glycine, pH 2.5, and dialyzed in three changes of PBS. The remaining serum that was
depleted of anti-GST antibodies was then applied to another Affigel
column to which the GST-Syn7 fusion protein was attached. Antibodies
were eluted in 0.2 M glycine, pH 2.5, and dialyzed in three changes of
PBS. Monovalent Fab fragments of rabbit anti-Syn7#2 IgG were prepared
according to Coulter and Harris (1983)
and then affinity purified like
the intact antibodies. Antibodies specific to Vamp 8 were purified
similarly. One antiserum raised against the C-terminal tail of the
cation-independent mannose-6-phosphate receptor (CI-MPR) was a kind
gift from Dr. Gwyn Gould (University of Glasgow, Glasgow, Scotland),
and a second was as described previously (Reaves et al.,
1996
). Affinity-purified anti-Rab7 rabbit polyclonal antibodies were a
kind gift of Marino Zerial (EMBL, Heidelberg, Germany). mAbs to the
transferrin receptor were purchased from Zymed Laboratories (San
Francisco, CA) and Chemicon (mAb 1451; Temecula, CA). Monoclonal
anti-syntaxin 6 and anti-early endosome-associated protein 1 (EEA1)
antibodies were purchased from Transduction Laboratories (Lexington,
KY). mAbs to the HA epitope were purchased from BAbCO (Berkeley, CA). Polyclonal anti-syntaxin 6 antibodies were affinity purified over a
GST-syntaxin 6 affinity column as described previously (Tellam et al., 1997
). mAbs to rat lgp120 were as described
previously (Grimaldi et al., 1987
; Reaves et al.,
1996
). Rabbit polyclonal antibodies to rat lgp120 were a gift from
Keitaro Kato, Yoshitake Tanaka, and Masaru Himeno (Kyushu
University, Fukuoka, Japan) (Furuno et al., 1989
).
Anti-Syn13 antibodies were raised against the GST-Syn13 fusion protein
or were a gift of Marino Zerial. Rabbit polyclonal antibodies to EEA1
were used as described previously (Mu et al. 1995
).
Anti-Syn13 antibodies were raised against the GST-Syn13 fusion protein
(antiserum 4972) or were a kind gift from Marino Zerial.
For the production of the monoclonal anti-Syn7 antibody Syn7.1C3,
hybridoma cell lines were produced and characterized as described
previously (Brooks et al., 1997
). Positive clones were screened for reactivity to the GST-Syn7 fusion protein by ELISA and
assessed for specificity by screening for reactivity to GST-Syn13 and
GST fusion proteins. Hybridoma culture supernatant was purified on a
0.1-ml protein G cartridge (Pharmacia) and eluted with 0.1 M
NaH2PO4, pH 2.5, into 100 µl of 1 M Na2HPO4, pH
9.0, and then dialyzed against three changes of PBS.
Cell Culture
Madin-Darby canine kidney (MDCK) cells and normal rat kidney (NRK) cells were grown at 37°C in an atmosphere of 5% CO2 in DMEM supplemented with 10% FCS, 2 mM L-glutamine, 100 U/l penicillin, 100 mg/l streptomycin, and 0.1 mM MEM nonessential amino acid solution. Cells were grown to near confluence in either 150-mm culture dishes for membrane preparation and cryosection immunoelectron microscopy or on coverslips for immunofluorescence microscopy.
WIF-B cells were grown as described (Ihrke et al., 1993
)
with some modifications. Briefly, cells were grown in Cassio
modified Ham's F12 medium (GIBCO/BRL, Grand Island, NY) supplemented
with 10 µM hypoxanthine, 0.04 µM aminopterin, 1.6 µM thymidine,
and 3.5% FCS (Hyclone, Logan, UT). For experiments, cells were plated on glass coverslips at 0.8-1.2 × 106
cells/cm2 and cultured until they had reached
maximal polarization (10-14 d after plating).
For transfection studies, cells were grown until 50% confluent and washed three times in sterile PBS. DNA was transfected with Lipofectamine according to the manufacturer's directions (Life Technologies) for 10 h in serum-free DMEM. Transfection medium was replaced with DMEM containing 10% FCS, and cells were allowed to incubate for an additional 48 h. Cells were then cultured in 1 mg/ml geneticin for 10 d, after which colonies were isolated and screened for expression of HA epitope-tagged Syn7.
Cell Fractionation
Whole cell extracts and whole membrane fractions were prepared
from rat tissues that were dissected and stored at
85°C. Tissues were minced in PBS containing PMSF, leupeptin, and
-tosyl-L-lysine chloromethyl ketone hydrochloride
at 4°C and then homogenized by 25-30 strokes with a Teflon/glass
Dounce. After a 1500 × g spin for 2 min, the
supernatant fractions were solubilized in Laemmli sample buffer to make
whole cell extracts.
Isolation of rat liver fractions enriched in late endosomes, hybrid
organelles, or lysosomes was performed as described previously (Mullock
et al., 1998
). Briefly, endosome/lysosome hybrid organelles formed after the content-mixing assay incubation were isolated at the
20% Nycodenz/20% Ficoll interface of a step gradient. Electron-dense lysosomes were collected from a preparative 45%/20% Nycodenz step gradient. Late endosomes were isolated from a preparative 1-22% Ficoll gradient.
Immunofluorescence
Immunofluorescence on MDCK cells was performed with cells that were grown on glass coverslips until 50% confluent. Cells were fixed for 20 min in 2% paraformaldehyde in PBS at 25°C and permeabilized for 15 min in 0.2% Triton X-100 containing 50 mM glycine. Cells were washed in PBS containing 2% donkey serum and labeled with primary antibodies for 1 h at 25°C. After this incubation, the cells were washed three times in PBS for 5 min and then incubated for 30 min with conjugated secondary antibodies diluted at 1:250 in PBS containing 1% donkey serum. For double-labeling experiments with the use of rabbit anti-Syn7 antibodies in combination with a mouse mAb, Oregon Green-conjugated goat anti-rabbit and Texas Red-conjugated goat anti-mouse secondary antibodies were used. For double-labeling experiments with the use of goat anti-Syn7 antibodies in combination with a rabbit polyclonal antibody, FITC-conjugated donkey anti-goat and Texas Red-conjugated donkey anti-rabbit secondary antibodies were used. After this incubation, the cells were washed three times in PBS for 5 min and the coverslips were mounted onto slides in mounting medium (50% glycerol/1% N-propyl gallate in PBS).
As a test for the specificity of immunofluorescence labeling, parallel antibody solutions, containing a 1:300 dilution of rabbit or goat anti-Syn7 primary antibodies in PBS with 5% donkey serum, were incubated with no additions or 300 µg/ml purified GST-Syn13 fusion protein or 300 µg/ml GST-Syn7 fusion protein at room temperature for 2 h. Antibody solutions were then used to label parallel coverslips of MDCK cells. Photography was performed with the use of a set exposure and the same normalization settings.
For immunofluorescence localization in transfected NRK cells, cells
were grown on coverslips until 50% confluent. Cells were washed three
times in PBS at 25°C and then fixed in 100% methanol for 20 min at
20°C. Cells were then labeled with primary and secondary antibodies
as described above.
Polarized WIF-B cells grown on coverslips were fixed for 2 min in 3% paraformaldehyde/0.05% glutaraldehyde in PBS in the presence of 0.2% sodium metabisulfite at 37°C, rinsed with PBS, and incubated with 0.5% sodium borohydride for 10 min at room temperature. Cells were incubated in 1% BSA/0.1% saponin in PBS for 30 min and then incubated for 1 h with primary antibodies diluted in 0.5% BSA/0.25% saponin in PBS. The rabbit anti-Syn13 antiserum (number 4972, 1:200) contained 300 µg/ml GST (preincubated for 30 min before adding to cells). Purified mouse IgG to Syn7 and affinity-purified anti-Vamp 8 were used at 10 µg/ml; mouse ascites fluid to lgp120 and mAb 1451 to the transferrin receptor were diluted 1:400 and 1:50, respectively; rabbit antiserum to lgp120 was diluted 1:300. After washes with PBS, the cells were incubated for 30 min with FITC- or Cy3-conjugated secondary antibodies (at 10 and 4 µg/ml, respectively). Cells were mounted in Prolong Antifade (Molecular Probes).
Images were captured with a Hamamatsu (Shizuoka, Japan) ORCA
charge-coupled device camera mounted on an Olympus (Tokyo, Japan) BX-60
microscope equipped with a 60× oil objective (numerical aperture 1.4).
In instances stated, a 4-µm z series was collected with a z-step of
0.1 µm (40 sections total) with a Ludl (Hawthorne, NY)
z-stepper for each fluorophore. Image stacks were then subjected to a constrained iterative deconvolution algorithm (Agard et
al., 1989
) with the use of Microtome software (Vaytek, Fairfield,
IA) and empirically determined point spread functions with the use of
blue, green, and red fluorescent 0.2-µm microspheres (Molecular Probes). Paired sets of 10 images from each stack (1 µm thick) were
combined by making maximum point projections and then overlaying the
images with the use of Adobe Photoshop (Adobe Systems, Mountain View,
CA). Alternatively, confocal images were taken with a Leica (Bucks
Milton Keynes, UK) TCS SP system, a Zeiss (Thornwood, NY) LSM
510 laser scanning microscope, or a Bio-Rad laser scanning system, all
equipped with 63× Plan-Apo objectives (numerical aperture 1.4). Images
were collected at a resolution of 1024 × 1024 pixels. Adobe
Photoshop software was used for image processing.
Immunogold Electron Microscopy on Isolated MDCK Membranes and Rat Liver Membranes
Preparation of membranes before fixation was performed at
0-4°C with the use of a procedure described previously (Martin
et al., 1996
). MDCK cells were washed three times in HES
buffer (20 mM HEPES, 250 mM sucrose, 1 mM EDTA, pH 7.4), scraped in HES
buffer (5 ml) containing protease inhibitors (10 µg/ml leupeptin, 10 µg/ml aprotinin, 250 µM PMSF), and homogenized by 10 passes through a 22-gauge needle. A postnuclear supernatant was obtained by
centrifugation at 9600 × g (SS-34 rotor, Sorvall
Instruments, Wilmington, DE); it was then layered onto a 1.5 M sucrose
cushion (containing 20 mM HEPES, pH 7.4, and 1 mM EDTA) and centrifuged
at 154,000 × g (SW-41 rotor, Beckman Instruments,
Fullerton, CA) for 1 h. The intracellular membrane fraction above
the 1.5 M sucrose cushion was recovered and immediately fixed in a
final concentration of 2% paraformaldehyde and stored at 4°C.
Formvar-coated carbon-stabilized grids were layered onto 10-µl drops
of paraformaldehyde-fixed intracellular membranes for 10 min. Grids
were incubated sequentially on 0.02 M glycine/PBS (four times) and
0.1% BSA/PBS. Grids were then incubated for 30 min with 5-µl drops
of primary antibody diluted 1:50 in 1% BSA/PBS. After the first
primary antibody incubation, the grids were washed in 0.1% BSA/PBS
(four times) and then incubated for 20 min with 5-µl drops of
colloidal gold conjugated to protein A (Electron Microscopy Sciences,
Fort Washington, PA) diluted in 0.1% BSA/PBS. The grids were then
washed in PBS (four times) and fixed with 1% glutaraldehyde for 5 min.
When double labeling was performed, the grids were washed sequentially
in 20 mM glycine/PBS (four times) and then returned to the 0.1%
BSA/PBS step; the second primary antibody was then incubated, followed
by incubation with a second protein A-gold conjugate and
glutaraldehyde fixation. The grids were then washed in ultrapure
H2O (seven times) and stained with uranyl
acetate:methyl cellulose (1:9; 4% uranyl acetate in 0.15 M oxalic
acid, pH 7-8, 2% methyl cellulose) for 10 min on ice. Grids were
dried and visualized with the use of a transmission electron
microscope. The order of primary antibody incubations in double-label
experiments was alternated to determine if a particular antigen was
compromised by glutaraldehyde treatment. We did not observe any affect
of glutaraldehyde fixation on the antigens used, because the same level
of labeling (number of gold particles per structure) was observed for
all antibodies both before and after glutaraldehyde treatment. The
specificity of double labeling was checked by omitting the second
primary antibody and confirming the absence of the second gold
conjugate. Random fields were quantitated in terms of the number of
gold particles and the morphology of the labeled structure.
Specifically for the analysis in Table 1,
we quantitated the average number of Syn7-specific gold particles per
distinct membrane structure. This was also performed for structures labeled for Rab7, CI-MPR, EEA1, and Vamp 8. To calculate the percentage of colocalization, we then quantitated the percentage of structures that were positive for Syn7 labeling that were also positive for one of
the other markers and vice versa.
|
Immunoelectron microscopy of the late endosome, hybrid, and lysosome
fractions was performed as described previously (Mullock et
al., 1998
) with the use of the rabbit anti-Syn7 or anti-Vamp 8 antibody at a dilution of 1:50 followed by protein A conjugated to
15-nm colloidal gold (Department of Cell Biology, University of
Utrecht, Utrecht, The Netherlands). The asialofetuin
(ASF)-avidin content of late endosomes and hybrids was sequentially
immunolabeled with 8-nm colloidal gold as described previously (Mullock
et al., 1998
). Quantitation of anti-Syn7 labeling and
anti-Vamp 8 labeling per micrometer on the boundary membranes of
organelles was performed with the use of intersections with a lattice
overlay method (Griffiths, 1993
). Late endosomes and hybrids were
defined by their content of ASF-avidin, and random micrographs of the
lysosome preparations were scored by their electron-dense morphology.
Electron Microscopy on Ultrathin Cryosections
MDCK cells were fixed in 8% paraformaldehyde in 0.1 M phosphate
buffer, pH 7.35, for 1 h at 25°C. They were then washed with 0.2 M phosphate buffer, scraped from the culture dish, and pelleted at
10,000 rpm in a microfuge. Cells were resuspended in warm gelatin (10%
in phosphate buffer) and repelleted at maximum speed in the microfuge.
After cooling, the gelatin-embedded cells were infiltrated with
polyvinylpyrrolidone-sucrose overnight at 4°C and then processed for
frozen sectioning as described previously (Parton et al., 1997
). Ultrathin frozen sections (60-80 nm) were labeled,
stained, and viewed (JEOL 1010, Center for Microscopy and
Microanalysis, University of Queensland) according to published
techniques (Parton et al., 1997
) with the use of
gold-conjugated protein A.
Late Endosome-Lysosome Fusion Assays
Rat liver late endosomes loaded in vivo with avidin-ASF
conjugate and rat liver lysosomes loaded in vivo with
125I-labeled biotinylated polymeric
immunoglobulin A (125I-bpIgA) were resuspended
separately in pig brain cytosol as described by Mullock et
al. (1998)
. Antibody in a total volume of 200 µl was added to
each membrane suspension to give a final volume of 700 µl. After 15 min on ice, 100-µl samples of the antibody-treated endosomes and
lysosomes were used in the standard late endosome-lysosome fusion
assay in a final volume of 240 µl for 10 min at 37°C (Mullock et al., 1998
).
Immunoprecipitations
MDCK cells were washed three times in HES buffer, scraped in HES buffer (5 ml) containing protease inhibitors (10 µg/ml leupeptin, 10 µg/ml aprotinin, 250 µM PMSF), and homogenized by 10 passes through a 22-gauge needle. A postnuclear supernatant was obtained by centrifuging the homogenate at 5000 × g for 5 min. One volume of PBS containing 2% Triton X-100 was added to the postnuclear supernatant, which was then centrifuged at 100,000 × g at 4°C (TLA-45 rotor, Beckman Instruments) for 40 min. The supernatant (protein concentration, 100 µg/ml) was then divided, and anti-Syn7 or anti-GST antibodies were added and incubated on ice for 6 h. Fifty microliters of a 50% slurry of IgG Sorb was then added followed by incubation for 45 min on ice. The immunoprecipitate was separated by centrifugation and washed three times with PBS containing 0.1% Triton X-100.
| |
RESULTS |
|---|
|
|
|---|
Syn7 Is Similar to Vam3p and Is Widely Expressed
After conducting a BLAST search of the Merck/Washington University
expressed sequence tag database, several candidate mammalian homologues
of the yeast vacuolar syntaxin Vam3p were identified. One expressed
sequence tag that described a candidate cDNA (GenBank accession number
H33185) was PCR amplified and used to screen a mouse cDNA library from
which we recovered a clone encoding a 266-amino acid protein with a
high level of identity to the human and rat sequences for Syn7, also
known as TSL-5 (Bock and Scheller, 1997
; Weimbs et al.,
1997
; Wong et al., 1998b
). Of the non-mammalian syntaxins,
Syn7 shows the highest level of identity (30%) with the Vam3p and
Pep12p homologues from A. thaliana, AtVam3 and AtPep12,
respectively (da Silva Conceicao et al. 1997
; Sato et
al. 1997
; Sanderfoot et al. 1998
). Overall, Syn7 shows
the most homology (50%) with mammalian Syn13, a syntaxin confined mainly to the early endosome, indicating that these isoforms may have
related functions in the endocytic pathway (Prekeris et al., 1998
; McBride et al., 1999
). Consistent with this is the
observation that in A. thaliana AtVam3 shares 65% identity
with AtPep12p. Furthermore in yeast, both Pep12p and Vam3p also occupy
the endocytic system, and despite the fact that they indeed have
distinct functional roles, high-level expression of one of these
syntaxins can partially substitute for the function of the other
(Darsow et al., 1997
; Gotte and Gallwitz, 1997
). Thus, by
sequence comparisons alone, it would appear that Syn7 and Syn13
represent a pair of similar syntaxins that would have a role in the
endocytic system as AtVam3 and AtPep12 have in A. thaliana
and as Vam3 and Pep12p have in S. cerevisiae. Given that
Pep12p and Syn13 have been shown to function in fusion events to the
endosome, we decided to test whether Syn7, like Vam3p, participates in
fusion events in the late endosomal/lysosomal system (Becherer et
al. 1996
; McBride et al., 1999
).
As a first step in this analysis, we produced both rabbit and goat
affinity-purified polyclonal antibodies with the use of a GST fusion
protein comprising the entire cytosolic tail of Syn7. The polyclonal
anti-Syn7 antibodies recognized a single ~38-kDa protein that was
expressed in all tissues examined (Figure
1). Syn7 levels were highest in brain and
kidney. These levels correlated with the level of Syn7 mRNA within
these tissues. The level of similarity between Syn7 and Syn13
presented the possibility that the anti-Syn7 antibodies could
cross-react with Syn13. To ensure the specificity of the antibodies, we
found that preincubation of either of the rabbit polyclonal anti-Syn7
antibodies or the goat anti-Syn7 antibody with a GST-Syn7 fusion
protein but not a GST-Syn13 fusion protein abolished
immunoblot reactivity. Similar results were obtained in
immunolocalization experiments (see below). A mAb to Syn7 (Syn7.1C3)
was also generated and recognized a single ~38-kDa protein in MDCK
cells. Characterization of Syn7.1C3 by ELISA revealed reactivity with
the GST-Syn7 fusion protein but not with the GST-Syn13 fusion
protein.
|
Syn7 Is Localized to Late Endosomal/Lysosomal Structures by Immunofluorescence
To facilitate our localization studies of Syn7, we surveyed
various cell types in culture for high levels of endogenous Syn7 expression. As shown in Figure 1A, high levels were found in MDCK cells. Thus, we initiated our immunofluorescence localization studies
in MDCK cells with the use of both the rabbit and goat affinity-purified anti-Syn7 polyclonal antibodies (Figure 1, E-M). To
ensure the specificity of the immunolabeling procedure, we labeled MDCK
cells in the presence of either a GST-Syn7 fusion protein or a
GST-Syn13 fusion protein. No change in the labeling pattern or the
intensity of labeling was observed when the GST-Syn13 fusion protein
was included during the primary antibody incubation; however, labeling
was completely abolished with the inclusion of the GST-Syn7 fusion
protein (Figure 1, E-J). In a series of double-labeling experiments
(Figure 1, K-M), Syn7 labeling in MDCK cells was seen in intracellular
structures that were most prominent in the perinuclear region but were
also found throughout the cells. There was little overlap between Syn7
and syntaxin 6, a trans-Golgi network marker (Bock et
al., 1997
). The labeling pattern for Syn7 was quite distinct from
that of the early endosome marker EEA1, which is generally concentrated
in sorting endosomes in MDCK cells (Mu et al., 1995
;
Stenmark et al., 1996
). Some overlap with Syn7 labeling was
observed in double-labeling experiments with transferrin receptor
(TfR), a more general marker of the recycling endocytic system.
However, the extent of colocalization with TfR was poor because a
considerable amount of labeling was observed in TfR-negative
structures. In contrast, we found the highest level of colocalization
was with the CI-MPR, which is concentrated in late endosomes in MDCK
cells (Griffiths et al., 1988
).
Because of the overlap of Syn7 with the CI-MPR in MDCK cells, we
examined the distribution of Syn7 in relation to lgp120, a
well-established marker of late endosomes and lysosomes (Lewis et
al., 1985
). Antibodies to lgp120 available to us did not
cross-react with MDCK cells, and because we subsequently wanted to use
a cell-free late endosome-lysosome fusion system from rat liver, we
chose to examine Syn7 in WIF-B cells. WIF-B is a hepatic cell line that possesses many of the characteristic features of polarized hepatocytes, including the formation of the apical bile canalicular membrane (Ihrke
et al., 1993
; Shanks et al., 1994
). We also took
further steps to ensure the specificity of our labeling procedure with the use of a mAb raised against the cytosolic domain of Syn7
(Syn7.1C3). This mAb also recognizes a single 38-kDa protein in MDCK
cell membrane fractions, and the binding of the antibody was
specifically competed with GST-Syn7 fusion protein but not with
GST-Syn13 fusion protein. Figure 2 shows
that Syn7 was concentrated within the perinuclear region of WIF-B
cells, well away from the periphery of the cell, where early endosomes
are typically located. Double labeling for lgp120 showed a high level
of colocalization in vacuolar structures. In contrast, Syn13 showed
very little colocalization with lgp120 but extensive overlap with TfR,
consistent with previous analyses indicating that Syn13 populates early
endosomes and catalyzes early endosome homotypic fusion (Prekeris
et al., 1998
; McBride et al., 1999
).
|
Although in the studies described above of MDCK and WIF-B cells we used
polyclonal and monoclonal antibodies that do not cross-react with Syn13
or other syntaxins with molecular weights different from that of Syn7
(Figure 1), we could not completely eliminate the possibility that our
antibodies cross-reacted with another protein in our immunofluorescence
studies. Therefore, we chose to localize an epitope-tagged version of
Syn7 in which we inserted two HA epitopes immediately after the
initiation codon. The site for tag insertion has been used with a
variety of other syntaxins and in those cases did not result in
missorting of the syntaxin (Banfield et al., 1994
; Advani
et al., 1998
; Carr et al., 1999
). To analyze the
distribution of epitope-tagged Syn7, we chose a cell line (NRK) in
which the various compartments of the endocytic system can be
distinguished morphologically and in which the localization and
biogenesis of lysosomes have been characterized extensively (Bright
et al., 1997
). A stable clonal NRK cell line (NRK-K2) was
isolated after transfection with a plasmid (pRCP316) encoding HA-tagged
Syn7 and subsequent screening for G418-resistant cells. Western blot
analysis of whole cell extract from NRK-K2 cells showed that the
HA-tagged Syn7 was expressed as a single species with an apparent
molecular mass ~ 3 kDa larger than endogenous Syn7 (Figure 1D).
Immunoblotting the same extract with anti-Syn7 antibody
showed that the level of the epitope-tagged Syn7 was far less than that
of the endogenous Syn7 (Figure 1D). As shown in Figure
3, the HA-Syn7 was distributed in large
intracellular structures around the nucleus that showed significant
overlap with lgp120. In contrast, very little overlap was observed
between HA-Syn7 and TfR (which was found within a large tubular
network). Furthermore, labeling of HA-Syn7 was distinct from that of
EEA1 and Syn13, both of which were found in punctate structures
throughout the cytoplasm. The observation that epitope-tagged Syn7
colocalized with lgp120 agrees well with the localization of endogenous
Syn7 in MDCK and WIF-B cells.
|
Syn7 Is Localized to Late Endosomes and Lysosomes by Immunoelectron Microscopy
The colocalization of Syn7 with lgp120 by immunofluorescence in
WIF-B and NRK cells indicated that a significant proportion of Syn7 is
localized to late endosomes and lysosomes. Yet the lower levels of Syn7
coinciding with TfR-containing compartments by immunofluorescence
(Figure 1K) in MDCK cells indicated that some Syn7 may also occupy
earlier endosomal compartments. To characterize further the
intracellular localization of Syn7 in MDCK cells, we examined ultrathin
cryosections and isolated membranes by immunogold electron microscopy.
Specific labeling for Syn7 was observed in the perinuclear region of
the cell associated with multivesicular endosomes (Figure
4A). In addition, labeling was often
observed on small tubulovesicular structures in close association with these multivesicular endosomes. However, despite the use of only the
mild fixative paraformaldehyde, labeling on cryosections was invariably
low. This proved problematic for convincing double-labeling experiments, so we adopted a procedure previously used to analyze GLUT-4-containing vesicles (Martin et al., 1996
). A
postnuclear supernatant was prepared from MDCK cells, fixed in
paraformaldehyde, adsorbed to Formvar-coated grids, and labeled with
antibodies to Syn7, CI-MPR, Rab7, and Vamp 3 (cellubrevin). Specific
labeling for Syn7 was observed on large, electron-dense, multivesicular structures (Figure 4, B-D) that were similar to those structures labeled on cryosections. A large proportion of the structures that were
positive for Syn7 labeling also showed labeling for the late endosome
marker CI-MPR (Griffiths et al., 1988
). In contrast, only a
minor proportion of the structures that were positive for Syn7 showed
labeling for EEA1 (Table 1), and most of the EEA1 labeling was
restricted to small electron-lucent structures, confirming that the
bulk of Syn7 and EEA1 occupy different compartments.
|
We also examined the distribution of Syn7 in late endosomes and
lysosomes isolated from rat liver (Figure
5, A and C) not only to confirm the
localization of Syn7 that we observed in lgp120-positive structures in
the hepatocyte WIF-B cell line but also because we used a cell-free
late endosome-lysosome fusion reaction with the use of membranes
derived from liver cells (see below). In addition, we examined the
distribution of Syn7 in hybrid organelles formed after the in vitro
late endosome-lysosome fusion assay (Figure 5B). Based on our previous
pulse-chase studies with endocytosed ASF-avidin in whole livers, we
prepared liver membrane fractions from rats that had been injected with
ASF-avidin 6 min before killing, because this procedure results in the
enrichment of ASF-avidin in multivesicular late endosomes (Mullock
et al., 1994
, 1998
). Quantitation of ASF-avidin in these
structures showed that there were 33 gold
particles/µm2 compared with 0.5 gold
particles/µm2 over other tissue components of
the pellet, thus defining late endosomal structures. Lysosomes and late
endosome-lysosome hybrids were identified in enriched fractions by
their characteristic morphology. As shown in Figure 5, late endosomes,
hybrids, and lysosomes showed significant labeling for Syn7, with the
highest labeling seen on lysosomes (Figure 5D). Together, these data
show that Syn7 is enriched in late endosomes and lysosomes. However, these data do not exclude the possibility that lower levels of Syn7 are
distributed in earlier endocytic compartments. Therefore, we embarked
on functional studies aimed at substantiating the proposed role of Syn7
in mediating fusion events to the late endosome.
|
Antibodies to Syn7 Inhibit the Fusion of Late Endosomes with Lysosomes
Given the distribution of Syn7, we sought to determine whether
Syn7 played a role as a t-SNARE that can coordinate specific fusion
events between late endosomes and lysosomes. Previous studies have
established an in vitro system that reconstitutes one of the last steps
in lysosomal biogenesis, i.e., the fusion of late endosomes with
lysosomes. This assay measures content mixing between distinct
compartments containing either ASF-avidin or
125I-bpIgA by immunoprecipitating the avidin and
quantitating the level of bound 125I-bpIgA.
Labeled late endosomes are obtained from rat livers allowed to uptake
ASF-avidin for 6 min, whereas labeled lysosomes are obtained by
allowing uptake of 125I-bpIgA for 30 min. Fusion
between these two compartments has been shown to require ATP and
cytosol and is dependent on NSF and Rab proteins (Mullock et
al., 1994
, 1998
).
Both the late endosome and lysosome fractions were labeled with
anti-Syn7 antibodies (Figure 5, A-C), and therefore both were treated
with anti-Syn7 antibodies before the fusion reaction. We found that a
15-min preincubation at 4°C of the late endosomes and lysosomes with
affinity-purified anti-Syn7 antibody significantly inhibited content
mixing between these compartments after the reaction was initiated by
combining fractions and incubating at 37°C. With the use of
affinity-purified antibodies from two separate rabbit anti-Syn7
antisera (#1 and #2), the inhibition was dose-dependent and specific to
anti-Syn7 antibodies (Figure 6A).
Antibodies to the CI-MPR cytosolic tail had no effect at the same
concentrations. In our initial experiments, we used the anti-Syn7 that
was purified from the first rabbit we immunized (anti-Syn7#1). At the
highest concentration used (80 µg/ml), we observed a 45% inhibition
of fusion. However, increasing the antibody concentration in hopes of
achieving complete inhibition was technically difficult. Therefore, we
tested antibodies raised in additional animals. One such antibody was
the goat anti-Syn7, which resulted in consistent and specific inhibition but which had a lower specific inhibitory activity than the
affinity-purified rabbit anti-Syn7#1. Another rabbit antibody against
Syn7 (anti-Syn7#2) proved to have an approximately fourfold higher
level of specific inhibitory activity, yielding 48% inhibition at only
20 µg/ml and complete inhibition at and above 40 µg/ml. All three
affinity-purified polyclonal antibody preparations were specific for
Syn7 by immunoblotting. Neither an anti-syntaxin 6 antibody nor an anti-GST antibody purified in an identical manner nor
anti-Syn7 antibodies that had been preincubated with the GST-Syn7
fusion protein affected the content-mixing assay (Figure 6B). Steric
hindrance was not responsible for the inhibition by anti-Syn7
antibodies because monovalent Fab fragments prepared from the most
inhibitory rabbit polyclonal antibody (anti-Syn7#2) also inhibited
fusion by >70% at 45 µg/ml (Figure 6B).
|
Syn7 Complexes with the Endocytic v-(R)-SNARE Vamp 8
Because it is a syntaxin (Q-SNARE), we would predict that Syn7
would specifically complex with a subset of v-SNARE proteins (R-SNARE)
to mediate fusion events with the late endosome and lysosome. Thus, in
an effort to identify a putative v-SNARE partner for Syn7, we once
again exploited the analogy between the yeast syntaxin, Vam3p, and its
putative mammalian counterpart, Syn7. The work of Wickner and
colleagues (Nichols et al., 1997
; Ungerman et
al., 1998
, 1999
) has established a role for Vam3p and the v-SNARE Nyv1p in fusion events within the late endocytic system of
yeast, i.e., homotypic fusion of vacuoles. Furthermore, a significant proportion of these proteins are found in a complex, as demonstrated by
coimmunoprecipitation experiments. Therefore, we searched the database
for v-SNAREs that showed the highest level of identity with yeast
Nyv1p. Although only low levels of identity were seen among the known
mammalian v-SNAREs, the closest relative was Vamp 8, which has been
localized to endocytic compartments (Advani et al., 1998
;
Wong et al., 1998b
). Therefore, we determined whether Vamp 8 was associated with Syn7 by coimmunoprecipitation experiments. Figure
7A shows the specificity of the
affinity-purified anti-Vamp 8 antibody generated to the cytosolic
domain of Vamp 8. As reported previously, Vamp 8 migrates as an
~17-kDa protein that is enriched in endosomal compartments (Wong
et al., 1998a
). Syn7 was immunoprecipitated from a Triton
X-100-soluble fraction prepared from MDCK cells and then
immunoblotted for Vamp 8 and Vamp 3 (cellubrevin) (Figure 7B). Immunoprecipitations performed with either the goat anti-Syn7 or
the rabbit anti-Syn7#1 antibody resulted in a quantitative recovery of
Syn7 in the immunoprecipitate. Blotting for candidate Vamps showed that
10-20% of the total Vamp 8 was associated with Syn7, whereas no
detectable Vamp 3 was found associated with the immunoprecipitated
Syn7.
|
Consistent with our finding of a specific complex between Vamp 8 and Syn7, we also observed a significant level of overlap in the localization of Vamp 8 and Syn7 by immunofluorescence in MDCK cells (Figure 7C). This colocalization was confirmed by immunoelectron microscopy labeling of MDCK membranes (Table 1). Despite this colocalization, there were other Vamp 8-positive structures that were distinct from those positive for Syn7. One possibility is that Vamp 8 is restricted only to early endosomal compartments and that the overlap between Syn7 and Vamp 8 reflects the low level of Syn7 in early endosomal compartments. To determine whether any Vamp 8 occupied late endosomes or lysosomes, we also localized Vamp 8 by double-label immunofluorescence in WIF-B cells (Figure 7D) and by immunoelectron microscopy on isolated late endosome and lysosome fractions from rat liver (Figure 5, E-G). These experiments showed significant localization of Vamp 8 to lgp120-positive structures. Interestingly, by immunoelectron microscopy, Vamp 8 was enriched in late endosomes but far less so in lysosomes (Figure 5H). Thus, although Vamp 8 and Syn7 are localized to late endosome/lysosome compartments, the general distribution of each protein is different throughout the endocytic system.
| |
DISCUSSION |
|---|
|
|
|---|
Our effort to characterize the function of Syn7 was motivated by hopes of finding a functional homologue of the yeast Vam3p that would play a role in the late stages of lysosomal biogenesis. We present two major findings that support a role for Syn7 in lysosomal biogenesis. First, Syn7 is localized to late endosomes and lysosomes. Second, Syn7 is required for the fusion of late endosomes with lysosomes in vitro.
The mouse sequence we identify here is 93 and 94% identical to human
and rat Syn7, respectively. Outside of the animal kingdom, mammalian
Syn7 shows the highest level of identity (~30%) with the plant Vam3p
homologue AtVam3p, which like its proposed yeast counterpart is
localized to the vacuole (Sato et al., 1997
). Furthermore, Syn7 is expressed in all tissues examined, consistent with the role we
hypothesize it fulfills in the endosomal system. By immunofluorescence microscopy, immunoelectron microscopy, and subcellular fractionation analysis, we find that significant levels of Syn7 occur in late endosomes and lysosomes and much less in EEA1-positive compartments.
As a potential partner v-SNARE for Syn7, we found that Vamp 8 partially
colocalized with Syn7 and that a significant proportion of Vamp 8 is
associated with Syn7 in immunoprecipitates from detergent-solubilized fractions prepared from MDCK cells. Whether Syn7 and Vamp 8 represent a
SNARE pair that operates in vivo needs to be interpreted in light of
recent experiments conducted in vitro that indicate that v-(R)-SNAREs
can form complexes with many different t-(Q)-SNAREs in a manner that
belies the specificity of the trafficking event they may catalyze in
vivo (Yang et al., 1999
). In contrast to these in vitro
studies, we found a significant amount of Syn7 in a complex with Vamp 8 by immunoprecipitation from cell extracts, indicating that this complex
exists in vivo. Syn7 was not observed in a complex with the v-SNARE
Vamp 3 (cellubrevin), which in MDCK cells shows less colocalization
with Syn7 than Vamp 8 (Table 1) and which has previously been localized
to endosomes (McMahon et al., 1993
; Chilcote et
al., 1995
; Daro et al., 1996
). Thus, the specificity of
the Syn7/Vamp 8 complex we observed diminishes the likelihood that the
association of Syn7 and Vamp 8 is serendipitous as a result of their
transit through the same compartment, because some Vamp 3 would be
predicted to coprecipitate given the extent of colocalization we
observed. Because of the specific association of Vamp 8 and Syn7 and
the degree of colocalization we observed by immunofluorescence and by
immunoelectron microscopy studies, we propose that Vamp 8 may be at
least one of the v-SNARE partners that functionally interacts with Syn7
in vivo. This does not preclude Vamp 8 or Syn7 from interacting with
other SNAREs to effect a variety of fusion events within the endocytic
system. Further experiments are required to determine which transport
steps this putative SNARE pair controls, because to date we have failed
to show inhibition of fusion between late endosomes and lysosomes in
the cell-free assay with the use of the single anti-Vamp 8 rabbit
antiserum we have prepared.
Given the localization of Syn7 as well as the effect of anti-Syn7
antibodies and Fab fragments on the fusion of late endosomes and
lysosomes in vitro, we believe that Syn7 participates in fusion events
within the late endocytic pathway. This is in contrast to the function
of the close homologue Syn13, which shares 50% identity with Syn7 and
is also localized to the endocytic pathway. Syn13, however, is
concentrated in early endosomes and participates with rab5 and EEA1 in
the fusion of early endosomes (Prekeris et al., 1998
;
McBride et al., 1999
). So far, no role for Syn7 has been
found in early endosome fusion (McBride et al., 1999
). Thus,
Syn7 and Syn13, like their putative counterparts Vam3p and Pep12p, are
likely to have distinct, nonoverlapping functions. Using an in vitro
fusion reaction that measures content mixing between endosomes and
lysosomes isolated from rat liver (Mullock et al., 1994
,
1998
), we were able to substantiate that Syn7 is likely to have a
functional role in at least one fusion event with the lysosome in vivo.
No vesicular carrier has been identified for transport from the late
endosome to the lysosome in either mammalian or yeast cells. In
contrast, it has been shown that this transport reaction is
characterized by the fusion of large multivesicular endosomes with
preexisting lysosomes (Futter et al., 1996
; Mellman, 1996
;
Storrie and Desjardins, 1996
; Mullock et al. 1998
). In
vitro, this fusion reaction results in the production of
morphologically distinct late endosome-lysosome hybrids that can also
be observed in vivo (Futter et al., 1996
; Bright et
al., 1997
; Mullock et al., 1998
). Previous studies have
shown that this fusion reaction is dependent on NSF and
and
SNAPs and is also sensitive to exogenous Rab GDI, a hallmark for the
requirement of Rab GTPases (Mullock et al., 1998
). These
findings are consistent with the involvement of SNARE proteins in this
fusion reaction, because it is well established that this cohort of
proteins acts together to promote fusion (Lian et al., 1994
;
Sogaard et al., 1994
; Luapshin and Waters, 1997
). Syn7
appears to be one of the SNARE proteins in this fusion step, because
antibodies directed to the cytosolic tail of Syn7 inhibited content
mixing in a dose-dependent manner. The complete inhibition of content
mixing observed with anti-Syn7#2 is consistent with the total
inhibition of yeast vacuole fusion observed in a cell-free assay in the
presence of anti-Vam3p (Nichols et al., 1997
)
Wong and colleagues (1998b)
reported that Syn7 was localized to early
endosomes based on partial colocalization with the TfR. Although we
find low levels of Syn7 in TfR-positive structures in MDCK cells, most
of the labeling we observe is found coincident with markers of late
endosomes and/or lysosomes. In the studies of Wong and colleagues, the
TfR was labeled after the internalization of antibodies directed to the
lumenal domain of the TfR, which, if in excess, may have also entered
late endosomes and lysosomes and could have obscured detection of Syn7
in early compartments. Recent studies by Prekeris et al.
(1999)
that used immunogold labeling of cryosections indicated that
Syn7 was restricted to clathrin-coated vesicles budding from early
endosomes and was far more restricted in its localization pattern than
the overlap with TfR that was reported by Wong et al.
(1998b)
. Although the labeling observed in these immunoelectron
microscopy studies was discrete and specific, the possibility remains
that only a subset of the intracellular Syn7 molecules was detected
under the fixation and labeling methods used. In our experiments, we
saw a far more broad distribution of Syn7 by a variety of techniques.
During the course of our immunoelectron microscopy experiments,
however, we generated rabbit antibodies, a goat antibody, and a mouse
mAb to Syn7 to use in immunogold labeling of cryosections. Although we
observed specific labeling that was associated with late endosomal structures, we were unable to boost the overall level of immunogold labeling in sections, indicating that many of the Syn7 epitopes were
obscured by this method despite our attempts with many different antibody preparations. Furthermore, when we labeled lysosomal fractions
isolated from rat liver, we found the labeling efficiency to increase
significantly when we incubated the fraction in cytosol and ATP before
fixation and cryosectioning. Thus, the highly restricted localization
of Syn7 in the studies of Prekeris and others may be due in part to the
selective detection of a subpopulation of Syn7 that may reside in a
specific protein complex (Prekeris et al., 1999
). Our
conclusion that Syn7 is distributed throughout the endocytic pathway
and concentrated in late endosomes and lysosomes is based on a variety
of immunofluorescence and immunoelectron microscopy localization
studies that were performed in MDCK cells, NRK cells expressing
epitope-tagged Syn7, and hepatocytes (e.g., rat liver and WIF-B cells)
in which Syn7 was largely colocalized with markers of late endosomes
and lysosomes. By electron microscopy, Syn7 was found on multivesicular
endosomes that also labeled with antibodies to CI-MPR and Rab7 (Figure
4) or that contained internalized avidin-conjugated ASF (Figure 5).
Importantly, we also found significant levels of Syn7 on the limiting
membrane of lysosomes isolated from rat liver (Figure 5) at even higher
levels than that observed for late endosomes also isolated from rat
liver. Consistent with our localization results is recent work by
Nakamura et al. (2000)
, who also found Syn7 localized to
late endosomes and lysosomes in colabeling experiments with LAMP1 (the
mouse homologue of rat lgp120). Furthermore, these authors provide
evidence for a functional role for Syn7 in the late endocytic pathway
by examining the effects of overexpressing the cytosolic domain of Syn7
to induce a dominant-negative effect. This resulted in a block in the
transfer of endocytosed material from early endosomes to late
endosomes. These results must be interpreted carefully, because the
dominant-negative Syn7 works by titrating out Syn7-binding proteins
that might function elsewhere. Also, soluble fragments of Syn7 may be
able to bind promiscuously to inappropriate SNARE partners. Our results
in vitro support a role for Syn7 per se in late endosome-lysosome fusion, and it will be interesting to determine exactly how Syn7 functions in vivo. In this regard, experiments aimed at assigning the
exact function of Syn7 are reminiscent of a similar analysis of the
role of Rab7. Experiments with the use of hyperactive Rab7 and
biochemical in vitro fusion experiments have implied and/or shown a
direct role for Rab7 and its yeast homologue Ypt7p in the fusion of
lysosomes and vacuoles in animal and yeast cells, respectively (Haas
et al., 1995
; Bucci et al., 2000
). However, analysis of dominant-negative Rab7 in transfected cells supports the
conclusion that Rab7/Ypt7p participates in early to late endosome transport (Press et al., 1998
). These results may mean that
Rab7, or in our case Syn7, works at multiple steps in the late
endocytic pathway or could mean that interruption of normal lysosomal
fusion events results in indirect effects earlier in the endocytic
pathway. At the very least, we believe that our results substantiate a role for Syn7 in the process of late endosome-lysosome fusion.
Given that Syn7 is found in both late endosomes and lysosomes, the
question arises whether Syn7 catalyzes fusion as a t-SNARE on the
lysosomal membrane or on the late endosome. Perhaps the best model for
Syn7 function is exemplified by the yeast Vam3p, which has been shown
to mediate homotypic fusion of yeast vacuoles (Nichols et
al., 1997
). This fusion reaction is dependent on NSF, Ypt7p (a
Rab7 homologue), Vam3p, and Nyv1p (a v-SNARE). The best model is that
Vam3p and the v-SNARE Nyv1p are not only present but are functionally
active on both fusion partners (Nichols et al., 1997
;
Ungermann et al., 1998
). Thus, Syn7 may be active on both
late endosomes and lysosomes and catalyze fusion events from a number
of different pathways that converge at late endosomal/lysosomal compartments. This would be consistent with the multifaceted role of
Vam3p, which catalyzes not only fusion of endosomes with the vacuole
but also fusion of autophagic vesicles with the vacuole and delivery of
transport intermediates derived from the AP-3 transport pathway
originating from the Golgi (Cowles et al., 1997
; Darsow
et al., 1997
; Piper et al., 1997
).
| |
ACKNOWLEDGMENTS |
|---|
The authors thank Judy Tellam for efforts in cloning Syn7 cDNA; the personnel at the University of Iowa Central Microscope facility, Nick Wade, and Kara Brown for their efforts in obtaining mAbs and polyclonal antibodies to syntaxin 7; Sally Gray for technical assistance; and Linda Pelleymounter for performing immunofluorescence studies. This work was supported by grants from the American Heart Association (9730275N), the National Health and Medical Research Council, the Medical Research Council, SmithKline Beecham, and the Australian Research Council. This work was also supported by a Human Frontiers Science Program grant to J.P.L., D.E.J., and R.C.P. The Center for Molecular and Cellular Biology is a Special Research Center for the Australian Research Council.
| |
FOOTNOTES |
|---|
¶ Corresponding author. E-mail address: robert-piper{at}uiowa.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. He and M. E. Linder Differential palmitoylation of the endosomal SNAREs syntaxin 7 and syntaxin 8 J. Lipid Res., March 1, 2009; 50(3): 398 - 404. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Xu, M. E. Sowa, J. Chen, X. Li, S. P. Gygi, and J. W. Harper An FTS/Hook/p107FHIP Complex Interacts with and Promotes Endosomal Clustering by the Homotypic Vacuolar Protein Sorting Complex Mol. Biol. Cell, December 1, 2008; 19(12): 5059 - 5071. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Achuthan, P. Masendycz, J. A. Lopez, T. Nguyen, D. E. James, M. J. Sweet, J. A. Hamilton, and G. M. Scholz Regulation of the Endosomal SNARE Protein Syntaxin 7 by Colony-Stimulating Factor 1 in Macrophages Mol. Cell. Biol., October 15, 2008; 28(20): 6149 - 6159. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-J. Yu, T. Pisitkun, G. Wang, J. F. Aranda, P. A. Gonzales, D. Tchapyjnikov, R.-F. Shen, M. A. Alonso, and M. A. Knepper Large-scale quantitative LC-MS/MS analysis of detergent-resistant membrane proteins from rat renal collecting duct Am J Physiol Cell Physiol, September 1, 2008; 295(3): C661 - C678. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ahras, T. Naing, and R. McPherson Scavenger receptor class B type I localizes to a late endosomal compartment J. Lipid Res., July 1, 2008; 49(7): 1569 - 1576. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Mashima, J. Suzuki, T. Hirayama, Y. Yoshikumi, H. Ohno, H. Ohnishi, H. Yasuda, T. Fujita, and M. Omata Involvement of Vesicle-Associated Membrane Protein 7 in Human Gastric Epithelial Cell Vacuolation Induced by Helicobacter pylori-Produced VacA Infect. Immun., June 1, 2008; 76(6): 2296 - 2303. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Craige, G. Salazar, and V. Faundez Phosphatidylinositol-4-Kinase Type II Alpha Contains an AP-3-sorting Motif and a Kinase Domain That Are Both Required for Endosome Traffic Mol. Biol. Cell, April 1, 2008; 19(4): 1415 - 1426. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tiwari, C.-C. Wang, C. Brochetta, G. Ke, F. Vita, Z. Qi, J. Rivera, M. R. Soranzo, G. Zabucchi, W. Hong, et al. VAMP-8 segregates mast cell-preformed mediator exocytosis from cytokine trafficking pathways Blood, April 1, 2008; 111(7): 3665 - 3674. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. D. Rogers and L. J. Foster The dynamic phagosomal proteome and the contribution of the endoplasmic reticulum PNAS, November 20, 2007; 104(47): 18520 - 18525. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Pocard, A. Le Bivic, T. Galli, and C. Zurzolo Distinct v-SNAREs regulate direct and indirect apical delivery in polarized epithelial cells J. Cell Sci., September 15, 2007; 120(18): 3309 - 3320. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Casey, J. L. Meade, and E. W. Hewitt Organelle Proteomics: Identification of the Exocytic Machinery Associated with the Natural Killer Cell Secretory Lysosome Mol. Cell. Proteomics, May 1, 2007; 6(5): 767 - 780. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sanderfoot Increases in the Number of SNARE Genes Parallels the Rise of Multicellularity among the Green Plants Plant Physiology, May 1, 2007; 144(1): 6 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Newell-Litwa, E. Seong, M. Burmeister, and V. Faundez Neuronal and non-neuronal functions of the AP-3 sorting machinery J. Cell Sci., February 15, 2007; 120(4): 531 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Salazar, B. Craige, M. L. Styers, K. A. Newell-Litwa, M. M. Doucette, B. H. Wainer, J. M. Falcon-Perez, E. C. Dell'Angelica, A. A. Peden, E. Werner, et al. BLOC-1 Complex Deficiency Alters the Targeting of Adaptor Protein Complex-3 Cargoes Mol. Biol. Cell, September 1, 2006; 17(9): 4014 - 4026. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hatsuzawa, T. Tamura, H. Hashimoto, H. Hashimoto, S. Yokoya, M. Miura, H. Nagaya, and I. Wada Involvement of Syntaxin 18, an Endoplasmic Reticulum (ER)-localized SNARE Protein, in ER-mediated Phagocytosis Mol. Biol. Cell, September 1, 2006; 17(9): 3964 - 3977. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bowers, S. C. Piper, M. A. Edeling, S. R. Gray, D. J. Owen, P. J. Lehner, and J. P. Luzio Degradation of Endocytosed Epidermal Growth Factor and Virally Ubiquitinated Major Histocompatibility Complex Class I Is Independent of Mammalian ESCRTII J. Biol. Chem., February 24, 2006; 281(8): 5094 - 5105. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Barile, T. Pisitkun, M.-J. Yu, C.-L. Chou, M. J. Verbalis, R.-F. Shen, and M. A. Knepper Large Scale Protein Identification in Intracellular Aquaporin-2 Vesicles from Renal Inner Medullary Collecting Duct Mol. Cell. Proteomics, August 1, 2005; 4(8): 1095 - 1106. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Paumet, V. Rahimian, M. Di Liberto, and J. E. Rothman Concerted Auto-regulation in Yeast Endosomal t-SNAREs J. Biol. Chem., June 3, 2005; 280(22): 21137 - 21143. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Bagshaw, D. J. Mahuran, and J. W. Callahan A Proteomic Analysis of Lysosomal Integral Membrane Proteins Reveals the Diverse Composition of the Organelle Mol. Cell. Proteomics, February 1, 2005; 4(2): 133 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-J. Lee, E. J. Sohn, M. H. Lee, and I. Hwang The Arabidopsis Rab5 Homologs Rha1 and Ara7 Localize to the Prevacuolar Compartment Plant Cell Physiol., September 15, 2004; 45(9): 1211 - 1220. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bilan, V. Thoreau, M. Nacfer, R. Derand, C. Norez, A. Cantereau, M. Garcia, F. Becq, and A. Kitzis Syntaxin 8 impairs trafficking of cystic fibrosis transmembrane conductance regulator (CFTR) and inhibits its channel activity J. Cell Sci., April 15, 2004; 117(10): 1923 - 1935. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. W. Richardson, S. C. Winistorfer, V. Poupon, J. P. Luzio, and R. C. Piper Mammalian Late Vacuole Protein Sorting Orthologues Participate in Early Endosomal Fusion and Interact with the Cytoskeleton Mol. Biol. Cell, March 1, 2004; 15(3): 1197 - 1210. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chidambaram, N. Mullers, K. Wiederhold, V. Haucke, and G. F. von Mollard Specific Interaction between SNAREs and Epsin N-terminal Homology (ENTH) Domains of Epsin-related Proteins in trans-Golgi Network to Endosome Transport J. Biol. Chem., February 6, 2004; 279(6): 4175 - 4179. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Poupon, A. Stewart, S. R. Gray, R. C. Piper, and J. P. Luzio The Role of mVps18p in Clustering, Fusion, and Intracellular Localization of Late Endocytic Organelles Mol. Biol. Cell, October 1, 2003; 14(10): 4015 - 4027. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Widberg, N. J. Bryant, M. Girotti, S. Rea, and D. E. James Tomosyn Interacts with the t-SNAREs Syntaxin4 and SNAP23 and Plays a Role in Insulin-stimulated GLUT4 Translocation J. Biol. Chem., September 12, 2003; 278(37): 35093 - 35101. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Sun, Q. Yan, T. A. Vida, and A. J. Bean Hrs regulates early endosome fusion by inhibiting formation of an endosomal SNARE complex J. Cell Biol., July 7, 2003; 162(1): 125 - 137. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Suzuki, H. Ohnishi, A. Wada, T. Hirayama, H. Ohno, N. Ueda, H. Yasuda, T. Iiri, Y. Wada, M. Futai, et al. Involvement of Syntaxin 7 in Human Gastric Epithelial Cell Vacuolation Induced by the Helicobacter pylori-produced Cytotoxin VacA J. Biol. Chem., July 3, 2003; 278(28): 25585 - 25590. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Martinez-Arca, V. Proux-Gillardeaux, P. Alberts, D. Louvard, and T. Galli Ectopic expression of syntaxin 1 in the ER redirects TI-VAMP- and cellubrevin-containing vesicles J. Cell Sci., July 1, 2003; 116(13): 2805 - 2816. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. I. Perera, M. Clarke, N. J. Morris, W. Hong, L. H. Chamberlain, and G. W. Gould Syntaxin 6 Regulates Glut4 Trafficking in 3T3-L1 Adipocytes Mol. Biol. Cell, July 1, 2003; 14(7): 2946 - 2958. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hasegawa, S. Zinsser, Y. Rhee, E. O. Vik-Mo, S. Davanger, and J. C. Hay Mammalian Ykt6 Is a Neuronal SNARE Targeted to a Specialized Compartment by its Profilin-like Amino Terminal Domain Mol. Biol. Cell, February 1, 2003; 14(2): 698 - 720. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Collins, A. D. Schreiber, S. Grinstein, and W. S. Trimble Syntaxins 13 and 7 Function at Distinct Steps During Phagocytosis J. Immunol., September 15, 2002; 169(6): 3250 - 3256. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Seto, H. J. Bellen, and T. E. Lloyd When cell biology meets development: endocytic regulation of signaling pathways Genes & Dev., June 1, 2002; 16(11): 1314 - 1336. [Full Text] [PDF] |
||||
![]() |
A. A. Sanderfoot, V. Kovaleva, D. C. Bassham, and N. V. Raikhel Interactions between Syntaxins Identify at Least Five SNARE Complexes within the Golgi/Prevacuolar System of the Arabidopsis Cell Mol. Biol. Cell, December 1, 2001; 12(12): 3733 - 3743. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Caplan, L. M. Hartnell, R. C. Aguilar, N. Naslavsky, and J. S. Bonifacino Human Vam6p promotes lysosome clustering and fusion in vivo J. Cell Biol., July 9, 2001; 154(1): 109 - 122. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Luhrmann, K. Streker, A. Schuttfort, J. J. D. Daniels, and A. Haas Afipia felis induces uptake by macrophages directly into a nonendocytic compartment PNAS, June 7, 2001; (2001) 121190398. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Klionsky and S. D. Emr Autophagy as a Regulated Pathway of Cellular Degradation Science, December 1, 2000; 290(5497): 1717 - 1721. [Abstract] [Full Text] |
||||
![]() |
N. Wade, N. J. Bryant, L. M. Connolly, R. J. Simpson, J. P. Luzio, R. C. Piper, and D. E. James Syntaxin 7 Complexes with Mouse Vps10p Tail Interactor 1b, Syntaxin 6, Vesicle-associated Membrane Protein (VAMP)8, and VAMP7 in B16 Melanoma Cells J. Biol. Chem., June 1, 2001; 276(23): 19820 - 19827. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Y. Kim, H. Kramer, A. Yamamoto, E. Kominami, S. Kohsaka, and C. Akazawa Molecular Characterization of Mammalian Homologues of Class C Vps Proteins That Interact with Syntaxin-7 J. Biol. Chem., July 27, 2001; 276(31): 29393 - 29402. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Luhrmann, K. Streker, A. Schuttfort, J. J. D. Daniels, and A. Haas Afipia felis induces uptake by macrophages directly into a nonendocytic compartment PNAS, June 19, 2001; 98(13): 7271 - 7276. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sachse, S. Urbe, V. Oorschot, G. J. Strous, and J. Klumperman Bilayered Clathrin Coats on Endosomal Vacuoles Are Involved in Protein Sorting toward Lysosomes Mol. Biol. Cell, April 1, 2002; 13(4): 1313 - 1328. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||