![]() |
|
|
Vol. 11, Issue 9, 3177-3190, September 2000

Howard Hughes Medical Institute, Programs in Developmental Biology, Neuroscience, and Genetics, Department of Anatomy and Department of Biochemistry and Biophysics, The University of California, San Francisco, California 94143
Submitted April 5, 2000; Revised June 9, 2000; Accepted July 5, 2000| |
ABSTRACT |
|---|
|
|
|---|
The Caenorhabditis elegans sax-1 gene regulates several aspects of neuronal cell shape. sax-1 mutants have expanded cell bodies and ectopic neurites in many classes of neurons, suggesting that SAX-1 functions to restrict cell and neurite growth. The ectopic neurites in sensory neurons of sax-1 mutants resemble the defects caused by decreased sensory activity. However, the activity-dependent pathway, mediated in part by the UNC-43 calcium/calmodulin-dependent kinase II, functions in parallel with SAX-1 to suppress neurite initiation. sax-1 encodes a serine/threonine kinase in the Ndr family that is related to the Orb6 (Schizosaccharomyces pombe), Warts/Lats (Drosophila), and COT-1 (Neurospora) kinases that function in cell shape regulation. These kinases have similarity to Rho kinases but lack consensus Rho-binding domains. Dominant negative mutations in the C. elegans RhoA GTPase cause neuronal cell shape defects similar to those of sax-1 mutants, and genetic interactions between rhoA and sax-1 suggest shared functions. These results suggest that SAX-1/Ndr kinases are endogenous inhibitors of neurite initiation and cell spreading.
| |
INTRODUCTION |
|---|
|
|
|---|
Neuronal cells have complex morphologies, with distinctive
cell bodies, axons, and dendrites. Although extrinsic cues that regulate axon guidance and branching have been defined (Tessier-Lavigne and Goodman, 1996
; Mueller, 1999
; Wang et al., 1999
), less
is known about the intrinsic determinants of cell shape. The mechanisms that determine a neuron's competence to form neurites, the number of
neurites per cell, and the subcellular site of neurite initiation are unknown.
Rho family GTPases affect the actin cytoskeleton and morphology
of many cell types (Hall, 1994
). These GTPases exert their activity by
binding and regulating multiple targets, including actin-binding
proteins and several classes of kinases (Tapon and Hall, 1997
). The Rho
family GTPases Rac and Cdc42 are implicated in cell motility and axon
outgrowth (Ridley et al., 1992
; Luo et al., 1994
;
Kozma et al., 1995
; Nobes and Hall, 1995
; Luo et al., 1997
), and Rho is implicated in contractile events such as stress fiber formation and neurite retraction (Paterson et
al., 1990
; Ridley and Hall, 1992
; Jalink et al., 1994
;
Gebbink et al., 1997
). Rho acts in part through the Rho
kinase family, which includes Rho kinase (Leung et al.,
1995
; Ishizaki et al., 1996
; Matsui et al.,
1996
), LET-502 (Wissmann et al., 1997
), Genghis Khan (Luo et al., 1997
), Citron (Di Cunto et al., 1998
;
Madaule et al., 1998
), and MRCK (Leung et al.,
1998
). These proteins share a related kinase catalytic domain as well
as domains that allow GTPase association. Mutations in the
Caenorhabditis elegans LET-502 kinase prevent the epidermal
cell shape changes that drive embryonic elongation, whereas mutations
in Genghis Khan disrupt actin structures in the Drosophila
egg chamber (Luo et al., 1997
; Wissmann et al., 1997
). These phenotypes, together with functional studies in cultured cells (Leung et al., 1996
; Amano et al., 1997
;
Ishizaki et al., 1997
), implicate Rho kinases in the
regulation of cell morphology.
Members of a distinct family of serine/threonine kinases, including
Orb6, COT-1, and Warts/Lats, are required for the regulation of cell
morphology and cell division (Yarden et al., 1992
; Justice et al., 1995
; Xu et al., 1995
; Verde et
al., 1998
). Kinases in the Orb6/COT-1/Warts family are closely
related to Rho kinases in the kinase catalytic domain but lack
consensus Rho-binding motifs. The pathways that regulate these kinases
are not fully defined. Orb6 functions downstream of Pak1/Shk1 kinase
(Verde et al., 1998
), which acts together with the Cdc42
GTPase in cell shape regulation (Marcus et al., 1995
;
Ottilie et al., 1995
). An expressed sequence tag (EST) in
C. elegans led to the identification of Ndr, a new member of
the Orb6/COT-1/Warts kinase family that is conserved in C. elegans, Drosophila, and humans (Millward et al., 1995
). The function of the Ndr kinases is not known.
A screen for mutants with altered neuronal morphology in C. elegans identified mutations in the sax-1 and
sax-2 genes (Zallen et al., 1999
). Here we show
that sax-1 encodes the C. elegans Ndr kinase, a
member of the Orb6/COT-1/Warts family. sax-1 and sax-2 mutants exhibit defects in neuronal cell shape and
polarity: cells appear expanded and irregular instead of compact and
spherical, and they initiate ectopic neurites in addition to the normal
axon and dendrite. Similar cell shape defects are caused by dominant negative mutations in the C. elegans RhoA GTPase. In sensory
neurons, ectopic neurites are also caused by mutations that disrupt
neuronal activity (Coburn and Bargmann, 1996
; Coburn et al.,
1998
; Peckol et al., 1999
). We find that the
activity-dependent pathway for neurite initiation is modulated by the
UNC-43 calcium/calmodulin-dependent protein kinase II (CaMKII) and
functions in parallel with the SAX-1 (GenBank accession number
AF275634) kinase to regulate neurite initiation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains and Genetics
Wild-type animals were C. elegans variety Bristol,
strain N2. Strains were maintained at 20 or 25°C by standard methods
(Brenner, 1974
). Some strains were provided by the
Caenorhabditis Genetics Center (St. Paul, MN).
sax-1 and sax-2 mutant alleles (Zallen et
al., 1999
) were outcrossed twice by kyIs4 X;
him-5(e1490) V, once by kyIs4 X, and once by N2.
Sensory axon defects detected by the ceh-23::gfp
kyIs4 transgene were followed to map sax-1(ky211) to
LGX. Five of five lon-2 non-lin-18 unc-78
recombinants and two of four lon-2 lin-18 non-unc-78 recombinants were mutant for sax-1.
Two of seven lon-2 non-fax-1 recombinants were
mutant for sax-1.
The stP40 restriction fragment length polymorphism that differs between the Bristol strains RW7000 and N2 was used to further map sax-1. Recombinants were isolated from unc-20(e112ts) sax-1(ky211) lon-2(e648)/RW7000 heterozygotes. None of three unc-20 sax-1 non-lon-2 recombinants and two of two unc-20 non-sax-1 lon-2 recombinants segregated the RW7000 stP40 polymorphism. None of two lon-2 sax-1 non-unc-20 recombinants and three of three lon-2 non-sax-1 unc-20 recombinants segregated the stP40 polymorphism. These mapping data placed sax-1 to the left of lin-18 and to the right or close on the left of stP40 on LGX.
Germline Transformation
Transgenic strains were created as described (Mello et
al., 1991
). Multiple lines from each injection were characterized
for rescue of the sensory axon defects in the sax-1(ky211)
kyIs4 X strain. Cosmids spanning the region between
stP40 and lin-18 were injected at 10 ng/µl each
in pools of four to five cosmids with the use of the dominant pRF4
rol-6(su1006) plasmid at 100 ng/µl as a coinjection
marker. Cosmids from the rescuing pool were injected individually at 30 ng/µl with pRF4. Rescue activity of the R11G1 cosmid was retained in
a 17-kilobase (kb) SacII-NarI subclone of the
R11G1 cosmid cloned into the SacII-ClaI sites of
pBSKII (pJAZ19, injected at 30 ng/µl) and a 7.7-kb
SacII-XhoI subclone of the R11G1 cosmid cloned
into the SacII-XhoI sites of pBSKII (pJAZ29,
injected at 50 ng/µl). A deletion in the pJAZ19 sax-1 rescuing construct was made by digestion with BalI and
religation, removing 1 kb of genomic sequence that deletes conserved
kinase domains V (part), VIa, VIb, and VII (part) and breaks within an intron, which is predicted to disrupt sax-1 splicing. This
deletion construct (pJAZ30) was injected at 30 ng/µl with pRF4.
cDNA Isolation and Allele Sequencing
A high-stringency screen of 5 × 105
plaques of a mixed-stage C. elegans cDNA library (Barstead
and Waterston, 1989
) that used the cm11b8 cDNA as a probe (a generous
gift from R. Waterston, Washington University, St. Louis, MO)
identified 15 full-length sax-1 cDNAs and 1 partial cDNA.
Six cDNAs were fully sequenced and the rest were partially sequenced,
encoding a predicted protein of 467 or 469 amino acids. The
sax-1 sequence was confirmed, and its genomic organization
was determined by aligning the cDNA with reported genomic sequences
from the C. elegans Sequencing Consortium (1998)
;
however, it differs from the gene predicted in that region (see below).
The cDNAs were flanked by a 38-base pair 5' untranslated region (UTR),
a 335-base pair 3' UTR, and a poly(A) tail.
The sax-1(ky211) mutation was identified by sequencing the sax-1 ORF and splice junctions from genomic DNA amplified with the use of the Expand PCR kit (Boehringer Mannheim, Indianapolis, IN). PCR fragments were sequenced on one strand with the use of the fmol sequencing kit (Promega, Madison, WI). The mutation was confirmed by sequencing a separately amplified PCR fragment.
The C. elegans Sequencing Consortium (1998)
predicted
a longer 1356-amino acid protein in the sax-1 region,
including sax-1 exons and additional downstream exons. To
determine whether these downstream exons could encode alternative exons
of sax-1, we sequenced five ESTs kindly provided by Y. Kohara (National Institute of Genetics, Mishima, Japan); the
longest contained 712 amino acids in addition to the 3' UTR. The 5' end
of this transcript was identified by reverse transcription (RT)-PCR
from wild-type N2 RNA prepared by Trizol extraction (GIBCO-BRL,
Gaithersburg, MD) with the use of 3' primers from the predicted ESTs in
combination with a 5' primer to the C. elegans SL2 spliced
leader sequence. The SL2 spliced leader sequence is present at the 5'
end of C. elegans genes that are located downstream in an
operon (Zorio et al., 1994
). The full-length transcript
encodes a predicted 811-amino acid protein. We named this transcript
stg-1, for sax-1 three-prime gene. The
stg-1 coding region was not required for sax-1
rescue. No transcripts were identified that extended from the
stg-1 coding region into the sax-1 coding region
or the SL1 spliced leader sequence. An additional in-frame
stg-1 exon upstream of the SL2 splice junction was present
in one of the five cDNAs; however, the 5' end of this transcript was
not detected by RT-PCR. Therefore, sax-1 and
stg-1 appear to encode distinct protein products that may
belong to a common operon, although it is possible that they are also
included in a single transcript that was not detected by ESTs or
RT-PCR.
Characterization of Neuronal Morphology
Axons were scored in living adult animals, except for larval
animals scored in Figure 2. The AWC neurons were visualized with an integrated str-2::gfp transgene (kyIs140
I; Dwyer et al., 1998
). The ASER neuron was visualized
with an integrated gcy-5::gfp transgene (kyIs164 II; Yu et al., 1997
). The ASJ neurons
shown in Figures 1 and 2 and described in Table 1 were visualized with
an integrated tax-2
::gfp transgene
(kyIs150 IV; Coburn and Bargmann, 1996
; Peckol et
al., 1999
). tax-2
::gfp labels
ASJ along with the AWB, AWC, ASG, ASI, and ASK amphid chemosensory
neuron pairs. Transgenes were integrated by trimethylpsoralen and UV
radiation and outcrossed three to seven times. In Figures 3 and 5, ASJ
neurons were visualized in the absence of a gfp transgene by
exposing adult animals to 15 µg/ml
1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate
(DiI) in M9 buffer (Brenner, 1974
) for 1.5 h to
label ASJ along with the ADL, ASH, ASI, ASK, and AWB amphid
chemosensory neuron pairs. The ASJ defects scored by the
tax-2
::gfp transgene or DiI filling
differed in penetrance by up to 20%, but in all cases qualitatively
similar results were obtained with the use of both
tax-2
::gfp and DiI filling of
strains lacking a gfp transgene.
Animals were scored as having ectopic neurite defects if at least one
neuron had an ectopic thin or thick process that was longer than the
diameter of the cell body. Lateral ectopic neurites emerged directly
from the cell body in sax-1 and sax-2 mutants and
grew posteriorly along the lateral body wall. tax-4 mutants exhibit both lateral and ventral neurite defects in ASJ (Peckol et al., 1999
), whereas sax-1 and sax-2
mutants exhibit only lateral neurites. Only lateral neurites were
included in this analysis. In Table 1, Figure 2, and Figure 5, ASE and
AWC neurons were scored as defective in cell shape if the mutant cell
body appeared at least twice the size of a wild-type cell body. Because
rhoA-expressing cells had milder defects than
sax-1 mutants, in Figure 6 ASE neurons were scored as
defective in cell shape if the cell body was expanded 1.5-fold compared
with wild-type neurons.
Statistical analysis was conducted with the use of Primer of
Biostatistics software (Stanton A. Glantz, McGraw-Hill, New
York) and Kaleidagraph (Synergy Software, Reading, PA).
Confocal images were acquired with the use of LaserSharp Acquisition
version 2.1A software (Bio-Rad, Richmond, CA), an Optiphot-2 microscope
(Nikon, Garden City, NY), and the MRC-1024 Laser Scanning Confocal
Imaging System (Bio-Rad). Epifluorescence images were acquired with the use of an Axioplan 2 microscope (Zeiss, Thornwood, NY) and assembled with the use of Adobe Photoshop (Adobe, Mountain View, CA). The image
in Figure 5D was acquired with a scientific-grade cooled charge-coupled
device camera on a multiwavelength wide-field three-dimensional microscopy system (Hiraoka et al., 1990
).
sax-1 Expression Analysis
A full-length translational SAX-1::GFP fusion was
constructed by cloning Green Fluorescent Protein (GFP) flanked
by splice acceptor and donor sites (pPD103.75) into the blunted
AflII site in the last intron of the
SacII-XbaI sax-1 genomic fragment in a pBSKII+ backbone. This SAX-1::GFP transgene (pJAZ31) was
injected at 50 ng/µl into a lin-15(n765ts) strain with the
use of 30 ng/µl pJM23 lin-15 plasmid as a coinjection
marker (Huang et al., 1994
). To assess whether the
SAX-1::GFP tag was functional, SAX-1::GFP was
injected at 100 ng/µl into sax-1(ky211) X and
sax-1(ky491) X mutant animals with pRF4, and rescue of the
ectopic neurite phenotype was scored by DiI filling. The
sax-1 expression pattern was characterized in animals that
contained the SAX-1::GFP plasmid as an unstable
extrachromosomal array. Chemosensory neurons were scored for rescue of
ectopic neurite defects by DiI filling of transgenic animals.
The srh-1::gfp construct contained a 3-kb fragment of the srh-1 promoter (cosmid R09F10 nucleotides 24,398-27,397) engineered by PCR to contain a 5' SphI site and a 3' BamHI site and cloned into the corresponding sites of the pPD95.77 GFP vector by Yongmei Zhang (Howard Hughes Medical Institute, University of California, San Francisco, CA). The gcy-5 constructs contained a 2.7-kb fragment upstream of the gcy-5 start codon engineered by PCR to contain a 5' SphI site and a 3' BamHI site and cloned into the corresponding sites of the pPD95.75 GFP vector. GFP vectors were kindly provided by A. Fire, S. Xu, J. Ahnn, and G. Seydoux (Carnegie Institution of Washington, Baltimore, MD).
A KpnI site was engineered immediately upstream of the sax-1 cDNA start codon by PCR. The complete sax-1 cDNA was cut at the 5' KpnI site and the 3' NaeI site in the sax-1 3' UTR. The sax-1 cDNA was joined to the downstream unc-54 3' UTR (cut with EcoRI and blunted) and the upstream srh-1 or gcy-5 promoters (cut with KpnI). gcy-5::sax-1 was injected at 50 ng/µl with pRF4 into the kyIs164 II; sax-1(ky491) X strain. srh-1::sax-1 was injected at 50 ng/µl with pRF4 into the sax-1(ky491) X strain and the kyIs164 II; sax-1(ky491) X strain.
To express the SAX-1::GFP tag in a single cell type, the full-length SAX-1::GFP clone with GFP in the final intron was cloned into the srh-1::sax-1 fusion gene (pJAZ22) in two steps. The srh-1::sax-1::gfp fusion gene (pJAZ35) was injected at 100 ng/µl into wild-type N2 animals with pRF4, and ASJ morphology was scored by DiI filling.
Isolation of a sax-1 Deletion Mutant
A sax-1 deletion mutation was isolated by PCR as
described (Dernburg et al., 1998
). A deletion library of
106 genomes was constructed with the use of the
ethyl methanesulfate (EMS) mutagen for half and
UV/trimethylpsoralen for half of the library. Nested PCR primers were
used to amplify a 3-kb fragment containing the sax-1 kinase
domain. A 1.7-kb deletion band was identified in a pool from the EMS
part of the library and sequenced. A single animal homozygous for the
deletion was isolated after three rounds of sib selection. The
sax-1(ky491) X deletion mutant was outcrossed once by N2 and
once by lon-2(e678) X.
Isolation and Mutagenesis of rhoA cDNA
A full-length cDNA of the rhoA gene (Chen and Lim,
1994
) was amplified by PCR from hexamer-primed C. elegans
cDNA (a gift of Mario de Bono, Howard Hughes Medical Institute,
University of California, San Francisco, CA) with the use of the
primers 5'GAAGTCGACACGAGTACGGGTGTTC and
3'CCATGGAATTAGAGAGAAGAAGAGCAGAC, which contained artificial
SalI and NcoI sites, respectively. The cDNA was
subcloned into SalI-NcoI sites of the vector
pPD49.26, sequenced, and determined not to contain any PCR-induced
mutations. The gcy-5 promoter (Yu et al., 1997
)
was subcloned into the SphI-BamHI sites of the
same vector with the use of artificial primers to create the
restriction sites. Point mutations Q63L, T19N, and D13T in the
rhoA gene were generated with the use of the Quikchange kit
(Stratagene, La Jolla, CA). After mutagenesis, the complete rhoA coding region was sequenced to confirm the presence of
the desired mutation and the absence of other mutations.
rhoA plasmids were injected at 50 ng/µl with
rol-6 as a cotransformation marker. gcy-5::sax-1 was injected at 50 ng/µl with the
D13T mutant, and the gcy-5 promoter plasmid was injected at
50 ng/µl with the D13T mutant as a control.
ASER cell shape was scored in adult animals raised at 25°C with the use of the kyIs164 transgene.
| |
RESULTS |
|---|
|
|
|---|
Mutations in sax-1 and sax-2 Disrupt Neuronal Cell Shape and Neurite Initiation
sax-1 and sax-2 mutations cause
ectopic neurite initiation from the ASI sensory neurons, the CAN
neuroendocrine neurons, and glr-1-expressing interneurons
(Zallen et al., 1999
). Characterization of sax-1
and sax-2 mutants with cell-specific GFP markers for the
AWC, ASE, and ASJ sensory neurons revealed similar defects in neurite
initiation as well as defects in neuronal cell shape (Figure
1, Table
1). In sax-1 and
sax-2 mutant animals, axon guidance of chemosensory neurons
in the embryo was normal, producing a bipolar neuron with one dendrite
that connects to the tip of the nose and one axon that grows
circumferentially in the nerve ring neuropil. However, some sensory
neurons had an ectopic neurite in addition to the normal dendrite and
axon (Figure 1, H and I). These ectopic neurites extended posteriorly
from the cell body for up to 25 µm and were up to ~1 µm in
diameter; a normal axon is 75 µm long and 0.1 µm in diameter. In
addition, the sensory neuron cell bodies appeared expanded and
irregular in shape (Figure 1, B, C, E, and F). The expanded regions of
the cell body are flattened and extended, like lamellipodia, but their
structures have not been characterized in detail. The three sensory
neuron types exhibited a range of phenotypes, with primarily cell shape defects in the AWC and ASE neurons and ectopic neurites in the ASJ
neurons (Table 1).
|
|
Despite the aberrant AWC morphology, sax-1 and
sax-2 mutant animals generated nearly wild-type chemotaxis
responses to attractive odorants detected by AWC (Figure
2A), suggesting that these cell shape
defects do not eliminate AWC function. sax-1 and
sax-2 mutant animals appeared morphologically and
behaviorally normal, with no obvious defects in locomotion or egg
laying.
|
sax-1 and sax-2 Suppress Neurite Initiation in Larval and Adult Stages
The ectopic neurite phenotypes of sax-1 and
sax-2 mutants are reminiscent of defects caused by mutations
that disrupt the electrical activity of sensory neurons, which result
in late-onset ectopic neurite initiation during larval and adult stages
(Peckol et al., 1999
). To determine whether sax-1
and sax-2 also affect a late developmental process, we
examined ectopic neurites in the ASJ sensory neurons at different
larval stages. Although ASJ axon guidance is completed in the embryo,
the ectopic neurites in sax-1 and sax-2 mutants
increased in severity throughout the four larval stages and continued
to appear in adults (Figure 2B). Activity mutants are also
temperature-sensitive for ectopic neurite formation (Peckol et
al., 1999
), and more ectopic neurites are observed in
sax-1 and sax-2 mutants at higher temperatures
(Table 1) (Zallen et al., 1999
).
Unlike ectopic neurites, the cell shape defects in sax-1 and sax-2 mutants are not observed in mutants with defects in sensory activity and have not been described previously in C. elegans. The AWC cell shape defects were apparent even at the L1 stage, although they increased slightly in severity between the first and second larval stages (Figure 2C). The ASE cell shape defects were temperature-sensitive in sax-1 but not in sax-2 mutants, whereas AWC cell shape defects were temperature-sensitive in only one sax-1 allele (Table 1).
SAX-1 Acts in Parallel with the UNC-43 Calcium/Calmodulin-dependent Kinase and the TAX-4 Sensory Transduction Channel to Regulate Neurite Initiation
The ectopic neurite defects, late onset, and
temperature-sensitivity of sax-1 mutants were all similar to
the defects in mutants with altered sensory transduction or electrical
activity. To determine whether SAX-1 participates in an
activity-dependent pathway, we generated double mutants defective in
sax-1 and the cGMP-gated sensory transduction channel
tax-4 (Komatsu et al., 1996
). ASJ neurons in the
sax-1; tax-4 double mutant displayed significantly more
ectopic neurites than a null mutant in either gene (Figure 3A), indicating that these genes function
in two different pathways to suppress neurite initiation.
|
The SAX-1-related Ndr kinase can be regulated by calcium (Millward
et al., 1998
; see below), and calcium-dependent kinases such
as CaMKII have been implicated in the regulation of neuronal morphology
in response to neural activity (Wang et al., 1994
; Wu and
Cline, 1998
). C. elegans has a single predicted CaMKII homologue encoded by the unc-43 gene (Reiner et
al., 1999
). To determine whether CaMKII is involved in the
regulation of cell morphology in C. elegans, we examined
chemosensory neurons in unc-43 mutants. Both the null
unc-43(n1186lf) mutation and the gain-of-function
unc-43(n498gf) mutation caused occasional ectopic neurites
in the ASJ (Figure 3B) and ASE neurons [13% defective in
unc-43(lf), n = 194; 3% defective in
unc-43(gf), n = 159], but no cell shape defects.
Genetic evidence indicates that the UNC-43 CaMKII functions in the activity-dependent pathway to regulate neurite initiation. The ASJ defects in the tax-4; unc-43(lf) double mutant were not enhanced compared with the tax-4 single mutant (Figure 3B), suggesting that UNC-43 functions in the same pathway as the TAX-4 sensory transduction channel. The tax-4; unc-43(gf) double mutant was significantly suppressed for the tax-4 ASJ defects, suggesting that UNC-43 acts downstream of TAX-4. However, tax-4 null mutants were significantly more defective than unc-43 null mutants at 25°C (Figure 3B), indicating that TAX-4 carries out additional UNC-43-independent functions.
UNC-43, like TAX-4, functions in parallel with the SAX-1 kinase. The ASJ neurons in the sax-1; unc-43(lf) double mutant were significantly more defective than in a null mutant in either gene, indicating that SAX-1 and UNC-43 operate in parallel pathways (Figure 3C). Interestingly, the sax-1; unc-43(gf) double mutant was partially suppressed compared with the sax-1 single mutant at 25°C, suggesting that increased activity of the UNC-43 kinase can partially compensate for decreased SAX-1 kinase activity.
sax-1 and sax-2 mutants have similar defects in neurite initiation and cell shape. The ASJ defects in sax-1; sax-2 double mutants were no more severe than those in either single mutant (Figure 3D), suggesting that these genes act in the same genetic pathway. We conclude that SAX-1 and SAX-2 function together, at least partly in parallel with an activity-dependent pathway that regulates neurite initiation through the action of the TAX-4 sensory transduction channel and the UNC-43 CaMKII.
sax-1 Encodes an Ndr Serine/Threonine Protein Kinase
sax-1 was mapped to the X chromosome between the
stP40 polymorphism and the lin-18 gene, and
cosmid pools covering this region were injected into the
sax-1(ky211) strain. The R11G1 cosmid and its subclones
rescued sax-1 mutant defects (Figure
4A). Sequence information from the
C. elegans Sequencing Consortium predicted that the smallest
rescuing subclone contained a serine/threonine kinase. A 1-kb deletion
within the predicted kinase domain completely abolished rescuing
activity (Figure 4A). To confirm that this gene was disrupted in
sax-1 mutant animals, we sequenced sax-1(ky211) and identified a G-to-A transition mutation in a predicted splice acceptor site. Fifteen full-length sax-1 cDNAs from a
mixed-stage C. elegans cDNA library (Barstead and Waterston,
1989
) define a 1.8-kb primary transcript that encodes a predicted
protein of 467 amino acids. An additional 2 amino acids were present at
the 11th splice acceptor site in 1 of 15 clones. The 467-amino acid protein overlaps with the first third of the putative protein R11G1.4,
which was predicted to encode a 1356-amino acid protein based on
genomic sequence. The sax-1 transcript was contained within
the 7.7-kb rescuing subclone, which included 1.9 kb of upstream
sequence and 2.4 kb of downstream sequence (Figure 4A).
|
sax-1 encodes a protein with homology to serine/threonine
protein kinases, including the 11 highly conserved motifs that
constitute the catalytic domain (Hanks et al., 1988
). The
SAX-1 kinase belongs to a family of serine/threonine kinases that is
conserved from yeast to humans (Figure 4, B and C). SAX-1 is most
closely related to the Ndr kinases (Millward et al., 1995
),
with 62% amino acid identity to human Ndr and 60% identity to
Drosophila Ndr. Certain features distinguish Ndr kinases
from other serine/threonine kinases, including a conserved N-terminal
region and a 34- to 45-amino acid spacer between kinase motifs VII and
VIII. Several close relatives of Ndr possess these features, including
Schizosaccharomyces pombe Orb6, Neurospora COT-1,
and Drosophila Warts/Lats (Yarden et al., 1992
;
Justice et al., 1995
; Xu et al., 1995
; Verde
et al., 1998
). However, the Ndr kinases form a distinct
class: C. elegans has both SAX-1/Ndr and a Warts/Lats
homologue (T20F10.1), and Drosophila has an Ndr kinase as
well as Warts/Lats.
SAX-1 is related to Rho kinases (Figure 4C), with 35% amino acid
identity and 52% amino acid similarity to human
p160ROCK/ROK
. However, Rho kinases lack the
SAX-1 spacer region between kinase subdomains VII and VIII, possess
divergent N termini, and contain an additional C-terminal region that
mediates Rho association (Leung et al., 1995
; Fujisawa
et al., 1996
).
Immediately 3' of the predicted sax-1 gene lies a second predicted ORF with a C1 motif (phorbol ester/diacylglycerol binding) and a C2 motif (calcium binding) that was predicted to be part of the same R11G1.4 protein as SAX-1 by the C. elegans Sequencing Consortium. We found that this gene encodes a separate 811-amino acid protein that does not overlap with SAX-1 (see MATERIALS AND METHODS) and is not required for sax-1 rescue. Its mRNA begins with an SL2 splice leader, suggesting that it may be in a common operon with sax-1.
Isolation of a Candidate sax-1 Null Mutation
The sax-1(ky211) mutation is predicted to disrupt sax-1 splicing and may cause a partial or complete loss of gene function. To obtain a null allele of sax-1, we used a PCR-based strategy to isolate a deletion mutant from a library of 106 EMS- or UV-trimethylpsoralen-mutagenized animals (see MATERIALS AND METHODS). The sax-1(ky491) mutation represents a 1.3-kb deletion of genomic sequence that leads to a frame shift in the sax-1 ORF early in the kinase domain. sax-1(ky491) is predicted to encode a truncated gene product containing only 3 of the 11 conserved kinase domains. Both break points of the deletion occur in exons, and the deleted sequences encompass conserved domains IV, V, and VIA of the sax-1 kinase region. Based on the early frame shift and the complete elimination of conserved kinase sequences, sax-1(ky491) is a candidate null allele. The sax-1(ky491) deletion mutation was fully recessive and caused defects similar to those caused by the sax-1(ky211) allele (Table 1, Figures 1E and 2A), indicating that the partially penetrant, temperature-sensitive defects in the ASJ and ASE neurons represent the sax-1 null phenotype.
A SAX-1::GFP Translational Fusion Is Broadly Expressed in Neurons, Hypodermis, and Muscle
To determine the pattern of sax-1
expression, we inserted a gfp reporter flanked by splice
sites into the final sax-1 intron, 15 amino acids before the
stop codon. The SAX-1::GFP fusion contained all exons,
introns, and 5' regulatory regions present in the rescuing sax-1 subclone. The SAX-1::GFP tag rescued the ASJ
defects of sax-1(ky211) and sax-1(ky491) mutant
animals (Figure 4A). SAX-1::GFP was widely expressed in
embryos and continued to be expressed in larvae in neurons that
contribute axons to the nerve ring (Figure 5A), hypodermal cells, including lateral
seam cells (Figure 5B), and muscle, where the SAX-1::GFP tag
displayed a punctate localization (Figure 5C). The rescuing
SAX-1::GFP fusion was present in the nucleus and cytoplasm of
cells (Figure 5, A-D).
|
Although they express SAX-1::GFP, hypodermal seam cells
do not have obvious defects in sax-1 mutants. They secrete
normal alae, indicating a correct apical/basal polarity, and have an apparently normal cell shape as assessed by expression of the cell
junction marker JAM-1::GFP (Mohler et al., 1998
).
sax-1 Can Function Cell Autonomously to Regulate Cell Shape
Because SAX-1::GFP is broadly expressed, we wanted to
determine whether SAX-1 functions cell autonomously in chemosensory neurons to regulate cell shape and neurite initiation. We used the
gcy-5 promoter (Yu et al., 1997
) to drive
sax-1 expression in the right ASE neuron.
gcy-5::sax-1 expressed in ASER was able to fully
rescue the ASER defects of sax-1 null mutant animals (Figure
5E), suggesting that SAX-1 can function cell autonomously to regulate
ASER cell shape. However, the ASJ ectopic neurite defects were also
partially rescued in these animals (Figure 5E). These results are
consistent with two possibilities: SAX-1 could function cell
autonomously in ASER and nonautonomously in ASJ, or the
gcy-5 promoter may be expressed at a low level in ASJ, allowing partial ASJ rescue.
To determine whether SAX-1 can function cell autonomously in ASJ to repress neurite initiation, we used an independent promoter to express SAX-1 in ASJ but not in ASE. The promoter for the predicted seven-transmembrane-domain receptor srh-1 drives expression in the two ASJ sensory neurons and pharyngeal muscle (Y. Zhang and C.I.B., unpublished results). Expression of the sax-1 cDNA from the srh-1 promoter fully rescued the ectopic neurite defects in the ASJ neurons of sax-1(ky491) null mutant animals but did not rescue the ASER defects (Figure 5E). To determine whether rescuing activity was due to sax-1 expression in ASJ or in pharyngeal muscle, we coinjected the srh-1::sax-1 transgene and an srh-1::gfp fusion to form an unstable extrachromosomal array whose site of expression can be monitored by gfp fluorescence. Mosaic animals with gfp expression in ASJ but not in the pharyngeal muscle were rescued for the ASJ defects (14 of 15 mosaic animals rescued). This result suggests that sax-1 expression in ASJ is sufficient for ASJ rescue, indicating that SAX-1 is likely to function cell autonomously in ASJ to regulate neurite initiation.
An srh-1::sax-1::gfp tag also rescued the ASJ ectopic neurite defects of sax-1 mutants [three independent transgenic lines: 10-12% defective, n = 46-80, each line significantly rescued at p < 0.001; control sax-1(ky491) animals: 61% defective, n = 218]. In larval and adult animals, SAX-1::GFP fluorescence was detected throughout the ASJ cell body, including the nucleus and the cytoplasm, and occasionally in the proximal axon and dendrite (Figure 5D).
The C. elegans RhoA GTPase Can Influence Neuronal Cell Shape
SAX-1 belongs to a kinase family that includes the Rho
kinases, but its targets are unknown. To determine whether SAX-1 might have functions similar to those of the Rho kinases, we explored the
activity of the C. elegans RhoA GTPase in sensory neurons. C. elegans RhoA shares 87% identity with vertebrate RhoA
GTPases and is expressed in nerve ring neurons during larval stages
(Chen and Lim, 1994
). Use of RNA interference to disrupt
rhoA function caused embryonic lethality (E.A. Lundquist and
C.I.B., unpublished observations), precluding a straightforward
loss-of-function analysis. Therefore, we generated mutations in
conserved residues in the rhoA ORF that are predicted to
confer dominant negative (rhoAT19N) or
gain-of-function (rhoAQ63L) properties
(Feig and Cooper, 1988
; Bourne et al., 1991
). Wild-type rhoA, rhoAT19N, and
rhoAQ63L were expressed from the
gcy-5 promoter (Yu et al., 1997
) to drive expression in the ASER chemosensory neuron in late embryonic-, larval-,
and adult-stage animals. The rhoAT19N
allele, which is predicted to reduce endogenous rhoA
function, caused ASER cell shape defects that resembled those of
sax-1 mutant animals (Figure
6D). A second mutation in the GTP-binding
domain, rhoAD13T, also caused cell shape
defects (Figure 6, B and D), suggesting that this allele also functions
in a dominant negative manner. Minimal defects were caused by
expression of rhoA or rhoAQ63L
(Figure 6D). These results suggest that RhoA-dependent pathways can
regulate cell shape in chemosensory neurons. However, the defects
observed in rhoA-expressing animals were less marked than those in sax-1 mutants. Whereas sax-1 mutant cell
bodies were usually more than twice as large as wild type, the
rhoAT19N or
rhoAD13T cell bodies were rarely more than
1.5-fold larger than wild type.
|
A sax-1; rhoAT19N strain had defects that were no more severe than the sax-1 single mutant, suggesting that sax-1 and rhoA affect a similar process (Figure 6E). In agreement with this model, overexpression of sax-1 partly suppressed rhoAD13T defects (Figure 6, C and D), and overexpression of rhoA or rhoAQ63L partly suppressed sax-1 defects (Figure 6E).
| |
DISCUSSION |
|---|
|
|
|---|
The SAX-1 Ndr Kinase Regulates Neuronal Cell Shape
During normal development, neurite outgrowth is limited to
discrete axons and dendrites, and the compact neuronal cell body is
refractory to neurite initiation. In sax-1 mutants,
chemosensory neurons and other neuron types have an extended,
irregularly shaped cell body and ectopic neurite-like processes.
sax-1 activity may stabilize neuronal morphology, maintain
cell polarity, or localize factors that make the rigid cell body
distinct from the exploratory axons. sax-1 encodes a
serine/threonine kinase related to the Drosophila and human
Ndr kinases (Millward et al., 1995
) in a kinase family that
includes S. pombe Orb6, Neurospora COT-1, and Drosophila Warts/Lats. The function of the Ndr kinase
subfamily has not been analyzed previously, but Orb6, COT-1, and
Warts/Lats all influence cell shape (Yarden et al., 1992
;
Justice et al., 1995
; Xu et al., 1995
; Verde
et al., 1998
), suggesting that these kinases participate in
an evolutionarily conserved mechanism that regulates cell morphology.
SAX-1 is the first member of this family found to affect neurons.
SAX-1 and related kinases may preferentially affect particular
subcellular compartments or cell types. sax-1 mutants have abnormal cell bodies, but axon and dendrite guidance in the same neurons appears to be normal. Drosophila warts/lats mutants
exhibit localized epithelial cell shape defects, with abnormal apical surfaces but normal basolateral morphologies (Justice et
al., 1995
). C. elegans, Drosophila, and
humans all have both an ndr/sax-1-like gene and a
warts/lats-like gene, suggesting that these two kinases have
distinct functions. sax-1 defects become more severe as
animals mature, suggesting an ongoing requirement for SAX-1 kinase
activity in the maintenance of cell morphology. The fission yeast Orb6 kinase is similarly required for cell shape maintenance; arrested elongate cells become spherical when orb-6 function is
disrupted (Verde et al., 1995
). Warts/Lats and Orb6 play an
additional role in cell division (Justice et al., 1995
; Xu
et al., 1995
; Verde et al., 1998
; St. John
et al., 1999
), but we have not observed cell proliferation
defects in sax-1 mutants.
The functions of SAX-1 in C. elegans are reminiscent
of the activities of RhoA GTPase in cultured mammalian neurons:
inactivation of RhoA promotes cell flattening and neurite outgrowth,
whereas activation of RhoA causes cell rounding and decreased neurite outgrowth (Jalink et al., 1994
; Gebbink et al.,
1997
). The effect of RhoA on neurite outgrowth has been shown to be
mediated by Rho kinase (Amano et al., 1998
; Hirose et
al., 1998
; Katoh et al., 1998
). We found that dominant
negative rhoA alleles or mutations in the SAX-1 kinase
caused similar cell shape changes in C. elegans sensory
neurons. Our genetic results are consistent with a model in which SAX-1
and RhoA act in a common process affecting cell shape. These
experiments should be interpreted with caution, because they involve
overexpression of wild-type and mutant proteins. However, standard
genetic analysis of this pathway is likely to be difficult, because RNA
interference of rhoA resulted in early embryonic lethality
(E. Lundquist and C.I.B., unpublished data). Mutations in other GTPase
pathways, including the C. elegans MIG-2 GTPase or the
UNC-73 Dbl-homology exchange factor (Zipkin et al., 1997
;
Steven et al., 1998
), do not cause cell shape defects in ASER, indicating that the effects of RhoA expression on cell shape are selective.
We propose that SAX-1, like Rho GTPase and Rho kinase, regulates the
cytoskeleton in neuronal cells to inhibit cell spreading and neurite
initiation. Human Ndr kinase localizes primarily to the nucleus in
cultured cells, but a subpopulation of human Ndr protein is present at
the cell periphery, where it could interact with the cytoskeleton
(Millward et al., 1995
). Orb6/COT-1/Warts family kinases are
related to Rho kinases but do not contain a Rho-binding domain and
other regulatory domains. It is possible that SAX-1 and Rho kinases can
phosphorylate similar targets but are regulated differently.
SAX-1 Functions in Parallel with an Activity-dependent Pathway Mediated by the UNC-43 Calcium/Calmodulin-regulated Kinase
The SAX-1 kinase functions in parallel with an activity-dependent
pathway to inhibit neurite initiation in sensory neurons. Ectopic
chemosensory neurites appear late in development in mutants with
abnormal sensory transduction, ion channel function, or development of
the dendritic sensory endings (Coburn and Bargmann, 1996
; Coburn et al., 1998
; Peckol et al., 1999
). The C. elegans unc-43 gene encodes CaMKII (Reiner et al.,
1999
), and we observed mild neurite defects in unc-43
mutants. Double-mutant analysis suggests that the calcium-permeable
sensory channel TAX-4 functions upstream of the UNC-43 CaMKII in the
activity-dependent pathway. CaMKII has also been implicated in the
activity-dependent regulation of axonal and dendritic branching in
flies and vertebrates (Budnik et al., 1990
; Wang et
al., 1994
; Wu and Cline, 1998
).
Although the ectopic neurite defects in sax-1 and activity
mutants are similar, double-mutant analysis argues that the SAX-1 kinase functions at least partly in parallel with TAX-4/UNC-43, not in
an identical pathway. Moreover, the activity-dependent pathway affects
only neurite initiation, whereas SAX-1 also regulates cell shape. The
human Ndr kinase is regulated by calcium through a domain that is
conserved in SAX-1 (Millward et al., 1998
), suggesting that
SAX-1, like UNC-43, might respond to neuronal activity and calcium.
Alternatively, these two pathways may represent activity-dependent (TAX-4 and UNC-43) and activity-independent (SAX-1) mechanisms that
maintain sensory neuron morphology.
Interestingly, increased activity of the UNC-43 CaMKII can partially
compensate for decreased activity of SAX-1, perhaps by regulating a
common downstream target. SAX-1/Ndr targets are unknown, but the
related Rho kinase and CaMKII both phosphorylate the same residue on
myosin light chain (Edelman et al., 1990
; Amano et al., 1996
). Phosphorylated myosin can regulate actin assembly and
inhibit neurite extension (Tan et al., 1992
; Wang et
al., 1996
), so this is one candidate among many that could be
regulated by SAX-1 and UNC-43. The characterization of SAX-2 and other
components of the SAX-1 pathway should provide further insight into the
mechanisms that regulate neuronal morphology.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to Orion Weiner and John Sedat for deconvolution microscopy of the SAX-1::GFP fusion, Jeff Simske, Yongmei Zhang, Andy Fire, and Emily Troemel for GFP markers, and Rachel Kindt, Orion Weiner, and Maria Gallegos for comments on the manuscript and useful advice during the course of this work. Some of the strains used in this study were obtained from the Caenorhabditis Genetics Center. This work was supported by the Howard Hughes Medical Institute. J.A.Z. and D.M.T. were predoctoral fellows of the National Science Foundation. E.L.P. was supported by a research fellowship from the American Heart Association, California Affiliate. C.I.B. is an Investigator of the Howard Hughes Medical Institute.
| |
FOOTNOTES |
|---|
Present addresses:
* Department of Molecular Biology,
Princeton University, Princeton, NJ 08544; and
Project
BIOTECH, University of Arizona, Tucson, AZ 85721.
Corresponding author. E-mail address:
cori{at}itsa.ucsf.edu.
| |
REFERENCES |
|---|
|
|
|---|
. induces neurite retraction.
J. Biol. Chem.
273, 2489-2492This article has been cited by other articles:
![]() |
C. Kurischko, V. K. Kuravi, N. Wannissorn, P. A. Nazarov, M. Husain, C. Zhang, K. M. Shokat, J. M. McCaffery, and F. C. Luca The Yeast LATS/Ndr Kinase Cbk1 Regulates Growth via Golgi-dependent Glycosylation and Secretion Mol. Biol. Cell, December 1, 2008; 19(12): 5559 - 5578. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Vogt and S. Seiler The RHO1-specific GTPase-activating Protein LRG1 Regulates Polar Tip Growth in Parallel to Ndr Kinase Signaling in Neurospora Mol. Biol. Cell, November 1, 2008; 19(11): 4554 - 4569. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Maerz, C. Ziv, N. Vogt, K. Helmstaedt, N. Cohen, R. Gorovits, O. Yarden, and S. Seiler The Nuclear Dbf2-Related Kinase COT1 and the Mitogen-Activated Protein Kinases MAK1 and MAK2 Genetically Interact to Regulate Filamentous Growth, Hyphal Fusion and Sexual Development in Neurospora crassa Genetics, July 1, 2008; 179(3): 1313 - 1325. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Williams Jennifer Zallen: Decoding the developmental dance J. Cell Biol., March 5, 2008; 180(5): 850 - 851. [Full Text] [PDF] |
||||
![]() |
F. J. Walton, J. Heitman, and A. Idnurm Conserved Elements of the RAM Signaling Pathway Establish Cell Polarity in the Basidiomycete Cryptococcus neoformans in a Divergent Fashion from Other Fungi Mol. Biol. Cell, September 1, 2006; 17(9): 3768 - 3780. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Seiler, N. Vogt, C. Ziv, R. Gorovits, and O. Yarden The STE20/Germinal Center Kinase POD6 Interacts with the NDR Kinase COT1 and Is Involved in Polar Tip Extension in Neurospora crassa Mol. Biol. Cell, September 1, 2006; 17(9): 4080 - 4092. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Jia and S. W. Emmons Genes That Control Ray Sensory Neuron Axon Development in the Caenorhabditis elegans Male Genetics, July 1, 2006; 173(3): 1241 - 1258. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. McMullan, E. Hiley, P. Morrison, and S. J. Nurrish Rho is a presynaptic activator of neurotransmitter release at pre-existing synapses in C. elegans Genes & Dev., January 1, 2006; 20(1): 65 - 76. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Stegert, A. Hergovich, R. Tamaskovic, S. J. Bichsel, and B. A. Hemmings Regulation of NDR Protein Kinase by Hydrophobic Motif Phosphorylation Mediated by the Mammalian Ste20-Like Kinase MST3 Mol. Cell. Biol., December 15, 2005; 25(24): 11019 - 11029. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. He, K. Emoto, X. Fang, N. Ren, X. Tian, Y.-N. Jan, and P. N. Adler Drosophila Mob Family Proteins Interact with the Related Tricornered (Trc) and Warts (Wts) Kinases Mol. Biol. Cell, September 1, 2005; 16(9): 4139 - 4152. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Leonhard and P. Nurse Ste20/GCK kinase Nak1/Orb3 polarizes the actin cytoskeleton in fission yeast during the cell cycle J. Cell Sci., March 1, 2005; 118(5): 1033 - 1044. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. He, X. Fang, K. Emoto, Y.-N. Jan, and P. N. Adler The Tricornered Ser/Thr Protein Kinase Is Regulated by Phosphorylation and Interacts with Furry during Drosophila Wing Hair Development Mol. Biol. Cell, February 1, 2005; 16(2): 689 - 700. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Stork, A. Zhdanov, A. Kudersky, T. Yoshikawa, K. Obata, and H.-C. Pape Neuronal Functions of the Novel Serine/Threonine Kinase Ndr2 J. Biol. Chem., October 29, 2004; 279(44): 45773 - 45781. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Bichsel, R. Tamaskovic, M. R. Stegert, and B. A. Hemmings Mechanism of Activation of NDR (Nuclear Dbf2-related) Protein Kinase by the hMOB1 Protein J. Biol. Chem., August 20, 2004; 279(34): 35228 - 35235. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Stegert, R. Tamaskovic, S. J. Bichsel, A. Hergovich, and B. A. Hemmings Regulation of NDR2 Protein Kinase by Multi-site Phosphorylation and the S100B Calcium-binding Protein J. Biol. Chem., May 28, 2004; 279(22): 23806 - 23812. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Hou, D. A. Guertin, and D. McCollum Initiation of Cytokinesis Is Controlled through Multiple Modes of Regulation of the Sid2p-Mob1p Kinase Complex Mol. Cell. Biol., April 15, 2004; 24(8): 3262 - 3276. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mehta, P. M. Loria, and O. Hobert A Genetic Screen for Neurite Outgrowth Mutants in Caenorhabditis elegans Reveals a New Function for the F-box Ubiquitin Ligase Component LIN-23 Genetics, March 1, 2004; 166(3): 1253 - 1267. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Wiley, S. Marcus, G. D'urso, and F. Verde Control of Cell Polarity in Fission Yeast by Association of Orb6p Kinase with the Highly Conserved Protein Methyltransferase Skb1p J. Biol. Chem., June 27, 2003; 278(27): 25256 - 25263. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tamaskovic, S. J. Bichsel, H. Rogniaux, M. R. Stegert, and B. A. Hemmings Mechanism of Ca2+-mediated Regulation of NDR Protein Kinase through Autophosphorylation and Phosphorylation by an Upstream Kinase J. Biol. Chem., February 21, 2003; 278(9): 6710 - 6718. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Hou, D. J. Wiley, F. Verde, and D. McCollum Mob2p interacts with the protein kinase Orb6p to promote coordination of cell polarity with cell cycle progression J. Cell Sci., January 1, 2003; 116(1): 125 - 135. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Jorgensen, B. Nelson, M. D. Robinson, Y. Chen, B. Andrews, M. Tyers, and C. Boone High-Resolution Genetic Mapping With Ordered Arrays of Saccharomyces cerevisiae Deletion Mutants Genetics, November 1, 2002; 162(3): 1091 - 1099. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. Bulow, K. L. Berry, L. H. Topper, E. Peles, and O. Hobert Heparan sulfate proteoglycan-dependent induction of axon branching and axon misrouting by the Kallmann syndrome gene kal-1 PNAS, April 30, 2002; 99(9): 6346 - 6351. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Fei, B. He, and P. N. Adler The growth of Drosophila bristles and laterals is not restricted to the tip or base J. Cell Sci., January 10, 2002; 115(19): 3797 - 3806. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bidlingmaier, E. L. Weiss, C. Seidel, D. G. Drubin, and M. Snyder The Cbk1p Pathway Is Important for Polarized Cell Growth and Cell Separation in Saccharomyces cerevisiae Mol. Cell. Biol., April 1, 2001; 21(7): 2449 - 2462. [Abstract] [Full Text] |
||||
![]() |
L.-L. Du and P. Novick Pag1p, a Novel Protein Associated with Protein Kinase Cbk1p, Is Required for Cell Morphogenesis and Proliferation in Saccharomyces cerevisiae Mol. Biol. Cell, February 1, 2002; 13(2): 503 - 514. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||