![]() |
|
|
Vol. 11, Issue 9, 3191-3203, September 2000


and
Departments of *Neurosciences and
Cell Biology and
Physiology University of New Mexico School of Medicine, Albuquerque,
New Mexico 87131; and §Program in Molecular Pharmacology
and Therapeutics, Memorial Sloan Kettering Cancer Center, New York, NY
10021; and
Department of Neurology, University of
Alabama, Birmingham
| |
ABSTRACT |
|---|
|
|
|---|
The RNA-binding protein HuD binds to a regulatory element in the 3' untranslated region (3' UTR) of the GAP-43 mRNA. To investigate the functional significance of this interaction, we generated PC12 cell lines in which HuD levels were controlled by transfection with either antisense (pDuH) or sense (pcHuD) constructs. pDuH-transfected cells contained reduced amounts of GAP-43 protein and mRNA, and these levels remained low even after nerve growth factor (NGF) stimulation, a treatment that is normally associated with protein kinase C (PKC)-dependent stabilization of the GAP-43 mRNA and neuronal differentiation. Analysis of GAP-43 mRNA stability demonstrated that the mRNA had a shorter half-life in these cells. In agreement with their deficient GAP-43 expression, pDuH cells failed to grow neurites in the presence of NGF or phorbol esters. These cells, however, exhibited normal neurite outgrowth when exposed to dibutyryl-cAMP, an agent that induces outgrowth independently from GAP-43. We observed opposite effects in pcHuD-transfected cells. The GAP-43 mRNA was stabilized in these cells, leading to an increase in the levels of the GAP-43 mRNA and protein. pcHuD cells were also found to grow short spontaneous neurites, a process that required the presence of GAP-43. In conclusion, our results suggest that HuD plays a critical role in PKC-mediated neurite outgrowth in PC12 cells and that this protein does so primarily by promoting the stabilization of the GAP-43 mRNA.
| |
INTRODUCTION |
|---|
|
|
|---|
In addition to transcriptional factors, RNA-binding proteins play
a critical role in the developmental control of gene expression. Among
these is ELAV (embryonic lethal abnormal vision), an RNA-binding protein identified in Drosophila, where the gene is required
for normal development and maintenance of the nervous system (Campos et al., 1985
; Robinow et al., 1988
). In higher
vertebrates and mammals, four members of the ELAV-like family have been
identified. These are also referred to as Hu proteins, namely HuR (also
known as HuA), HuB (Hel-N1), HuC, and HuD, because these are targets of
anti-Hu antibodies present in the sera of patients with paraneoplastic encephalomyelitis (Dalmau et al., 1992
). HuR is ubiquitously
expressed (Ma et al., 1996
), while HuB, HuC, and HuD are
expressed uniquely in the nervous system. Recent studies indicate that
overexpression of neural ELAV-like proteins is sufficient to induce
neuronal differentiation in vitro and in vivo (Wakamatsu and Weston,
1997
; Akamatsu et al., 1999
; Antic et al., 1999
;
Kasashima et al., 1999
). While the exact function and
targets of ELAV/Hu proteins remain to be fully elucidated, it seems
likely that this family of RNA-binding proteins controls neuronal
differentiation by selectively modulating the expression of
neural-specific, growth-associated genes.
The growth-associated protein GAP-43 is expressed in neurons primarily
during the initial establishment and regeneration of neural connections
(Skene, 1989
; Benowitz and Routtenberg, 1997
). During the development
of the nervous system, GAP-43 expression correlates with axonal growth
in all neural pathways examined (Benowitz and Perrone-Bizzozero, 1991
).
Both transcriptional and posttranscriptional mechanisms control GAP-43
gene expression in neurons. Basic helix-loop-helix proteins (bHLH)
interact with sequences in the promoter region to regulate the
neural-specific expression of the gene (Nedivi et al., 1992
;
Eggen et al., 1995
; Chiaramello et al., 1996
;
Kinney et al., 1996
). In addition, posttranscriptional mechanisms control GAP-43 gene expression in PC12 cells (Federoff et al., 1988
; Perrone-Bizzozero et al., 1991
,
1993
) and in hippocampal neurons in vivo (Cantallops and Routtenberg,
1999
). In PC12 cells, NGF induces the stabilization of the GAP-43 mRNA
via a mechanism that depends on protein kinase C (PKC) activation but
does not require de novo protein synthesis; Perrone-Bizzozero et
al., 1991
; Perrone-Bizzozero et al., 1993
). Moreover,
GAP-43 mRNA stability depends on the interaction of highly conserved
sequences in the 3' untranslated region (3' UTR) of the mRNA (Kohn
et al., 1996
) and neuronal-specific RNA-binding proteins
(Kohn et al., 1996
; Irwin et al., 1997
). One of
these GAP-43 mRNA-binding proteins was recently identified as the
ELAV-like protein HuD (Chung et al., 1997
). This protein
binds to the GAP-43 3' UTR within a region that contains a U-rich
TPA-responsive element that controls mRNA stability (Tsai et
al., 1997
).
In view of HuD's neuronal-specific expression (Okano and Darnell,
1997
; Clayton et al., 1998
), developmental regulation
(Wakamatsu and Weston, 1997
), and binding properties (Chung et
al., 1997
), we proposed that this RNA-binding protein was involved
in the posttranscriptional regulation of the GAP-43 gene during
neuronal differentiation. To test this hypothesis, we measured the
levels of the GAP-43 mRNA, protein, and neurite outgrowth in PC12 cells expressing either high levels of HuD antisense RNA (pDuH) or HuD sense
RNA and protein (pcHuD). Using antisense methods, we found that HuD is
required for the control of GAP-43 mRNA stability and induction of
GAP-43 expression and neurite outgrowth, in response to PKC activation
by NGF or phorbol esters. Alternatively, overexpression of HuD in PC12
cells was sufficient to increase GAP-43 mRNA stability, protein
expression, and GAP-43-dependent process outgrowth. These results
confirm the role of this RNA-binding protein in the posttranscriptional control of the GAP-43 gene and emphasize the significance of this ELAV-like protein in early events in neural development.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid Preparation
The pDuH and pcHuD constructs were prepared using HuD cDNA from
the pGEX-HuD construct (Chung et al., 1996
). The HuD
fragment was removed from the pGEX vector with BamHI and
ligated into the same restriction enzyme site in pcDNA3 (Invitrogen,
Boston, MA). After amplification, plasmids were screened for antisense
(pDuH) orientation of the HuD cDNA. To prepare pcHuD, the HuD cDNA was cloned in the sense orientation in pcDNA3, downstream of the myc-tag sequence (EQKLISEEDL) engineered adjacent to the HindIII
site in the vector.
Generation of Stable Transfectants
Transfection experiments were performed on the original PC12
cell line (Greene and Tischler, 1976
) and on two different PC12 cell
clones isolated by Dr. Richard Burry, namely the PC12-N21 clone,
which contains GAP-43 and exhibits a typical phenotypic differentiation
in response to NGF (Burry and Perrone-Bizzozero, 1993
), and the GAP-43
deficient subclone PC12-N36, which does not differentiate in the
presence of the growth factor (Tsai et al., 1997
). Cells
were grown at 37°C, 5% CO2, in RPMI-1640 media supplemented with
7.5% horse serum and 2.5% fetal calf serum (Perrone-Bizzozero et al., 1993
). All cell transfections were performed by
electroporation as previously described (Tsai et al., 1997
).
Cells transfected with pcDNA3 vectors were selected with the neomycin
analog G418 (500 µg/ml). Stable transfectants of PC12-N36 cells with
the GAP-43 cDNA in pMEP4 vector (Invitrogen) were maintained with
hygromycin B (150 µg/ml, Calbiotech, San Diego, CA).
Cotransfection experiments used double selection with both G418 and
hygromycin B.
Cell Morphology
Control and transfected PC12 cells were cultured on
poly-lysine-coated dishes and treated with either nerve growth factor (NGF; 100 ng/ml), 12-O-tetradecanoylphorbol-13-acetate (TPA; 160 nM),
or dibutyryl cyclic AMP (cAMP; 1 mM). After treatment, cells were grown
for 48 or 96 h, then fixed with 4% paraformaldehyde (PFA). Phase
contrast micrographs were obtained using a Zeiss Axiovert microscope
(Carl Zeiss, Inc, Thornwood, NY). In some experiments, cells were
stained with 0.1% Coomassie blue (Fisher, Norcross, GA) in 50%
methanol/10% acetic acid to aid in neurite visualization as previously
described (Perrone-Bizzozero et al., 1986
). Cells were
classified as undifferentiated, if they were round with no processes,
or differentiated, if they were bipolar or polygonal with one or more
processes longer than the diameter of the cell body. At least 300 cells
were analyzed per condition. Statistical analyses were performed using
a two-tailed Student's t test.
Immunocytochemistry
PC12 cells were grown for 48 or 96 h on
poly-L-lysine-coated Labtek slides (Nunc, Milwaukee, WI), then
fixed with 4% PFA for 30 min at room temperature. Fixed cells were
incubated for 20 min at room temperature, in buffer containing 2%
bovine serum albumin (BSA), in Tris-buffered saline (TBS) at pH 7.4, with 0.1% Triton (T) X-100 (BSA-TBST). GAP-43 was detected with a
sheep polyclonal antibody (Benowitz et al., 1988
) at 1:250
dilution. Cells were incubated with the primary antibodies for 2 h, then incubated with donkey antisheep-FITC (1:50, Sigma
Immunochemicals, St. Louis, MO) in BSA-TBST for 1 h in the dark.
Coverslips were rinsed with phosphate buffered saline (PBS) and mounted
onto glass slides with PermaFluor aqueous mounting media (Immunon,
Pittsburgh, PA). Photographs were taken on a Zeiss Axiovert microscope
at 400X magnification. For some experiments, images were scanned using
an Olympus microscope (BX60) with color video camera (Optronics DEI-470), and GAP-43 immunofluorescence was measured using the Bioquant
image analysis software (R and M Biometrics, Nashville, TN).
Measurements were determined for control cells and NGF-induced cells.
Data were collected from at least three fields per condition and cell type.
Generation of HuD-specific Antibodies
Because none of the antibodies available against ELAV/Hu
proteins recognize specific members of this family (King et
al., 1994
; Barami et al., 1995
), we generated
polyclonal antibodies (
-HuD) using an N-terminal peptide that is
uniquely present in HuD (SNNRNCPSPMQTGA, Research Genetics, Huntsville,
AL). The specificity of the antibody for HuD is shown in Figure
1A.
|
Western Blot Analysis
Proteins from control and transfected cell lines were extracted
using a simultaneous RNA/DNA/protein isolation reagent (Tri reagent,
Sigma, St. Louis, MO) and solubilized in 0.1% SDS. Aliquots containing
50 µg protein were separated on 10% (wt/vol) polyacrylamide gels and
electrotransferred onto Immunoblot PVDF membranes (Bio-Rad Laboratories, Hercules, CA). HuD levels were determined using our
antipeptide antibody, while GAP-43 was detected using a polyclonal antibody to rat GAP-43 as previously described (Perrone-Bizzozero et al., 1996
). Specific protein bands were visualized using
Renaissance Western blot chemiluminescence reagent (Dupont NEN, Boston,
MA). Loading variations in protein levels in each band were corrected using either the density of the Coomassie Blue staining or a monoclonal anti-
-tubulin clone TUB 2.1 (Sigma, St. Louis MO). The amount of
protein was determined densitometrically using the FotoAnaylyst system
(Fotodyne, Inc., New Berlin, WI).
Northern Blots and Quantitative RT-PCR
After RNA extraction, 15 µg total RNA from each sample was run
on 1.1% formaldehyde-agarose gels, as described by Perrone-Bizzozero et al., (1993)
. Membranes were probed for GAP-43 mRNA or
glycerol-3-phosphate dehydrogenase (G3PD) mRNA using
32P-radiolabeled cDNA probes generated using
random priming (Prime-a-Gene, Promega, Madison, WI).
RT-PCR reactions were performed using the Titan One Tube RT-PCR System
(Roche Molecular Biochemical, Indianapolis, IN). Reaction components
were as described in the manufacturer's protocol, with the addition of
1 µCi 32P
-dCTP per PCR reaction. Cycle and
quantity titrations were used to determine the linear range of
amplification for each set of primers used. RT-PCR reactions using HuD
and GAP-43 primers and 0.5 and 1.0 µg RNA were within the linear
range of response between 18 and 26 cycles (data not shown). Similarly,
reactions were quantitative for G3PD using a 20-fold dilution of the
total RNA and the same PCR conditions. The temperature profile for PCR reactions was 45 min at 45°C, 2 min at 94°C, 22 cycles of 94°C for 30 s, 55°C for 1 min, and 68°C for 2 min, followed by a
final cycle of 7 min at 68°C. Primers used for RT-PCR reactions were: 5'ATAAGTAAGGGTGAGAAATTCAGG3' and 5'TGCTTAATATGGCCTTATGGCG3' (Steller et al., 1996
) for rat HuD, 5'GGAATAAGGATCCGAGGAGGAAAGGAG3',
5'CTTAAAGTTCAGGCATGTTCTTGGT3' (Basi et al., 1987
; Karns
et al., 1987
) for rat GAP-43, and 5'CCCACGGCAAGTTCAAC3' and
5'TGGCAGGTTTCTCCAGGCGGC3' (accession number XO2231) for G3PD. Rat-specific HuD primers were derived from nonconserved sequences in
the 3' UTR and did not detect human HuD sequences (data not shown). The
Protein Chemistry Laboratory of the University of New Mexico Health
Sciences Center prepared all primers. PCR reactions were performed in a
Perkin Elmer-Cetus (Wellesley, MA) Gene Amp System 9600. Reaction products were analyzed on 5% acrylamide-TBE gels (Bio-Rad)
and quantitated using a phosphorimager (Storm 860, Molecular Dynamics)
and ImageQuant software.
GAP-43 mRNA Stability Analysis in Transfected Cell Lines
To determine the effect of HuD on the stability of GAP-43 mRNA,
PC12-N36 cells were cotransfected with the full-length GAP-43 in pMEP4
(Kohn et al., 1996
) and pcHuD, pDuH, or pcDNA3. RNA decay assays were performed as previously described (Tsai et al.,
1997
). Briefly, cultures were treated with 5 µM cadmium, which causes an 8- to 10-fold activation of the human metallothionein-IIA promoter in the pMEP4 vector. After induction, cadmium was removed, and cells
were collected at various intervals. RNA was isolated with the Tri
reagent according to the manufacturer's recommended protocol. Northern
blots were probed with radiolabeled cDNAs for GAP-43 and G3PD. The
intensity of mRNA bands was determined either densitometrically or
using a phosphorimager. Loading variations were corrected by normalizing optical densities of the GAP-43 bands with those of G3PD.
The half-life (T1/2) of the GAP-43 transcripts
was calculated from the slope of the plot of logarithm of relative mRNA
levels versus time of decay, using linear regression analysis
(Perrone-Bizzozero et al., 1993
).
HuD Immunoprecipitation Studies
The in vivo interaction of the GAP-43 mRNA and HuD protein was
investigated using a combination of immunoprecipitation and RT-PCR
analysis that was recently developed for other ELAV-like proteins
(Antic et al., 1999
). HuD was immunoprecipitated from cell
extracts essentially as we have previously described for the separation
of UV-cross-linked RNA-protein complexes from in vitro binding
reactions (Chung et al., 1997
). Briefly, cell extracts were
prepared using a buffer containing 1% NP-40, 10 mM Tris-HCl, pH 7.5, 1% BSA, 150 mM NaCl, and 2 mM EDTA. Our anti-HuD antibody was added at
1:100 dilution, and antigen-antibody complexes were separated using
Protein-G-beads (Sigma). RNAs were purified from the beads using RNA
Aqueous kit (Ambion, Austin TX) and RT-PCR reactions for GAP-43 were
performed as indicated before.
| |
RESULTS |
|---|
|
|
|---|
Antisense HuD RNA Decreases HuD and GAP-43 Expression in PC12 Cells
To begin our assessment of HuD protein function in GAP-43 gene
expression and neuronal differentiation, we generated stable transfectants of PC12 cells with the pcDNA3 vector containing human HuD
sequences in the antisense orientation (pDuH). Transfection experiments
were performed using the original PC12 cell line (Greene and Tischler,
1976
) and PC12-N21, a clone that shows a robust differentiation in
response to NGF (Burry and Perrone-Bizzozero, 1993
). To avoid selection
of a particular cell phenotype, stable transfectants of both the
original PC12 cell line and the N21 clone were selected without further
cloning and used in parallel for all the experiments. Given that both
transfected lines showed identical phenotypic responses in our studies,
representative results from each of these PC12 cells are shown herein.
HuD specific primers and antibodies were used to evaluate the levels of
endogenous mRNA and protein in control and transfected PC12 cells. Our
HuD polyclonal antibodies specifically recognized recombinant human HuD
(Figure 1A) and endogenous rat protein (Figure 1C), but they did not
react against the neuronal ELAV-like proteins HuC and HuB or with the
ubiquitously expressed HuR. In contrast, the anti-Hu mAb16A11 antibody
(Marusich et al., 1994
; Wakamatsu and Weston, 1997
)
recognized all three neuronal ELAV proteins, HuB, HuC, and HuD, but did
not react against HuR. The presence of HuR in the blot was confirmed
using an antibody that specifically recognizes this ELAV-like protein
(Wang et al., 2000
; data not shown). Rat-specific HuD
primers (Steller et al., 1996
) were used to determine the
levels of the endogenous mRNA in the presence of exogenous human
sequences. As reported by Steller et al., (1996)
, we
detected a major and a minor PCR product for HuD in PC12 cells, of 360 and 400 bp, respectively (Figure 1B). These sizes correspond to two of
the mRNA splicing variants, HuD and HuDpro (Liu et al., 1995
). Analysis of HuD mRNA levels in the different cells indicated that this mRNA was significantly reduced (by 75%) in pDuH transfected cells relative to untransfected (PC12) or vector only (pcDNA3) transfected cells (Figure 2A). In
agreement with the RT-PCR data, Western blots revealed that the
antisense treatment resulted in decreased levels of HuD protein in pDuH
cells (Figure 1C). Although ~ 30% of residual HuD remained in
the cells, the decrease was specific for this protein and did not
affect the levels of other ELAV-like proteins in the cells (data not
shown). In agreement with Steller et al., (1996)
, we found
that NGF did not affect the expression of this protein within the first
24 h of treatment. As the NGF-dependent stabilization of the
GAP-43 mRNA does not require newly synthesized proteins, it is likely
that HuD is the previously described translation-indepedent factor
involved in this process (Perrone-Bizzozero et al., 1993
).
|
Having established the effects of HuD antisense RNA on HuD levels, we
used Western and Northern blots to evaluate its effects on GAP-43 gene
expression. Analysis of mRNA and protein levels in untransfected PC12,
pDuH, and pcDNA3 transfectants demonstrated that all three cell types
produced GAP-43 mRNA and protein (Figure 2). However, the endogenous
GAP-43 mRNA levels in pDuH cells were only at 30% of the levels
observed in the other cell types (Table 1). Thus, the low levels of GAP-43 in
pDuH cells correlated well with residual HuD expression in these
cultures. When PC12 cells were treated with NGF for 24 h, all
cells responded with an approximate 2- to 3-fold induction of the mRNA
and protein. However, in pDuH cells, this induction still left GAP-43
levels at 30% of those found in NGF-treated untransfected PC12 cells,
which were equivalent to the levels of the protein in PC12 cells in the
absence of NGF (Figure 1C). This result suggests that the residual HuD
protein present in pDuH-transfected cells is not sufficient to mediate the NGF-dependent stabilization of the mRNA.
|
Decreased HuD Expression Results in the Destabilization of the GAP-43 mRNA
We have shown previously that HuD binds to an element in the
GAP-43 3'UTR that controls the stability of the mRNA (Chung et al., 1997
). Thus, it is likely that a decrease in HuD expression could affect the rate of degradation of the mRNA. To evaluate this
possibility, we examined the half-life of the GAP-43 mRNA in control
and pDuH transfected cells (Figure 3).
For these studies, a GAP-43 deficient PC12 subclone, PC12-N36, was
cotransfected with full length GAP-43 cDNA in the inducible expression
vector pMEP4 (Kohn et al., 1996
) and with either pDuH or
pcDNA3. As in previous studies, cells were exposed for 16 h to 5 µM cadmium to induce high levels of GAP-43 mRNA via activation of the
metallothionein promoter in pMEP4 (Tsai et al., 1997
). After
induction, cadmium was removed and the RNA harvested at various time
points. As shown in Figure 3, the GAP-43 mRNA in pcDNA3 transfected
cells decayed with a half-life of 5 h, similar to that observed in
untransfected PC12 cells. In pDuH cells, however, the half-life of the
mRNA decreased to ~ 3 h, indicating that GAP-43 mRNA
stability is linked to the levels of HuD protein in the cell (Table 1).
|
Defective Neurite Outgrowth in PC12 Cells Expressing Low Levels of HuD
In view of the observed defect in GAP-43 gene expression in cells
transfected with antisense HuD RNA, subsequent experiments examined the
morphological differentiation of pDuH-transfected cells in response to
NGF (Figure 4). Since GAP-43 is involved in early stages of neurite outgrowth, we examined the changes in cell
morphology during the first 2 days of NGF exposure. At this time,
neurites are still immature and elongate about one cell body length
(Jacobs et al., 1986
). Unlike untransfected PC12 cells, we
found that pDuH cells did not respond to NGF with increased outgrowth
of neurites. After 48 h of stimulation, pDuH cells exhibited only
very short stubby processes (Figure 4A), which failed to elongate even
with longer NGF exposures (data not shown). In addition, pDuH cells did
not exhibit the characteristic flattening and increase in cell body
size that normally accompanies PC12 differentiation. Immunocytochemical
analysis of GAP-43 expression in the cells (Figure 4B) demonstrated
that the defect in neurite outgrowth correlated with a decrease in
GAP-43 levels in pDuH cells. In unstimulated control PC12 and pDuH
cells, GAP-43 was localized diffusely throughout the cytoplasm. After
two days of NGF treatment, GAP-43 was still present in the cell body of
PC12 cells, but more intense staining was seen in the processes and
growth cones. In contrast, NGF-treated pDuH cells showed cytoplasmic
localization of GAP-43 with intense staining in the perinuclear region.
Analysis of the intensity of the immunofluorescence indicated that pDuH cells contained significantly lower levels of GAP-43 than wild-type PC12 cells and that these levels did not change in the presence of NGF
(data not shown).
|
HuD Protein Is Required for Phorbol Ester-dependent, But Not for cAMP-dependent, Neurite Outgrowth
To evaluate the extent of the defect observed in pDuH cells,
additional studies compared the responses of pDuH, PC12, and pcDNA3-transfected cells to various agents that are known to mimic the
effect of NGF on cell differentiation (Figure
5). Exposure of pDuH cells to the phorbol
ester TPA failed to induce neurite outgrowth and resulted only in the
extension of short stubby processes. In contrast, pDuH cells exhibited
normal process outgrowth in the presence of dibutyryl-cAMP, an agent
that induces neurite outgrowth via a different signaling pathway
(Greene et al., 1986
; Burry, 1998
). As expected,
untransfected PC12 cells and pcDNA3-transfected cells exhibited normal
process outgrowth in response to all agents (Figure 5B).
|
Phorbol esters are known to mimic the effect of NGF on GAP-43
expression (Perrone-Bizzozero et al., 1993
). Therefore, it
was conceivable that the lack of response of pDuH cells to TPA could be
due to the low levels of GAP-43 protein in the cells (Figure 2). To
test this idea, we exposed a GAP-43-deficient PC12 cell clone,
PC12-N36, to similar treatments. As shown in Figure
6 and Table
2, PC12-N36 cells, like pDuH-transfected
cells, did not exhibit significant process outgrowth in response to NGF
or TPA but differentiated normally in response to cAMP. The absence of GAP-43 mRNA in the PC12-N36 cells was confirmed using Northern blots
(not shown) and RT-PCR (Figure 8C, lane c). The finding that neither
pDuH cells nor GAP-43-deficient PC12 cells were able to differentiate
in response to PKC activators suggest that HuD-mediated process
outgrowth is selectively triggered by this signaling pathway and that
it requires the presence of GAP-43 in the cells.
|
|
Overexpression of HuD Increases GAP-43 mRNA Stability, Gene Expression, and Neurite Outgrowth in the Absence of NGF
To further address the role of HuD in GAP-43 gene expression and
PC12 differentiation, we generated two additional stable PC12 cell
lines expressing HuD mRNA in the sense orientation (pcHuD). The
original PC12 line and PC12-N36 cells were transfected with pcHuD and
stable transfectants were used for gene expression and morphometric
studies (Figure 7). Analysis of GAP-43
expression in these cultures indicated that pcHuD cells contained
higher levels of the mRNA and protein under basal conditions and that these levels did not increase upon NGF stimulation (Figure 7A,B). pcHuD
cells also contained 2-3 fold higher levels of HuD than untransfected
PC12 cells (Figure 7B) and showed spontaneous process outgrowth in the
absence of NGF (Figure 7C). Consistent with the observed up-regulation
of GAP-43 expression in pcHuD cells, mRNA decay assays indicated that
overexpression of HuD protein increased the half-life of the GAP-43
mRNA from 5 h to 9 h (Figure 8,
Table 1). To confirm that HuD was bound to the GAP-43 mRNA in vivo, we
used a combination of immunoprecipitation and RT-PCR. This procedure
was successfully used to demonstrate the interaction of other ELAV/Hu
proteins to their target mRNAs (Antic et al., 1999
). As
shown in Figure 8C, GAP-43 mRNA could be detected in the pellet after
HuD immunoprecipitation (lane b). These results suggest that HuD
protects the GAP-43 mRNA from ribonuclease attack by binding to its 3'
UTR. Supporting this idea, we have recently found that a GAP-43 mRNA
molecule that is lacking the HuD binding site is not stabilized by the
RNA-binding protein (Beckel-Mitchener et al., unpublished
observations).
|
|
HuD-induced Neurite Outgrowth Requires the Presence of GAP-43
To evaluate whether the effect of HuD on neurite outgrowth
was due to its effects on GAP-43 levels, we overexpressed HuD in PC12-N36 cells that do not contain any endogenous GAP-43. Cells were
transfected with pcDNA3 vector alone or with vector containing HuD
sequences (Figure 9A, pcDNA3 and HuD,
respectively). To control for the effect of GAP-43 in neurite
outgrowth, some PC12-N36 cultures were also transfected with GAP-43 in
the pMEP-4 vector (GAP-43), or were cotransfected with pcHuD and
pMEP4-GAP-43 (HuD + GAP-43). GAP-43 expression in these transfected
cultures was induced using 2.5 µM CdCl2 as described by (Neve
et al., 1999
). When transfected alone, neither HuD nor
GAP-43 was able to cause significant process outgrowth in the cells.
Only the combination of HuD and GAP-43 resulted in extensive neurite
outgrowth in the absence of NGF (Figure 9A). Similar results were
observed in the presence of NGF or the phorbol ester TPA (Figure 9B).
Cultures expressing GAP-43 (GAP-43 and pcHuD + GAP-43) showed a robust
neurite outgrowth in response to these agents while those without
GAP-43 (pcDNA3 and HuD) did not. As noted before, in the presence of
decreased amounts of GAP-43 (Figure 4A) or in the absence of this
protein (Figure 5A), cells exhibited process outgrowth only upon
stimulation with dibutyryl-cAMP. The only cell type upon which cAMP had
no effect was the pcHuD-transfected PC12 N36 cells, suggesting that excess HuD in the absence of GAP-43 may interfere with this signaling pathway. Altogether these results support the notion that HuD is a
stabilizing factor for the GAP-43 mRNA and that GAP-43 expression is
critical to mediate HuD's effects on neurite outgrowth.
|
| |
DISCUSSION |
|---|
|
|
|---|
The control of GAP-43 gene expression occurs through both
transcriptional and posttranscriptional mechanisms, with the latter mediated by changes in the stability of the mRNA (Perrone-Bizzozero et al., 1991
; Perrone-Bizzozero et al., 1993
). In
this study, we used antisense and sense RNA strategies to investigate
the role of the RNA-binding protein HuD in GAP-43 mRNA stability and expression in PC12 cells. We found a tight correlation between the
effect of HuD on GAP-43 gene expression and neurite outgrowth. PC12
cells expressing HuD antisense RNA (pDuH) had decreased levels of both
GAP-43 mRNA and protein and failed to extend neurites in response to
NGF and phorbol esters. These findings are in agreement with previous
studies from our laboratory demonstrating that phorbol ester treatment
mimics the effect of NGF on GAP-43 gene expression and mRNA stability
and process outgrowth (Perrone-Bizzozero et al., 1993
).
Moreover, HuD's binding site is located within the TPA-responsive
element in the GAP-43 3'UTR and the phorbol ester increases its
affinity for these sequences (Chung et al., 1997
; Tsai
et al., 1997
). Based upon these results, we propose that HuD
is an essential factor for controlling GAP-43 mRNA stability, GAP-43
expression, and neurite outgrowth in response to PKC activation.
HuD is a member of the ELAV family of RNA binding proteins first
discovered in Drosophila (Campos et al., 1985
;
Szabo et al., 1991
). In Drosophila, the
elav gene is required for the normal development and
maintenance of the nervous system (Campos et al., 1985
).
Likewise in vertebrates, the neuronal ELAV-like proteins HuB, HuC, and
HuD have been implicated in promoting the differentiation of neuronal
cells (Wakamatsu and Weston, 1997
). While all four ELAV-like proteins
are important for neuronal differentiation, it is becoming apparent
that their functional properties may be different. These RNA-binding
proteins show a distinct pattern of expression during development, with
HuD and HuR being the first to be expressed in neuronal progenitors,
followed by HuC and HuB (Wakamatsu and Weston, 1997
; Okano and Darnell,
1997
; Clayton et al., 1998
) Likewise, these proteins map to
different neuronal populations in the developing and adult rat CNS and
PNS (Okano and Darnell, 1997
; Clayton et al., 1998
) and
appear to control different mRNAs (Aranda-Abreu et al.,
1999
; Antic et al., 1999
).
Multiple pathways are capable of signaling the expression of
proteins required for neurite outgrowth in PC12 cells (Kaplan and
Stephens, 1994
; Burry, 1998
). Here we found that decreases in HuD
expression by antisense RNA treatment selectively affected the
signaling cascade activated by NGF and phorbol esters while leaving
intact the cellular response to cAMP. Because GAP-43 gene expression is
also dependent on PKC activity but independent of cAMP
(Perrone-Bizzozero et al., 1993
), these results suggest that the effect of HuD on neurite outgrowth may be mediated by its direct
action on GAP-43 expression. While it has been possible to dissociate
GAP-43 expression and neurite outgrowth in specific GAP-43 deficient
PC12 cell clones (Baetge and Hammang, 1991
; Burry and
Perrone-Bizzozero, 1993
) and in cAMP-treated pDuH cells (Figure 6), it
is apparent that neurite outgrowth in the absence of GAP-43 is not
normal. GAP-43 deficient PC12 cells display reduced membrane excitability and altered cell adhesion properties (Gribkoff et al., 1995
; Meiri et al., 1996
). A similar phenotype was
observed in other GAP-43 deficient PC12 clones in the presence of
forskolin (Burry and Perrone-Bizzozero, 1993
). Altogether these results suggest that neurite extension is normally linked to the amount of
GAP-43 in the cells, and this process is controlled by HuD.
Besides GAP-43, HuD is known to bind the 3' UTRs of other mRNAs
expressed in neurons, such as those for c-fos, tau, N-myc, and
p21waf1 (Chung et al., 1997
; Joseph
et al., 1998
; Aranda-Abreu et al., 1999
; Lazarova
et al., 1999
). Therefore, it is likely that the expression
of other genes may be affected by the presence of HuD antisense or
sense transcripts. Notwithstanding, we believe that the observed effect
of HuD on PC12 cell differentiation is mediated primarily by changes in
GAP-43 gene expression for the following reasons. First, GAP-43 is
involved in early events in neurite outgrowth occurring within the
first 48 h after NGF treatment (Yankner et al., 1990
;
Perrone-Bizzozero et al., 1993
; Aigner and Caroni, 1995
), a
period in which we found that HuD was required for cell differentiation
(Dobashi et al., 1998
). As mentioned earlier, HuD's effect
on neurite outgrowth, like GAP-43, was found to depend on PKC activity
but was independent of cAMP (Table 2). In fact, HuD was unable to
induce process outgrowth in a PC12 cell clone that does not express
GAP-43 (Figure 9), suggesting that GAP-43 is required for some of the
effects of HuD on neuronal differentiation. In this regard, it is
noteworthy that, within the first 24 h of culture, HuD induced
GAP-43 levels but did not affect the levels of other proteins
associated with NGF induction or those whose expression is regulated by
ELAV-like proteins, such as the microtubule associate protein
and
neurofilament M (Anderson et al., 2000
).
The results presented here suggest that HuD controls GAP-43 gene
expression by increasing the stability of the mRNA. The effect of HuD
on GAP-43 mRNA stability was demonstrated in cells containing levels of
HuD protein that were either a 3-fold lower (pDuH) or a 3-fold higher
(pcHuD) than untransfected PC12 cells (Table 1). Likewise, other
members of the ELAV family have been shown to control the stability of
cellular mRNAs. Overexpression of HuR, the ubiquitously expressed ELAV
protein, was found to stabilize ARE-containing mRNAs such as those for
c-fos and c-jun (Fan and Steitz, 1998b
; Peng et al., 1998
).
In the case of HuR, mRNA stabilization depended on the
nuclear-cytosolic shuttling of the protein (Fan and Steitz, 1998a
).
Although we cannot exclude similar mechanisms of action for HuD, we
favor the idea that HuD acts mainly by stabilizing GAP-43 mRNA at the
cytoplasmic level. Analysis of the distribution of this protein in
different subcellular fractions demonstrated that HuD is enriched in
polysomes (Kohn et al., 1996
). Similarly, the ELAV-like
proteins Hel-N1 and Hel-N2 were found to localize to polysomes (Gao and
Keene, 1996
), where they control mRNA stability and translation (Antic
et al., 1999
). As shown in Figure 2, the GAP-43 mRNA and
protein were similarly reduced in control and in NGF-induced pDuH
cells, suggesting that HuD's effects on GAP-43 protein may be mediated
by its effect on the levels of its mRNA. Thus, while Hel-N1 (HuB)
participates in the control of both types of posttranscriptional
processes (i.e., mRNA stability and translation), our results suggest
that HuD affects primarily GAP-43 mRNA stability without having any
translational effects.
In conclusion, our results indicate that HuD is essential for
controlling GAP-43 mRNA stability, GAP-43 expression, and PKC-dependent neurite outgrowth in PC12 cells. Based on these observations, we
propose that HuD contributes to the induction of GAP-43 expression and
neurite outgrowth in vivo. HuD is one of the first markers expressed in
neuronal cells, at the onset of process outgrowth (Barami et
al., 1995
; Wakamatsu and Weston, 1997
). Likewise, GAP-43 is
expressed in neurons in association with the initial stages of process
outgrowth (Skene, 1989
; Benowitz and Routtenberg, 1997
; Oestreicher
et al., 1997
). In addition, there is an excellent correlation between the levels of HuD and GAP-43 mRNA in different areas of the CNS and PNS during brain development (Szabo et
al., 1991
; Okano and Darnell, 1997
; Clayton et al.,
1998
) and nerve regeneration (Anderson et al., submitted),
and between the levels of expression of GAP-43 and HuD in PC12 cells
(Table 1). Once HuD is expressed in the cell, additional mechanisms may
control its function. Because HuD is a substrate of PKC (H. M. Furneaux, unpublished observations) and because phorbol esters increase the binding of HuD to the GAP-43 mRNA (Tsai et al., 1997
),
it is likely that PKC controls HuD function in vivo. While we are investigating these issues, it is becoming clear that ELAV-like proteins are important posttranscriptional regulators of nervous system-specific genes in a broad array of species, from invertebrates to humans (King et al., 1994
; Wakamatsu and Weston, 1997
;
Akamatsu et al., 1999
; Antic et al., 1999
;
Kasashima et al., 1999
).
| |
ACKNOWLEDGMENTS |
|---|
We thank Richard Burry for his gift of the PC12-N21 and PC12-N36 clonal lines and Dr. Rachael Neve for providing us with the pcDNA3-myc-tag construct for these studies. We thank Angel Miera, Deirdre Thomas, and Jay Sengupta for their technical assistance. This work was supported by the National Institutes of Health (NS-30255, GM-52576) and by dedicated Health Research Funds of the University of New Mexico School of Medicine to N.P.B..
| |
FOOTNOTES |
|---|
Present address: Lung Cancer Program,
Lovelace Respiratory Research Institute, Albuquerque, NM
87185-5890.
¶ Corresponding author. E-mail: NBizzozero{at}salud.unm.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. Gopalakrishna, U. Gundimeda, J. E. Schiffman, and T. H. McNeill A Direct Redox Regulation of Protein Kinase C Isoenzymes Mediates Oxidant-induced Neuritogenesis in PC12 Cells J. Biol. Chem., May 23, 2008; 283(21): 14430 - 14444. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Fialcowitz-White, B. Y. Brewer, J. D. Ballin, C. D. Willis, E. A. Toth, and G. M. Wilson Specific Protein Domains Mediate Cooperative Assembly of HuR Oligomers on AU-rich mRNA-destabilizing Sequences J. Biol. Chem., July 20, 2007; 282(29): 20948 - 20959. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deschenes-Furry, K. Mousavi, F. Bolognani, R. L. Neve, R. J. Parks, N. I. Perrone-Bizzozero, and B. J. Jasmin The RNA-Binding Protein HuD Binds Acetylcholinesterase mRNA in Neurons and Regulates its Expression after Axotomy J. Neurosci., January 17, 2007; 27(3): 665 - 675. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Burry and C. L. Smith HuD Distribution Changes in Response to Heat Shock but Not Neurotrophic Stimulation J. Histochem. Cytochem., October 1, 2006; 54(10): 1129 - 1138. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fujiwara, Y. Mori, D. L. Chu, Y. Koyama, S. Miyata, H. Tanaka, K. Yachi, T. Kubo, H. Yoshikawa, and M. Tohyama CARM1 Regulates Proliferation of PC12 Cells by Methylating HuD. Mol. Cell. Biol., March 1, 2006; 26(6): 2273 - 2285. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Barreau, L. Paillard, and H. B. Osborne AU-rich elements and associated factors: are there unifying principles? Nucleic Acids Res., January 3, 2006; 33(22): 7138 - 7150. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pascale, M. Amadio, G. Scapagnini, C. Lanni, M. Racchi, A. Provenzani, S. Govoni, D. L. Alkon, and A. Quattrone Neuronal ELAV proteins enhance mRNA stability by a PKC{alpha}-dependent pathway PNAS, August 23, 2005; 102(34): 12065 - 12070. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. De Biase, S. M. Knoblach, S. Di Giovanni, C. Fan, A. Molon, E. P. Hoffman, and A. I. Faden Gene expression profiling of experimental traumatic spinal cord injury as a function of distance from impact site and injury severity Physiol Genomics, August 11, 2005; 22(3): 368 - 381. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deschenes-Furry, G. Belanger, J. Mwanjewe, J. A. Lunde, R. J. Parks, N. Perrone-Bizzozero, and B. J. Jasmin The RNA-binding Protein HuR Binds to Acetylcholinesterase Transcripts and Regulates Their Expression in Differentiating Skeletal Muscle Cells J. Biol. Chem., July 8, 2005; 280(27): 25361 - 25368. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pascale, P. A. Gusev, M. Amadio, T. Dottorini, S. Govoni, D. L. Alkon, and A. Quattrone Increase of the RNA-binding protein HuD and posttranscriptional up-regulation of the GAP-43 gene during spatial memory PNAS, February 3, 2004; 101(5): 1217 - 1222. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Amada, T. Tezuka, A. Mayeda, K. Araki, N. Takei, K. Todokoro, and H. Nawa A Novel Rat Orthologue and Homologue for the Drosophila crooked neck Gene in Neural Stem Cells and Their Immediate Descendants J. Biochem., May 1, 2003; 133(5): 615 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deschenes-Furry, G. Belanger, N. Perrone-Bizzozero, and B. J. Jasmin Post-transcriptional Regulation of Acetylcholinesterase mRNAs in Nerve Growth Factor-treated PC12 Cells by the RNA-binding Protein HuD J. Biol. Chem., February 14, 2003; 278(8): 5710 - 5717. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kasashima, E. Sakashita, K. Saito, and H. Sakamoto Complex formation of the neuron-specific ELAV-like Hu RNA-binding proteins Nucleic Acids Res., October 15, 2002; 30(20): 4519 - 4526. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Irwin, S. Chao, L. Goritchenko, A. Horiuchi, P. Greengard, A. C. Nairn, and L. I. Benowitz Nerve growth factor controls GAP-43 mRNA stability via the phosphoprotein ARPP-19 PNAS, September 17, 2002; 99(19): 12427 - 12431. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Beckel-Mitchener, A. Miera, R. Keller, and N. I. Perrone-Bizzozero Poly(A) Tail Length-dependent Stabilization of GAP-43 mRNA by the RNA-binding Protein HuD J. Biol. Chem., July 26, 2002; 277(31): 27996 - 28002. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Quattrone, A. Pascale, X. Nogues, W. Zhao, P. Gusev, A. Pacini, and D. L. Alkon Posttranscriptional regulation of gene expression in learning by the neuronal ELAV-like mRNA-stabilizing proteins PNAS, September 25, 2001; 98(20): 11668 - 11673. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. F. Manohar, M. L. Short, A. Nguyen, N. N. Nguyen, D. Chagnovich, Q. Yang, and S. L. Cohn HuD, a Neuronal-specific RNA-binding Protein, Increases the in Vivo Stability of MYCN RNA J. Biol. Chem., January 11, 2002; 277(3): 1967 - 1973. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||