![]() |
|
|
Vol. 11, Issue 9, 3233-3246, September 2000

*Max Planck Institute for Biophysical Chemistry, Department of
Biochemistry, D-37018 Göttingen, Germany; and
German Cancer Research Center, Division of Cell Biology,
D-69120 Heidelberg, Germany
| |
ABSTRACT |
|---|
|
|
|---|
Targeting of nuclear lamins to the inner nuclear envelope membrane requires a nuclear localization signal and CaaX motif-dependent posttranslational modifications, including isoprenylation and carboxyl methylation. These modifications, although necessary for membrane targeting, are not sufficient to mediate stable association with membranes. We show that two variants of lamin B3 (i.e., B3a and B3b) exist in Xenopus oocytes. They are encoded by two alternatively spliced, developmentally regulated mRNAs. The two lamin variants differ greatly in their membrane association in meiotically matured eggs. The presence of an extra cysteine residue (as a potential palmitoylation site) and a basic cluster in conjunction with the CaaX motif function as secondary targeting signals responsible for the stable membrane association of lamin B3b in Xenopus eggs. Moreover, transfection experiments with Green Fluorescent Protein lamin tail chimeras and with a Green Fluorescent Protein N-Ras chimera show that these secondary motifs are sufficient to target proteins to the inner nuclear membrane and/or the plasma membrane. Implications for the intracellular trafficking of doubly lipidated proteins are discussed.
| |
INTRODUCTION |
|---|
|
|
|---|
Membrane targeting of certain eukaryotic proteins depends on
posttranslational lipidation. A major class of these proteins contains
CaaX motifs at their COOH termini. The CaaX motif is the target of a
series of posttranslational modifications, including isoprenylation,
proteolytic trimming, and carboxyl methylation. In a first step, a
farnesyl or geranylgeranyl lipid is added via a stable thioether
linkage to the CaaX cysteine (Glomset and Farnsworth, 1994
; Zhang and
Casey, 1996
). The substrate specificity for farnesyltransferase versus
geranylgeranyltransferase is determined by the residue in the X
position of the CaaX motif (Casey and Seabra, 1996
). Next, a specific
protease cleaves the aaX residues from the prenylated protein. Finally,
the terminal prenylcysteine is recognized by a prenylcysteine carboxyl
methyltransferase (pcCMT) that methylesterifies the carboxyl group.
Thus, a hydrophobic COOH-terminal region is generated in an otherwise
hydrophilic molecule. Proteins that contain a CaaX motif include the
Ras proteins and many other small G proteins, the heterotrimeric large
G proteins, fungal mating pheromones, and most nuclear lamins (Glomset
and Farnsworth, 1994
; Reuther and Der, 2000
). Prenylated proteins
exert a variety of different functions. For many of these proteins, the
importance of prenylation for their function has been shown (Loewinger
and McKeon, 1988
; Hancock et al., 1989
, 1991a
; Holtz
et al., 1989
; Krohne et al., 1989
; Kitten and
Nigg, 1991
; Nigg et al., 1992
; Hennekes and Nigg, 1994
).
Large G proteins are geranylgeranylated, whereas Ras proteins, the
fungal mating pheromones, and lamins are farnesylated (Moores et
al., 1991
; Zhang and Casey, 1996
). Proteins carrying the same
CaaX-dependent modifications are located in different membrane
compartments, indicating that additional factors must be responsible
for the specific targeting of these proteins. Targeting of lamins to
the inner nuclear membrane depends on isoprenylation and the presence
of a nuclear localization signal (NLS) (Loewinger and McKeon, 1988
;
Holtz et al., 1989
; Krohne et al., 1989
; Kitten
and Nigg, 1991
).
CaaX-dependent isoprenylation has been used to explain the different
fates of vertebrate A- and B-type lamins during cell division. A-type
lamins, which lose their isoprene moiety soon after incorporation into
the lamina, become freely soluble upon mitotic nuclear envelope (NE)
breakdown (Weber et al., 1989
; Beck et al., 1990
;
Kilic et al., 1999
). Somatic B-type lamins, in contrast, are
permanently isoprenylated and, although depolymerized during mitosis,
remain associated with remnants of NE membranes (Gerace and Blobel,
1980
; Stick et al., 1988
; Nigg et al., 1992
;
Hennekes and Nigg, 1994
). However, as shown by studies of amphibian egg maturation, the CaaX-dependent modifications are not sufficient to
mediate the stable membrane association of lamins. Only a small fraction of lamin B3, the major B-type lamin of Xenopus
oocytes and eggs, remains associated with membranes after NE breakdown in the meiotic metaphase. The majority of B3 becomes soluble, although
it retains its isoprene moiety and remains carboxyl methylated (Firmbach-Kraft and Stick, 1993
).
Posttranslational modification and membrane targeting of Ras proteins
has been studied in great detail (Hancock et al., 1989
, 1990
, 1991a
,b
; Jackson et al., 1994
; Willumsen et
al., 1996
; Yokoe and Meyer, 1996
; Choy et al., 1999
).
Prenylated H-Ras and N-Ras undergo a second lipidation that comprises
palmitoylation of cysteine residues within the hypervariable region of
these proteins in the vicinity of the CaaX motif (Hancock et
al., 1989
). Prenylated K-Ras, which is not palmitoylated, contains
a cluster of six basic amino acid residues within the hypervariable
domain (Hancock et al., 1990
). Palmitoylation or a basic
cluster, in combination with the CaaX-dependent modifications, targets
proteins to the plasma membrane (PM). The concept of a two-signal
mechanism for subcellular localization seems to be more general. It
applies also to proteins that are NH2-terminally
myristoylated, many of which also have nearby S-acyl groups or basic
clusters (Resh, 1996
).
The modifications of CaaX proteins follow a general pathway. Whereas
prenyltransferases are soluble (Casey and Seabra, 1996
), the enzymes
that act in the subsequent processing steps, including the prenyl-CaaX
protease, the pcCMT, and the protein palmitoyltransferase, are membrane
bound. The prenyl-CaaX protease and the pcCMT are predicted polytopic
membrane proteins localized in the endoplasmic reticulum (ER) (Choy
et al., 1999
; Magee and Marshall, 1999
). Significantly, the
pcCMT has been shown to be completely excluded from the PM (Dai
et al., 1998
). A detailed study on Ras proteins (Choy
et al., 1999
) has demonstrated that the CaaX motif alone targets proteins to the endomembrane system, where they are
proteolytically processed and methylated. Further trafficking of Ras to
the PM is dependent on either a basic cluster or palmitoylation.
Furthermore, palmitoylated Ras is found in the Golgi and peri-Golgi
vesicles before PM expression (Choy et al., 1999
).
We have determined the expression of two variants of Xenopus
lamin B3 in early development by reverse transcription (RT)-PCR and
have characterized their membrane association in oocytes and eggs. The
two variants are generated by alternative RNA splicing (Döring
and Stick, 1990
). They differ in their last CaaX-containing exon of 12 amino acid residues. Lamin B3b contains both a basic cluster of six
lysine and arginine residues and an additional cysteine residue
directly adjacent to the CaaX motif, whereas lamin B3a contains none of
these motifs in addition to the CaaX tetrapeptide. We show that the two
variants differ greatly in membrane association after meiotic NE
breakdown. Using site-directed mutagenesis, we show that the presence
of an extra cysteine residue, as a potential palmitoylation site, and
the basic cluster, in conjunction with the CaaX motif, are responsible
for the stable membrane association of lamin B3 in Xenopus
eggs. Furthermore, transfection experiments with Green Fluorescent
Protein (GFP) chimera demonstrate that CaaX proteins, carrying either
of the secondary membrane-targeting signals or both signals, can be
targeted to both the PM and the inner NE membrane.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Isolation and Manipulation of Oocytes and Eggs
Xenopus laevis oocyte and embryo techniques were as
described (Firmbach-Kraft and Stick, 1993
, 1995
). Twenty to 30 nl of
the appropriate RNA in water was injected per oocyte. Oocytes were kept
at 18°C.
Plasmid Construction
The coding region of Xenopus lamin B3a (Stick,
1988
) (GenBank accession number X13169), excluding the start methionine codon, was amplified by PCR with the use of a sense primer that contained an XbaI recognition site
(5'CCGTCTAGAAGCCACATCTACCCCCAGC3') and an antisense primer
that contained an SnaBI recognition site (5'CGCTACGTATTACATGATGGAACAGCTGG3') (recognition sites
underlined). Cycling parameters were initial denaturation (3 min,
94°C), followed by 35 cycles (1 min, 94°C; 1 min, 58°C; 2 min,
72°C), and a final polymerization step (10 min, 72°C). The PCR
product was double digested with XbaI-SnaBI and
cloned into XbaI-SnaBI double-digested pCS2+(Flag) vector (Rupp et al., 1994
). The resulting
protein contains at its NH2 terminus the Flag
epitope followed by nine vector-derived amino acid residues
(MDYKDDDDKNSRPLEPLE) (Flag tag underlined). Flag-B3b was
generated by replacing the NheI-NotI fragment of
pCS2+Flag-B3a with the corresponding fragment of pCS2+myc-B3b, which
contains the lamin B3b-specific COOH-terminal region (Döring and
Stick, 1990
).
Mutants of lamin B3 were generated by site-directed mutagenesis with the use of the QuickChange mutagenesis kit (Stratagene, La Jolla, CA) with pairs of complementary mutagenic primers. The following primers were used (sense primers only are listed): B3aCC, 5'CCAAT-CAGTGGACCCCTGCTGTTCCATCATGTAATGG3'; B3b3Q, 5'GTT-CCGTTCCCAGACACAACAACAAAAAAAGAAATGTTGTTCAG3'; B3b6Q, 5'CCAGACACAACAACAACAACAGCAATGTTGTTCA-G3'; B3bSC, 5'GAAGAAAAAAGAAAAGTTGTTCAGTTTCATAA-TGG3'; B3bCS, 5'GAAGAAAAAAGAAATGTTCTTCAGTTTCAT-AATGG3'; B3aCSIL, 5'GCTGTTCCATCCTGTAATACG3'; and B3aCAIL, 5'CCAGCTGTGCCATCCTGTAATACG3'. For generation of the B3aCAIL mutant, plasmid pCS2+B3aCSIL was used as a template.
GFP-lamin B3 tail chimeras were generated by amplifying amino acid
residues 388-583 of lamin B3a and B3b with a sense primer that
contained an EcoRI recognition site
(5'GAGGGAATTCCTGTCACCAAGCCCTTC3') and antisense primers
with the KpnI recognition site 5'
GTCTGGTACCACGTATTACATGATGGAACAGC3' for B3a or
5'CTCACGGTACCTCTAGACCATTATGAAACTGAAC3' for B3b. The PCR
products were double digested with EcoRI-KpnI
and cloned into the EcoRI-KpnI sites of the
eukaryotic expression vector peGFP-C2 (Clontech, Palo Alto, CA) (GFP-B3
constructs). The NLS of lamin B3, KKRKL (amino acid residues 413-417)
(Stick, 1988
), was inactivated by changing it to TKIKL with a mutagenic
primer pair (sense primer, 5'GCCTTTTACGTGGGACAAAGATAAAGTTAGACGAAACTGG3') (GFP-B3
NLS constructs).
To generate the GFP-N-Ras chimera, the coding region of eGFP,
excluding the start methionine codon, was amplified by PCR with the use
of plasmid peGFP-C1 (Clontech) as a template, with a sense primer
containing an EcoRI recognition site
(5'CGGAATTCCGTGAGCAAGGGCGAGGAGC3') and an antisense primer
containing an XbaI recognition site
(5'GCTCTAGATCCGGTGGATCC3'). The fragment was double
digested with EcoRI-XbaI and cloned into the
EcoRI-XbaI sites of pCS2+NLS+MT
(pCS2+NLS+MT-GFP). This vector contains the SV40 large T antigen NLS
followed by six copies of the myc (MT) epitope (Rupp et al.,
1994
). Two complementary oligonucleotides (sense,
5'CTAGACAGGGTTGTATGGGATTGCCATGTGTGGTGATGTAA3'; antisense, 5'TTACATCACCACACATGGCAATCCCATACAACCCTGT3') encoding the last 11 codons
of human N-Ras were annealed, phosphorylated, purified with the use of
a nucleotide removal kit (Qiagen, Hilden, Germany), and cloned
into the XbaI-SnaBI sites of pCS2+NLS+MT-GFP
(pCS2+NLS+MT-GFP-N-Ras).
RNA Techniques
For RNA synthesis, plasmid templates were linearized with NotI. Capped RNAs were synthesized with a MessageMachine kit (Ambion, Austin, TX). RNAs were purified with the use of spin columns (Qiagen) and quantitated by reading the absorbance at 260 nm.
RNA from oocytes and embryos (10 per extraction) was extracted as
described (Stick, 1988
). RNAs were treated with 200 U/ml DNase I for 30 min at 37°C and purified with the use of spin columns.
First-strand synthesis (20 µl) for RT-PCR was done with 2 µg of total RNA with a SuperScript preamplification system (GIBCO-BRL, Gaithersburg, MD) and oligo(dT) primers according to the manufacturer's instructions, including RNase H treatment and heat inactivation at the end of the reaction. PCR amplification (20 µl) was carried out with one-third of the first-strand reaction with 10 pmol of each oligonucleotide primer, 0.5 U of AmpliTaq-Gold polymerase, and the corresponding buffer (Perkin Elmer-Cetus, Norwalk, CT) in the presence of 1.25 mM MgCl2. Cycling parameters were initial denaturation (10 min, 95°C), followed by 30 cycles (30 s, 95°C; 30 s, 55°C; 30 s, 68°C), and a final polymerization step (10 min, 68°C). Reaction products were separated on 1.5% agarose gels and stained with ethidium bromide. The following primers were used: sense primer lamin B3, 5'GGGCTGCTGGTGCTGGTGCTG3'; antisense primer B3a, 5'AATTACATGATGGAACAGC3'; antisense primer B3b, 5'AGCCATTATGAAACTGAAC3'; sense primer lamin B1 (GenBank accession number X06344), 5'CCCGTATTCACATGATGGCGC3'; antisense primer B1, 5'GGCCACACTGAAGAATTCTCAGGG3'; sense primer lamin B2 (GenBank accession number X54099), 5'CATGACAGAGCAGCCTCTGG3'; and antisense primer B2, 5'GAGTTCCTGGGGTACAGGCAGC3'.
Preparation of Egg Homogenates
Xenopus eggs were washed several times in
homogenization buffer (10 mM HEPES-KOH, 100 mM KCl, 1 mM
MgCl2, 50 mM sucrose, pH 7.7) (Matthews and
Colman, 1991
). Eggs were packed by centrifugation at 100 rpm at 4°C
for 60 s in a bench-top centrifuge, buffer was removed, and the
eggs were crushed by centrifugation at 14,000 × g for
8 min at 4°C. The layer between the yolk pellet and the lipid cap was
gathered and used immediately for fractionation or floating gradient
centrifugation or was shock frozen in liquid nitrogen and stored at
70°C.
Fractionation of Egg Extract
Twenty microliters of egg homogenate was diluted with 100 µl
of egg buffer (10 mM HEPES-KOH, 50 mM KCl, 20 mM
-glycerophosphate, 2 mM MgCl2, 1 mM DTT, 1 mM EGTA, 1 mM ATP, pH
7.5). Samples were centrifuged in a TL100.3 rotor (Beckmann, Fullerton,
CA) at 200,000 × g for 45 min at 4°C. The resulting
supernatants (S1) were removed. The pellets were carefully washed with
100 µl of egg buffer and centrifuged for 15 min (see above), and the
resulting supernatants were discarded. The pellets were resuspended in
100 µl of egg buffer containing 4 M urea, incubated on ice for 10 min, and centrifuged for 45 min as described above. Supernatants (S2)
were removed, and the pellets were resuspended directly in 100 µl of
egg buffer containing 1% NP40, incubated, and centrifuged as described
above, giving rise to supernatants (S3) and pellets (P3). The
supernatants were concentrated by precipitation with
methanol/CHCl3/H2O (Wessel and Flügge, 1984
). The pellets and the precipitates of the
supernatants were dissolved in SDS-PAGE sample buffer and boiled for 4 min.
Floating Gradient Analysis
Egg homogenates were mixed with 1 volume of egg buffer. Up to 50 µl of the diluted homogenate was made 1.3% sucrose with a 2.3 M sucrose stock in egg buffer. This homogenate was overlaid with 300 µl each of 1.1 M, 0.9 M, and 0.7 M sucrose in egg buffer in a 2.2-ml polyallomer tube (Beckman). Gradients were centrifuged in a TLS-55 rotor (Beckman) at 200,000 × g for 2 h at 4°C. Fractions of 75 µl were taken from the top. Twenty microliters of each fraction was mixed with 2× SDS-PAGE sample buffer and boiled for 4 min.
In Vitro Translation and Immunoprecipitation
Lamins were translated in vitro in a rabbit reticulocyte coupled
transcription/translation system with the use of SP6 RNA polymerase
(Promega, Madison, WI). To achieve sufficient geranylgeranyl incorporation, the reticulocyte lysate was supplemented (after 2 h
of incubation at 30°C) with 1 volume of freshly prepared undiluted egg homogenate supplemented with 8 mM phosphocreatine, 1 mM spermidine, 50 µg/ml cytochalasin B, and 1 µg/ml aprotinin (Matthews and
Colman, 1991
). For radiolabeling, 10 µCi of
[3H]mevalonolactone (20-40 Ci/mmol; New
England Nuclear, Köln, Germany) or
[3H]geranylgeranylpyrophosphate (10-30
Ci/mmol; New England Nuclear) was used per reaction. The radioactive
reagents were dried by vacuum centrifugation and dissolved in egg
extract before addition to the reticulocyte lysate. The mixture was
incubated for 1 h at 25°C.
Immunoprecipitation was as described (Stick, 1988
) with anti-Flag mAb
M2 (Kodak, Rochester, NY) with the use of GammaBind Sepharose
(Pharmacia, Freiburg, Germany) and wash buffer (20 mM HEPES-KOH,
150 mM NaCl, 5 mM EDTA, 1% NP-40, 50 mM sucrose, pH 7.2, and protease
inhibitor tablets; Roche, Mannheim, Germany).
Electrophoresis and Immunoblotting
Isoelectric focusing (IEF), SDS-PAGE, and
immunoblotting were done as described (Huttenlauch
et al., 1998
). Immobilized pH gradient buffer 3-10 NL
(0.4%; Pharmacia) was used for IEF gels. In some experiments,
Immobilon polyvinylidene difluoride membranes (Millipore, Bedford, MA)
were used instead of nitrocellulose.
Tissue Culture and Cell Lines
HeLa and MCF7 (HTB-22; American Type Culture Collection, Rockville, MD) cells were maintained in 5% CO2 at 37°C in Dulbecco's modified MEM containing 10% FCS. For transfections, cells were grown on coverslips in 3.5-cm dishes. Cells were transfected with 0.5-1 µg of DNA per dish with the use of FuGene 6 (Roche) according to the manufacturer's instructions.
Cells were fixed in 4% formaldehyde in PBS for 20 min, followed by 4% formaldehyde, 0.5% Triton in PBS for 10 min, counterstained with 0.1 µg/ml 4',6'-diamidino-2-phenyl-indol-dihydrochloride (Roche) for 2 min, washed with PBS, mounted in Elvanol (Hoechst, Frankfurt, Germany), and viewed with a LSM 510 confocal laser scanning microscope (Zeiss, Obarkochen, Germany).
Software Applications
X-ray films were scanned with a Duoscan T2500 (Agfa, Köln, Germany). Digital images (laser scan images and scans of x-ray films) were processed with LSM software (Zeiss), Photoshop 4.0 (Adobe, Mountain View, CA), and FreeHand 8.0 (Macromedia, San Francisco, CA).
| |
RESULTS |
|---|
|
|
|---|
Expression of Two Variants of Lamin B3 in Oocytes and Embryos of Xenopus
Lamin B3 is the major lamin of amphibian oocytes (Stick and
Krohne, 1982
). It serves as a maternal lamin pool for the formation of
the cleavage nuclei up to the mid blastula. After mid blastula, B3 is
gradually replaced by the newly synthesized lamins B1 and B2, and in
later development it represents only a minor lamin (Benavente et
al., 1985
; Stick and Hausen, 1985
). The Xenopus lamin
B3 gene encodes two CaaX-carrying exons that give rise to two mRNAs via
alternative splicing (Figure 1). These
mRNAs code for two B3 proteins, named lamin B3a and B3b, that differ
only in their 12 COOH-terminal residues (Table
1) (Döring and Stick, 1990
). Both
B3 mRNAs are present in oocytes, but mRNA B3a is the predominant
species, as revealed by RNase protection assay (Döring and Stick,
1990
).
|
|
We used RT-PCR to monitor the presence of the two mRNAs in early
development. A scheme of the relevant part of the lamin B3 gene and the
two alternatively spliced RNAs, with the positions of the three primers
used in the RT-PCR, is shown in Figure 1A. PCR with a 5' primer common
to both B3 mRNAs, in combination with a B3b-specific 3' primer, gives
rise to a single amplicon of the expected size of 275 base pairs. The
level of B3b mRNA is constant in oocytes and early embryos but shows a
significant increase in tadpole stages (Figure 1B, 3b, lane 5). The
level of lamin B3a mRNA is more variable in early development. In
tadpole stages, B3a mRNA is hardly detectable (Figure 1B, 3a, lane 5).
The slower-migrating band in Figure 1B (B3a, lane 5) represents an
amplification product of lamin B3b mRNA with the B3a-specific primer
(Figure 1A). Under our amplification conditions, this band is detected
only when mRNA B3b is present at sufficiently high concentrations. The
levels of mRNAs encoding lamin B1 and B2 were also analyzed and
appeared constant throughout development (Figure 1B, 1 and B2). The
identities of the individual amplicons shown in Figure 1 were verified
by subcloning and sequencing. In summary, mRNA B3a is the predominant lamin B3 mRNA in oocytes (Döring and Stick, 1990
). Both B3 mRNA variants can be detected in early development. In tadpoles, mRNA B3b is
up-regulated, whereas mRNA B3a is no longer detectable.
None of the lamin B3-specific antibodies available at present allows
discrimination between the two B3 variants. However, two-dimensional
gel electrophoresis can separate the two variants, because lamin B3b is
more basic than lamin B3a as a result of the presence of a basic
cluster within the B3b-specific exon (Table 1). Therefore, we separated
total oocyte nuclear proteins by two-dimensional gel electrophoresis
and detected lamin B3 polypeptides with a B3-specific mAb. A nonlinear
pH gradient was chosen in the first dimension to optimize resolution
between pH 5.0 and 6.0. Several major lamin B3 spots with isoelectric
points between pH 5.55 and 5.65 as well as a minor spot with a
significantly more basic isoelectric point of 5.75 were detected
[Figure 2, 3 (GV)]. Although the
amount of protein of the minor spot was clearly detectable by
immunological methods, it was too low to allow direct identification of
this spot as either lamin B3a or B3b by protein analytical methods. To
allow an assignment of the spots, we generated lamin B3a and B3b
constructs that carried a Flag epitope at their
NH2 termini. Synthetic RNA encoding either of
these epitope-tagged lamins was injected into the cytoplasm of oocytes.
Oocytes were incubated for 12 h to allow synthesis and targeting
of lamin polypeptides. Both epitope-tagged lamin variants were
efficiently accumulated in the nucleus and incorporated into the NE
lamina, as judged by gel electrophoretic separation and
immunoblotting of isolated cytoplasm, nuclei, and
nuclei fractionated into nuclear content and NE. Their spatial
distribution within the NE was indistinguishable from that of the
endogenous lamin B3, as revealed by immunofluorescence microscopy of
isolated NEs.
|
Total nuclear proteins of injected oocytes were separated by
two-dimensional gel electrophoresis, and the epitope-tagged lamins were
detected with mAb M2, which is specific for the Flag epitope. The
resulting pattern was compared with that of endogenous lamin B3 (Figure
2A). Because lamins are phosphorylated during interphase, they give
rise to multiple spots in the IEF dimension depending on the degree of
phosphorylation (Gerace and Blobel, 1980
; Ottaviano and Gerace, 1985
).
The pattern of isoelectric variants of Flag-B3a polypeptides (Figure
2B) is remarkably similar to that of the major spots of the endogenous
lamin B3 (Stick and Hausen, 1985
; Stick, 1987
). In contrast to the
endogenous lamin, a spot at a more basic pH was never observed, even
after overexposure of the blots. However, the Flag-B3a spots are
shifted by ~0.1 pH unit. This shift is due to the presence of the
Flag epitope that introduces net negative charge (for sequence, see
MATERIALS AND METHODS). Our observation indicates that the major spots
of the endogenous lamin B3 represent isoelectric variants of lamin B3a.
Flag-B3b shows several major spots in the range between pH 5.6 and 5.85 (Figure 2C). The most acidic of these spots corresponds to the minor basic spot of the endogenous lamin B3, if the pH shift caused by the Flag epitope is taken into account (Figure 2, A and C). This indicates that the minor basic spot of endogenous lamin B3 represents lamin B3b. The presence of additional, more basic spots of Flag-B3b (Figure 2C) might be due to inefficient phosphorylation of the relatively high amounts of Flag-B3b introduced by RNA injection. Moreover, the rather broad separation of these isoelectric variants is due to the nonlinearity of the pH gradient, which is very shallow between pH 5.7 and 5.8.
In conclusion, both splice variants of lamin B3 are expressed at the
protein level in oocytes. Lamin B3a is the quantitative major B3 lamin,
whereas B3b is a minor component. This correlates well with the
relative abundance of the mRNAs encoding the two variants (Döring
and Stick, 1990
).
Lamin B3a and B3b Differ in Their Affinity to Membranes
Lamin B3a and B3b differ in their last exon (Döring and
Stick, 1990
), which contains the CaaX tetrapeptide (Table 1). The CaaX
motif is necessary for membrane association. It has been shown that, in
addition to the CaaX-dependent modifications, either a basic cluster or
palmitoylation of additional cysteine residue(s) is required to
localize Ras to the PM (Hancock et al., 1990
; Dudler and
Gelb, 1996
). The lamin B3b-specific exon contains both a basic cluster
and an additional cysteine residue adjacent to the CaaX motif (Table
1). Therefore, it was analyzed to determine whether the two lamin
splice variants differ in their membrane association. Flag-tagged
versions of either splice variant were expressed in oocytes by
injection of synthetic RNA. Injected oocytes were matured to eggs by
incubation with progesterone, and extracts, containing membranes as
well as soluble proteins, were prepared. The extracts were fractionated
by high-speed centrifugation into a supernatant containing soluble
proteins and a pellet containing membrane vesicles and large protein
complexes. The pellet was extracted with 4 M urea and, after another
round of centrifugation, with 1% NP-40. In this way, three supernatant
fractions and a final pellet fraction were obtained (see MATERIALS AND
METHODS). The fractions were probed for epitope-tagged lamin variants
by immunoblotting after SDS-PAGE. The majority of lamin
Flag-B3a was found in the first supernatant fraction of soluble
proteins (Figure 3, lane 1). Only a minor
amount of Flag-B3a was found in the pellet. This was completely soluble
in 4 M urea, as shown after the second centrifugation (Figure 3, lane
2). Consequently, Flag-B3a was not found in fractions obtained after
further treatment with NP-40 (Figure 3, lanes 3 and 4). This indicates
that lamin Flag-B3a is soluble in eggs and that only a small fraction
is either loosely attached to membranes or exists in large urea-soluble
protein complexes. The fractionation behavior of lamin Flag-B3b was
significantly different. Only a relatively small fraction of Flag-B3b
was soluble (Figure 3, lane 5). A comparable fraction to that of
Flag-B3a was extracted with 4 M urea (Figure 3, compare lanes 2 and 6),
but the majority of Flag-B3b could be sedimented after urea treatment.
Flag-B3b in this fraction was completely solubilized after treatment
with NP-40 (Figure 3, lanes 7 and 8), indicating that in the egg, the majority of lamin Flag-B3b might be membrane bound.
|
Sedimentation analysis could not unequivocally discriminate between
sedimentation attributable to membrane association and sedimentation
caused by association with large protein complexes. Therefore, floating
sucrose gradient centrifugation was used to determine whether lamin
Flag-B3b is associated with membranes. In this procedure, cell extracts
are brought to a high concentration of sucrose and are then overlaid
with buffers of decreasing sucrose concentrations. Upon centrifugation,
lipid vesicles and proteins bound to these vesicles float according to
their buoyant density, whereas soluble proteins remain at the bottom
(Wilson and Newport, 1988
; Meier and Georgatos, 1994
). In this way, a
small amount of membrane-bound protein can readily be separated from
the soluble fraction even if the latter is in large excess. First,
total extracts of eggs were analyzed that had been matured from
uninjected oocytes. Aliquots of the gradient fractions were separated
by SDS-PAGE, and lamin B3 was detected by
immunoblotting with a lamin B3-specific mAb (Figure
4A). The vast majority of lamin B3
remained at the bottom of the gradient within the loading zone. Only a
small portion of B3 floated to lower sucrose concentrations, indicating
that only a minor fraction of the endogenous lamin B3 was stably
associated with membranes in eggs. This is in agreement with previous
findings (Firmbach-Kraft and Stick, 1993
; Lourim and Krohne, 1993
).
|
A Basic Cluster and an Extra Cysteine Mediate Membrane Association of Lamin B3b
Next, lamin Flag-B3a and Flag-B3b as well as several mutants of
the two variants were analyzed. Mutants were generated by site-directed
mutagenesis. Selection of the mutated residues was guided by results
obtained with Ras proteins (Hancock et al., 1990
). We
focused our attention on the extra cysteine residue as a potential
palmitoylation site and on the basic cluster. The sequences of the last
exon of wild-type and mutant lamin B3 variants are listed in Table 1.
Lamin Flag-B3a remained exclusively soluble as determined by floating gradient analysis (Figure 4B). In contrast, Flag-B3b was predominantly membrane associated. Only a minor fraction of Flag-B3b remained within the loading zone (Figure 4C). Flag-B3b was also analyzed by gradient centrifugation in the presence of nonionic detergent. Under these conditions, membranes are dissolved. Flag-B3b remained completely within the loading zone, demonstrating that flotation was dependent on the presence of lipid membranes.
Next, we studied the contribution to membrane association of the extra cysteine residue on the one hand and the basic cluster on the other. Introduction of a single extra cysteine residue into lamin Flag-B3a (at the position where a cysteine is found in lamin B3b) (Flag-B3aCC) resulted in membrane binding. Flag-B3aCC was nearly completely (~80-90%) membrane associated (Figure 4D). Replacement of the extra cysteine with a serine residue in Flag-B3b (Flag-B3bSC) drastically reduced membrane association (Figure 4G). The influence of the basic cluster was much less dramatic. Replacement of the first three basic residues by glutamine residues (Flag-B3b3Q) had no significant effect on membrane association (Figure 4E), whereas replacement of the entire basic cluster by glutamine residues (Flag-B3b6Q) led to a moderate decrease of membrane association (Figure 4F).
The effect of palmitoylation or a basic cluster on membrane association
strictly depends on the CaaX-dependent modifications (Hancock et
al., 1989
, 1990
; Dudler and Gelb, 1996
). As a control, the CaaX
cysteine residue of Flag-B3b was replaced with a serine residue
(Flag-B3bCS) so that this mutant protein could not be isoprenylated. As
expected, Flag-B3bCS was completely soluble in eggs (Figure 4H). This
experiment demonstrates the efficiency with which soluble lamins can be
separated from membrane-associated lamins by floating gradient
centrifugation. Consequently, the presence of even small amounts of
lamin B3 in the flotation zone indicates stable membrane association of
this lamin fraction (Figure 4A). In contrast to the sedimentation
analysis (Figure 3), floating gradient analysis could uncover true
membrane binding.
These results suggest that B3a and B3b constitute the soluble and membrane-associated fractions, respectively, of lamin B3 in eggs. Furthermore, they show that an extra cysteine residue adjacent to the CaaX motif is crucial for association with inner NE-derived membranes, suggesting that palmitoylation plays an important role in lamin B3 membrane association in oocytes and eggs.
The two Flag lamin variants were also expressed in enucleated oocytes by RNA injection, and their membrane partition was analyzed by flotation gradient centrifugation. Neither Flag-B3a nor Flag-B3b associated with endomembranes. This could be explained in one of two ways. Either palmitoylation of lamin B3b occurs after translocation into the nucleus, or the palmitoylated lamin is prevented from binding to cytoplasmic membranes by interaction with unknown escort protein(s).
Geranylgeranylation Does Not Alter the Membrane Association of Lamin B3a in Eggs
CaaX-containing proteins can be either farnesylated or
geranylgeranylated. The type of isoprene residue is determined by the COOH-terminal residue of the CaaX motif (Reiss et al., 1991
;
Schafer and Rine, 1992
). Ras proteins and all nuclear lamins are
farnesylated. Mutational analysis has shown that geranylgeranylated Ras
proteins show a significantly higher affinity with membranes than the
farnesylated wild-type proteins (Hancock et al.,
1991b
). Therefore, the CaaX motif CSIM of lamin Flag-B3a was
changed to CAIL, the CaaX motif of a brain G protein
-subunit that
is geranylgeranylated (Flag-B3aCAIL) (Hancock et al.,
1991b
). The specificity of the Flag-B3aCAIL modification was
demonstrated in an in vitro translation system. The rabbit reticulocyte
translation system was supplemented with Xenopus egg extract
to reach sufficient incorporation of radiolabeled geranylgeranyl
moieties. Both polypeptides were efficiently translated in vitro as
detected by immunoblotting with an anti-Flag mAb
(Figure 5A, lanes 1 and 2), and both were
isoprenylated in the presence of [3H]mevalonic
acid, a precursor of isoprene synthesis (Figure 5A, lanes 5 and 6). Two
closely spaced bands were detected in the immunoblot of the
Flag-B3aCAIL mutant (Figure 5A, lane 2). Comparison of the
immunoblot and the autoradiogram showed that the
faster-migrating band of Flag-B3aCAIL was isoprenylated (Figure 5A,
compare lanes 2 and 6), whereas the slower-migrating band represented
the unmodified form. Only Flag-B3aCAIL was efficiently
geranylgeranylated (Figure 5A, lane 4), whereas the wild-type protein
was a very poor substrate for the geranylgeranyltransferase (Figure 5A,
lane 3).
|
After having established that lamin Flag-B3aCAIL is specifically geranylgeranylated, the membrane affinity of this construct was tested in the oocyte/egg system with the floating gradient method. As in the vitro translation system, modified and unmodified Flag-B3aCAIL was detected in egg extracts by immunoblotting. Significantly, both the geranylgeranylated and the unprocessed forms remained completely within the loading zone of the gradient, indicating that geranylgeranylation is not sufficient for stable binding of lamin B3a to NE-derived membranes (Figure 5B).
Association of Proteins with the PM and the Inner NE Is Mediated by the Same Targeting Motifs
The sequence motifs that target Ras proteins to and mediate stable
association with the PM are remarkably similar to those that mediate
stable association of lamin B3b with the inner nuclear membrane in
Xenopus eggs. Targeting of lamins to the nucleus is mediated
by a NLS that is present in the lamin tail domain. The membrane-targeting signals, therefore, might direct a protein to either
the PM or the inner nuclear membrane depending on whether they act in
the absence or presence of a NLS. This hypothesis was tested by
transiently expressing chimeric GFP-lamin constructs in human tissue
culture cells. These constructs contained the tail domain of wild-type
or mutant lamin B3 variants fused to the COOH terminus of GFP. Two
types of constructs were analyzed. One type contained the functional
NLS of the lamin tail domain (Figure 6,
A-F). In the other type, the NLS was inactivated by site-directed
mutagenesis (Figure 6, G-L) (see MATERIALS AND METHODS). The
constructs were expressed in either HeLa or MCF7 cells by transfection.
The subcellular distribution of GFP fluorescence was analyzed by
confocal laser scan microscopy of formaldehyde-fixed cells. Identical
results were obtained with both cell lines. Cells were observed 24 and
48 h after transfection. No differences in the subcellular
distribution were noted at the two time points. Cells transfected with
GFP alone showed diffuse staining throughout the entire cytoplasm and
nucleoplasm, with no preferential staining of membranes.
|
GFP-B3 chimeras that contained an intact NLS gave rise to three
different staining patterns. Three constructs, GFP-B3awt, GFP-B3aCC,
and GFP-B3bCS, were exclusively nucleoplasmic. They showed no
association with the NE (Figure 6, A, B, and F). GFP-B3b6Q and
GFP-B3bSC were also nuclear, but they showed both nucleoplasmic and
nuclear rim staining (Figure 6, D and E). GFP-B3bwt was associated exclusively with the NE and the PM. Intranuclear expression was confined to small dots and to narrow lines that were in contact with
the NE (Figure 6C, arrows). These structures probably represent canaliculi that transverse the nucleus and cytoplasmic invaginations that are lined by NE membranes and that, consequently, are decorated by
the GFP chimeras (Fricker et al., 1997
; Broers et
al., 1999
).
The GFP-B3 chimeras in which the NLS was inactivated by mutagenesis
gave rise to four different staining patterns. GFP-B3awt
NLS was
associated with endomembranes. It was also found in the nucleoplasm. No
association with the NE or the PM was detected (Figure 6G). The
constructs GFP-B3aCC
NLS and GFP-B3b6Q
NLS, which both contain an
extra cysteine residue, showed identical staining patterns. They are
associated with the PM and with the Golgi apparatus. No intranuclear or
nuclear rim staining was observed (Figure 6, H and J). In contrast,
GFP-B3bwt
NLS and GFP-B3bSC
NLS, which both contain a basic
cluster, showed nuclear rim and PM staining (Figure 6, I and K). A
minor fraction of GFP-B3bSC
NLS was nucleoplasmic (Figure 6K). The
basic cluster that is present in lamin B3b constructs has a dual
function. It acts as a secondary membrane-targeting motif (Figure 6, E
and K) and as a NLS. The latter was especially evident in the case of
GFP-B3bCS
NLS. This construct could not be farnesylated because of
the mutation of the CaaX cysteine. As expected, it was not associated
with membranes. Despite the inactivation of the NLS, GFP-B3bSC
NLS
was efficiently accumulated within the nucleus (Figure 6L). Its
expression pattern was indistinguishable from that of the corresponding
construct that contains a functional NLS within the
NH2-terminal region of the lamin B3 tail (Figure 6, compare F and L). Furthermore, GFP-B3b6Q
NLS, in which the basic
cluster is replaced by six glutamine residues, was exclusively cytoplasmic (Figure 6J).
The transfection experiments described above are in line with and
extend recent observations on endomembrane trafficking of Ras (Choy
et al., 1999
). For Ras, it has been shown that the CaaX motif and a secondary targeting motif are required for PM association. Our results demonstrate that the two-signal model holds also for the
association with the inner nuclear membrane. GFP chimeras that contain
a secondary membrane-targeting motif in conjunction with at least one
NLS showed a dual localization at the inner nuclear membrane and the PM
(Figure 6, C, D, E, I, and K). Notably, GFP-B3bwt, which contains the
NLS of the lamin B3 tail and a basic cluster, shows the strongest NE
staining. Furthermore, nuclear rim staining was observed only with
constructs that contain a NLS. This indicates that nuclear rim staining
is due to expression of GFP chimeras at the inner rather than the outer
nuclear membrane (Figure 6, compare J and K).
To exclude the possibility that other sequences of the lamin tail than
the NLS and the COOH-terminal membrane-targeting motifs might influence
targeting to the inner nuclear membrane, GFP chimeras were generated
containing targeting sequences that were not derived from lamins. One
of these chimeras contained at its NH2 terminus the NLS of the SV40 large T antigen followed by six myc epitopes as
tags and at its COOH terminus the last 11 amino acid residues of human
N-Ras (NLS-MT-GFP-N-Ras; for sequence, see Table 1). The N-Ras sequence
is sufficient to target GFP to the PM (Choy et al., 1999
).
The NLS-MT-GFP-N-Ras construct was enriched at the nuclear envelope and
was also located in the nucleoplasm in transfected cells (Figure
7A). The distribution between the NE and
the nucleoplasm was comparable to that of the GFP lamin chimeras GFP-B3b6Q and GFP-B3bSC (Figure 6, D and E). In cells expressing the
chimera at high levels, the NE showed deep invaginations that were
decorated by the chimeric GFP (Figure 7B). Bright fluorescent dots were
often found in the cytoplasm of transfected cells, probably resulting
from the high expression. Staining of the PM was seen only in rare
cases. As a control, a chimera was expressed that lacked the
N-Ras-specific sequences (NLS-MT-GFP). This protein was efficiently
accumulated in the nucleoplasm. However, it showed no association with
membranes (Figure 7C). In summary, these results confirm the conclusion
that dual lipidation in conjunction with a NLS is sufficient to target
a protein to the inner nuclear membrane.
|
| |
DISCUSSION |
|---|
|
|
|---|
By expressing epitope-tagged lamin B3 variants in
Xenopus oocytes, we show that Xenopus lamin B3b,
one of two B3 proteins that are generated by alternative RNA splicing,
remains stably associated with membranes after meiotic NE breakdown,
whereas lamin B3a becomes freely soluble. From previous work, it is
known that the majority of lamin B3 is soluble in Xenopus
eggs, whereas only a minor fraction remains associated with egg
membranes (Benavente et al., 1985
; Firmbach-Kraft and Stick,
1993
; Lourim and Krohne, 1993
; Lourim et al., 1996
).
Immunoblotting of two-dimensional gels allowed us to
detect both protein variants in oocyte nuclei. The assignment of the
multiple isoelectric variants as either lamin B3a or B3b was
accomplished by expressing epitope-tagged versions of B3a or B3b in
oocytes. The tagged lamins were used as markers.
Immunoblots revealed that variant B3b represents a minor
fraction of lamin B3 in oocytes (Figure 2A). This fits well with the
relative abundance of the mRNAs encoding B3a and B3b (Döring and
Stick, 1990
).
The presence of soluble and membrane-bound lamin B3 in the amphibian
egg cytoplasm, together with earlier observations that soluble lamin B3
retained its CaaX motif-mediated modifications (isoprenylation and
carboxyl methylation) in mature eggs, led us to conclude that these
modifications, although necessary, are not sufficient for stable
association of lamins with NE-derived membranes (Firmbach-Kraft and
Stick, 1993
). The existence of two lamin B3 variants in oocytes that
differ in their membrane-binding properties can explain the earlier
observations at the molecular level.
Our RT-PCR data show that the relative abundance of the mRNAs of the
two variants is developmentally regulated (Figure 1). This is also
reflected at the protein level. Variant B3b is a minor species in
oocytes (this study) but is much more abundant relative to variant B3a
in later stages of development (see Figure 5d in Stick and Hausen,
1985
). The biological relevance of the existence of a soluble and a
membrane-bound pool of the same lamin and the developmental regulation
of the relative proportions of these pools is not clear at present
(Fricker et al., 1997
; Gant and Wilson, 1997
; Lourim and
Krohne, 1998
).
Both lamin variants contain a CaaX motif, and both are isoprenylated.
However, lamin B3b contains, in addition, a basic cluster and a
potential palmitoylation site adjacent to the CaaX motif. It has been
shown that palmitoylation or a basic cluster in conjunction with
CaaX-dependent modifications confer stable association of Ras proteins
with the PM (Hancock et al., 1990
). The concepts of double
lipidation (isoprenylation plus S-acylation) and the two-signal
mechanism (lipidation plus basic cluster) for stable membrane
association also applies to other groups of lipid-modified proteins,
such as those subject to NH2-terminal
myristoylation (Cadwallader et al., 1994
; Resh, 1996
). All
of these proteins localize at the PM or to the Golgi. Our results show
that the same principles also hold for proteins that bind to the inner NE membrane. This became particularly clear from the results obtained with mutant B3 variants. Replacement of the serine residue with cysteine next to the CaaX results in stable association of B3a with NE
membranes in the Xenopus oocyte/egg system (Figure 4). Conversely, changing the palmitoyl cysteine of lamin B3b to a serine
has the opposite effect. It grossly reduces membrane binding, although
binding of B3bSC is not completely abolished. This indicates that lamin
B3b, like H- and N-Ras, is stably associated with membranes via double
lipidation by an isoprene plus a palmitoyl residue. The basic cluster
that is present in lamin B3b adds to membrane binding, although its
contribution is relatively small in the oocyte/egg system. Both the
effect of palmitoylation and the basic cluster depend on the CaaX
modifications, as revealed by a mutant in which the CaaX cysteine had
been replaced by serine.
We were unable to demonstrate directly the presence of a palmitoyl
residue on lamin B3b. This is due to technical reasons. The small
amount of endogenous B3b in oocytes precluded direct chemical
identification of a palmitoylcysteine residue in B3b. In vivo labeling
of B3b with radiolabeled palmitate was also unsuccessful. This is
probably due to the reversible nature of palmitoylation and the fact
that palmitate is rapidly metabolized in cells (Kloc et al.,
1991
; Casey and Buss, 1995
). In contrast to tissue culture cells, in
amphibian oocytes incorporation of newly synthesized lamins into the NE
is a relatively slow process, making radiolabeling with palmitate
extremely inefficient. Nevertheless, the label consistently was three
to five times greater in immunoisolates of
[3H]palmitate-labeled oocytes that had been
injected with RNA encoding lamin B3b than in oocytes injected with B3a RNA.
Geranylgeranyl-modified Ras has been shown to bind more tightly to
membranes than farnesylated Ras (Hancock et al.,
1991b
). Determination of the affinities of farnesylated versus
geranylgeranylated model peptides to lipid vesicles shows a higher
affinity of the latter (Silvius and l'Heureux, 1994
). Moreover, in
conjunction with a basic cluster, geranylgeranylation is sufficient to
target a protein to the PM in tissue culture cells (Hancock et
al., 1991b
). Geranylgeranylated lamin B3a, like the
farnesylated wild-type protein, became soluble after meiotic NE
breakdown (Figure 5). Obviously, an increase in hydrophobicity alone is
not sufficient for stable association with NE-derived membranes. In
light of the two-signal mechanism proposed for Ras PM binding, it would be interesting to determine whether the introduction of a basic cluster
into B3aCAIL would result in membrane association. Such experiments
have not yet been done.
The transfection experiments carried out with chimeras of GFP and the COOH regions of wild-type and mutant lamin B3b demonstrate that the same signals that confer association with nuclear membranes in the amphibian oocyte/egg system are sufficient to target a heterologous protein to the inner nuclear membrane in human tissue culture cells. Even more strikingly, several of the chimeras that contain at least one functional NLS showed a dual location at the NE and the PM. Lamins are never found in association with cytoplasmic membranes during interphase. The dual location of the chimeras in the transfected cells is probably due to overexpression. However, it suggests similarities between the PM and the inner nuclear membrane with respect to binding of lipidated proteins.
The basic cluster of lamin B3b exerts a dual function. It acts as a NLS
and as a secondary membrane-targeting signal. Its NLS function is
especially clear in construct GFP-B3bCS
NLS (Figure 6L). This
construct cannot be modified by lipidation and shows no affinity to
membranes. It is accumulated in nuclei with the same efficiency as the
corresponding construct that carries the wild-type lamin NLS. A similar
property was described for the polybasic cluster of K-Ras (Hancock
et al., 1990
).
The CaaX motif alone is sufficient to target a protein to the
endomembrane system, but it is insufficient for PM targeting (Choy
et al., 1999
). Similar to our observations in the amphibian oocyte/egg system, it is also insufficient on its own to confer stable
binding to the NE. This observation is somewhat at variance with
previous findings (Hennekes and Nigg, 1994
) that showed at least week
nuclear rim staining of chimeras of pyruvate kinase and chicken lamin
tails, a phenotype we did not observe with the GFP-B3awt construct
(Figure 6A).
Our results show that both the basic cluster and the palmitoylation site contribute to NE targeting in the transfected cells. Chimeras that lack either of the two signals show nuclear as well as nucleoplasmic staining (Figure 6, D, E, and K), whereas the construct that contains both signals is located exclusively at the NE and the PM (Figure 6C).
Unexpectedly, GFP-B3aCC is not targeted to the NE, whereas the
corresponding chimera lacking the NLS is associated with the Golgi and
the PM (Figure 6, B and H). Although we do not have a straightforward
explanation, it might be that, as observed in other cases (El-Husseini
et al., 2000
), palmitoylation is influenced by amino acid
residues surrounding the palmitoyl cysteine. This would imply that
different palmitoyltransferases are active in the cytoplasm and the
nucleus (see below) and that these enzymes might differ in their
optimal sequence requirements.
The striking similarity between the targeting signals of Ras and
those found in nuclear lamin B3b of Xenopus, together with our finding that these signals can target proteins to both cytoplasmic and nuclear membrane compartments, raises the question of how trafficking to the two destinations occurs. For Ras, a detailed description was given recently (Choy et al., 1999
). Ras
proteins are made in the cytoplasm and are farnesylated by soluble
farnesyltransferase (Casey and Seabra, 1996
). They then bind to the ER
and are aaX proteolyzed and carboxyl methylated. The aaX protease and
the pcCMT are integral membrane proteins of the ER (Magee and Marshall, 1999
). H-Ras and N-Ras then traffic to the PM via the secretory pathway, whereas K-Ras is probably targeted directly to the PM (Yokoe
and Meyer, 1996
; Choy et al., 1999
; Apolloni et
al., 2000
). The association of K-Ras with the PM is assisted by
its basic cluster. S-Acylation of H- and N-Ras occurs in an early
compartment of the exocytotic pathway (Choy et al., 1999
;
Magee and Marshall, 1999
; Apolloni et al., 2000
). Studies
with lipid-modified peptides have shown that efficient S-acylation can
occur directly at the PM (Schroeder et al., 1996
) and that
doubly lipidated peptides are bound to membrane vesicles by kinetic
trapping (Shahinian and Silvius, 1995
). Whether K-Ras exists in a
dynamic equilibrium and can rapidly switch between a PM-bound and a
cytosolic form (Yokoe and Meyer, 1996
) or shows fast lateral diffusion
at the PM (Niv et al., 1999
) is still a matter of debate.
Our results with mutant lamin B3 in the amphibian system indicate that
palmitoylation strongly contributes to binding to the inner nuclear
membrane. Therefore, lamin B3b should be trapped as soon as
palmitoylation has occurred. We know from earlier studies that
farnesylation of lamin B3 occurs in the cytoplasm before its uptake
into the nucleus (Firmbach-Kraft and Stick, 1995
). The intriguing
question remains at which point the transport pathways of doubly
lipidated proteins destined to either the PM or the inner NE will
deviate. Lamin B3b might be palmitoylated after nuclear transport by a palmitoyltransferase located at the inner nuclear membrane.
Alternatively, it might be doubly lipidated at cytoplasmic membranes
and targeted to the inner nuclear membrane with the aid of escort
protein(s) that are able to extract the doubly lipidated lamins from
the cytoplasmic membranes. Injection experiments with enucleated
oocytes showed that neither of the two Flag-B3 variants associated with endomembranes. Molecular characterization of the S-acylation machinery and its precise subcellular localization (Dunphy and Linder, 1998
; Apolloni et al., 2000
; Reuther and Der, 2000
) might help
decide which of these two possibilities is correct.
Whether the same mechanism described here for an amphibian lamin also
holds for other lamins is not clear. B-type lamins of mammals and birds
are associated with mitotic NE-derived membranes (Gerace and Blobel,
1980
; Stick et al., 1988
; Meier and Georgatos, 1994
). The
cDNA sequences of the two avian and several mammalian B-type lamins
indicate that all of these proteins carry a CaaX motif, but none
contains additional membrane-targeting signals such as a basic cluster
or an extra cysteine residue. Stable membrane association of these
lamins during mitosis must be mediated by other factors. Several
integral membrane proteins of the inner nuclear membrane have been
shown to interact with lamins in vitro and in vivo. Whether these act
as bona fide lamin membrane receptors, however, is still a matter of
debate (Gant and Wilson, 1997
; Gotzmann and Foisner, 1999
).
| |
ACKNOWLEDGMENTS |
|---|
We thank T. Pieler, Göttingen, for his generous support. We are grateful to M. Philips, New York, for providing us with GFP-Ras constructs and Katja Köbernik, Göttingen, for the Flag version of the pCS vector. We thank H. Spring, Heidelberg, for help with the laser scan microscopy and T. Ralle, Heidelberg, for his contribution to the cloning of the GFP-N-Ras construct. We thank Caroline Keedy, Göttingen, and D. Olins, Scarborough, for critically reading the manuscript. The initial phase of this work was carried out during our stay at the Institut für Biochemie, Universität Göttingen, and was supported by the Deutsche Forschungsgemeinschaft (SFB 523 A3).
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
r.stick{at}dkfz.de.
| |
ABBREVIATIONS |
|---|
Abbreviations used: GFP, Green Fluorescent Protein; NE, nuclear envelope; NLS, nuclear localization signal; pcCMT, prenylcysteine carboxyl methyltransferase; PM, plasma membrane.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. W. Goldberg, I. Huttenlauch, C. J. Hutchison, and R. Stick Filaments made from A- and B-type lamins differ in structure and organization J. Cell Sci., January 15, 2008; 121(2): 215 - 225. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Celton-Morizur, N. Bordes, V. Fraisier, P. T. Tran, and A. Paoletti C-Terminal Anchoring of mid1p to Membranes Stabilizes Cytokinetic Ring Position in Early Mitosis in Fission Yeast Mol. Cell. Biol., December 15, 2004; 24(24): 10621 - 10635. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Prufert, A. Vogel, and G. Krohne The lamin CxxM motif promotes nuclear membrane growth J. Cell Sci., December 1, 2004; 117(25): 6105 - 6116. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ralle, C. Grund, W. W. Franke, and R. Stick Intranuclear membrane structure formations by CaaX-containing nuclear proteins J. Cell Sci., December 1, 2004; 117(25): 6095 - 6104. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Okeley and M. H. Gelb A Designed Probe for Acidic Phospholipids Reveals the Unique Enriched Anionic Character of the Cytosolic Face of the Mammalian Plasma Membrane J. Biol. Chem., May 21, 2004; 279(21): 21833 - 21840. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Mani, R. Rajagopal, A. B. Garfinkel, X. Fan, and M. F. Wolfner A hydrophilic lamin-binding domain from the Drosophila YA protein can target proteins to the nuclear envelope J. Cell Sci., May 15, 2003; 116(10): 2067 - 2072. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Goldman, Y. Gruenbaum, R. D. Moir, D. K. Shumaker, and T. P. Spann Nuclear lamins: building blocks of nuclear architecture Genes & Dev., March 1, 2002; 16(5): 533 - 547. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||