![]() |
|
|
Vol. 12, Issue 11, 3386-3401, November 2001




*McGill Cancer Center and
Department of Biochemistry,
McGill University, Montreal, Quebec, Canada H3G 1Y6
| |
ABSTRACT |
|---|
|
|
|---|
Ku is a heterodimeric (Ku70/86-kDa) nuclear protein with
known functions in DNA repair, V(D)J recombination, and DNA
replication. Here, the in vivo association of Ku with mammalian origins
of DNA replication was analyzed by studying its association with ors8 and ors12, as assayed by
formaldehyde cross-linking, followed by immunoprecipitation and
quantitative polymerase chain reaction analysis. The association of Ku
with ors8 and ors12 was also analyzed as
a function of the cell cycle. This association was found to be
approximately fivefold higher in cells synchronized at the G1/S border,
in comparison with cells at G0, and it decreased by approximately
twofold upon entry of the cells into S phase, and to near background
levels in cells at G2/M phase. In addition, in vitro DNA replication
experiments were performed with the use of extracts from
Ku80+/+ and Ku80
/
mouse embryonic
fibroblasts. A decrease of ~70% in in vitro DNA replication was
observed when the Ku80
/
extracts were used, compared
with the Ku80+/+ extracts. The results indicate a novel
function for Ku as an origin binding-protein, which acts at the
initiation step of DNA replication and dissociates after origin firing.
| |
INTRODUCTION |
|---|
|
|
|---|
According to the replicon model (Jacob et al.,
1963
) origins are defined by specific DNA sequences (replicators) and
an initiator protein or complex of proteins, that bind to this
sequence (reviewed in Berezney et al., 2000
). Once the
origin is activated, the initiator protein unwinds the DNA duplex,
allowing the entry of the replication machinery and synthesis of the
first primers for chain elongation (reviewed in Ritzi and Knippers,
2000
).
Considerable progress has been made in Saccharomyces
cerevisiae toward our understanding of the regulation of
initiation of DNA replication in relation to the cell cycle (reviewed
by Quintana and Dutta, 1999
). The origin recognition complex (ORC) was
first described in yeast and led to the subsequent identification of ORC homologs in humans, invertebrates (Caenorabditis
elegans), plants (Arabidopsis thaliana), fission yeast,
and flies (Drosophila melanogaster) (Gavin et
al., 1995
; Gossen et al., 1995
). In budding yeast, ORC
is bound to the replication origins (or ARS elements) throughout
the cell cycle (Diffley et al., 1994
; Aparicio et
al., 1997
; Liang and Stillman, 1997
). A prereplication complex
(preRC) assembles during G1 phase of the cell cycle in preparation for initiation of DNA replication at the origin. In S. cerevisiae, this complex consists of ORC proteins, Cdc6p,
and the family of MCM proteins, licensing factors. Afterward,
activation of cell cycle-regulated protein kinases guides the
"licensed" origin into S phase. The preRC gradually dissociates by
releasing Cdc6p and MCM proteins; this postreplication complex persists
until the next G1 phase when another round of replication can occur.
ORC was recently shown to play a critical role in replication
initiation by positioning nucleosomes adjacent to yeast origins of
replication, which influences the preRC assembly (Lipford and Bell,
2001
), reinforcing the hypothesis that chromosomal context can
significantly affect origin function (Newlon et al.,
1993; Friedman et al., 1996).
Chromosomal proteins often interact with DNA to control
maintenance, propagation, and expression of the genome. Identification and isolation of proteins interacting with origins of replication are
essential for understanding the mechanism of initiation of DNA
replication. In S. cerevisiae, the Ku-like protein (OBF2) was shown to be required for the assembly of a stable multiprotein complex at essential sequences within the eukaryotic origin of replication (Shakibai et al., 1996
). Ku is an abundant
heterodimeric nuclear protein, composed of ~70- and ~86-kDa
subunits, originally identified as an autoantigen recognized by sera
from patients with autoimmune diseases (Mimori et al.,
1981
). Furthermore, Ku is the regulatory subunit of the DNA-dependent
serine/threonine protein kinase (DNA-PK) (Carter et al.,
1990
), and acts as the component of DNA-PK that confers binding to DNA
(Dvir et al., 1992
). Ku is present in all eukaryotes,
suggesting conservation of function. This multifunctional protein has
been implicated in many cellular metabolic processes, such as
nonhomologous DNA double-strand break repair, site-specific V(D)J
recombination of immunoglobulins and T-cell receptor genes,
transcriptional regulation, telomeric maintenance, replicative
senescence, cell cycle regulation, and DNA replication (Ruiz et
al., 1999
, and references therein; reviewed in Tuteja et
al., 2000
). Maintenance of the genome's integrity has been
suggested to be accomplished by the Ku80 caretaker gene, through
suppression of chromosomal rearrangements (Difilippantonio et
al., 2000
). Most recently, Pucci et al. (2001)
proposed
a differential DNA-binding activity of Ku in human neoplastic tissues
that might be associated with tumor progression. Ku is not only a
double-stranded DNA end-binding protein but also has sequence-specific
DNA binding (Griffith et al., 1992
; Ruiz et al.,
1999
), ATPase (Ochem et al., 1997
), and helicase activities
(Tuteja et al., 1990
, 1993
, 1994
). The role of Ku in cell
cycle regulation has been largely investigated in the past decade. Both
Ku70 and Ku80 (or Ku86) subunits are coexpressed in human cell lines
throughout the cell cycle. The catalytic subunit of DNA-PK (DNA-PKcs)
is also present in the nucleus in interphase cells, but unlike Ku, none
of DNA-PKcs was localized at the periphery of condensed chromosomes
during mitosis (Koike et al., 1999
). These data along with
knockout data of Ku70, Ku86 and DNA-PKcs (Gao et al.,
1998) suggest that there is an important function of Ku in
growth control, which is separate from the DNA-PK activity. Furthermore, a role for Ku in tumor suppression, has been suggested (Nussenzweig et al., 1997
; Li et al., 1998
),
because Ku70 and Ku80 deficiencies facilitated neoplastic growth.
Evidence involving Ku in DNA replication is accumulating. Ku has
been shown to associate with several origins of replication, such as
the adenovirus type 2 origin (de Vries et al., 1989
), B48
human DNA, lamin B2 region (Toth et al., 1993
), A3/4
sequence present in the minimal origin of the monkey ors8
and ors12 (Ruiz et al., 1999
; our unpublished
results), the Chinese hamster dihydrofolate reductase origin
ori
(Ruiz et al., 1999
), and the human
dnmt1 (DNA-methlytransferase) origin (Araujo et
al., 1999
). Recently, Ku was found to bind to matrix attachment
regions, which are implicated in the loop domain organization of
chromatin (Galande and Kohwi-Shigematsu, 2000
). Matrix attachment
regions have been shown to colocalize with origins of replication
(Largarkova et al., 1998
).
Our laboratory has purified an origin binding activity (OBA)
(Ruiz et al., 1995
) through its ability to interact
specifically with ors8, a mammalian (monkey) origin of
replication. OBA binds specifically to A3/4 (Ruiz et al.,
1999
), a 36-bp mammalian replication origin sequence that is capable of
supporting autonomous replication in vivo and in vitro (our unpublished
results). Furthermore, OBA has helicase activity and associates with
proteins involved in DNA replication (our unpublished results), such as
PCNA, DNA polymerases
and
, topoisomerase II, RF-C, and Oct-1.
Microsequencing analysis of the DNA binding activity of OBA revealed
that it was identical to the 86-kDa subunit of Ku antigen (Ruiz
et al., 1999
). In addition, the affinity-purified OBA
fraction contained the 70-kDa subunit of Ku and DNA-PKcs. Furthermore,
our laboratory has previously isolated origin-enriched sequences,
ors, from early-replicating CV-1 monkey cells (Kaufmann
et al., 1985
; reviewed in Zannis-Hadjopoulos and Price,
1998
,1999
), which are capable of conferring autonomous replication to
plasmids in vivo (Frappier and Zannis-Hadjopoulos, 1987
; Landry and
Zannis-Hadjopoulos, 1991
) and in vitro (Pearson et al.,
1991
). In addition, in vivo mapping of ors12 by competitive PCR demonstrated that it acts as a chromosomal origin of DNA
replication (Pelletier et al., 1999
). Among the
ors, ors8 and ors12 have been characterized in detail. They both contain an internal minimal origin
fragment, 186 bp for ors8 (Todd et al., 1995
) and
215 bp for ors12 (Pelletier et al., 1997
),
AT-rich regions, inverted repeats, bent DNA, the ARS consensus sequence
of yeast, the consensus for scaffold attachment regions of
Drosophila, and various eukaryotic transcriptional
regulatory elements (Rao et al., 1990
). These sequences and
structural features have been associated with origins of replication
(reviewed in Zannis-Hadjopoulos and Price, 1998
, 1999
).
In the present study, we quantitated throughout the cell cycle,
the in vivo binding of Ku to replication origin-containing sequences
(ors8 and ors12), with the use of the
formaldehyde cross-linking technique (Strahl-Bolsinger et
al., 1997
). Immunoprecipitation of Ku-DNA cross-links was
performed with antibodies against the 70- and 86-kDa subunits of Ku
antigen and against the Ku70/86 heterodimer. Conventional, competitive,
and real-time PCR were then performed with the use of the
immunoprecipitated material as template. Ku was found to associate
specifically with ors8 and ors12, because DNA
fragments from these regions were enriched in the immunoprecipitate
compared with other portions of the genome not containing replication
origins. Furthermore, higher binding of Ku to ors8 and
ors12 was found at the G1/S border, in comparison with other
stages of the cell cycle. The data suggest an involvement of Ku in
mammalian DNA replication as an origin-binding protein.
| |
Experimental Procedures |
|---|
|
|
|---|
Cell Culture and Synchronization
CV-1 cells (monolayers) were cultured in minimal essential
medium
(Invitrogen, Carlsbad, CA) supplemented with 10%
fetal bovine serum (Invitrogen) (termed regular medium) at 37°C, as previously described (Mah et al., 1993
). For synchronization
to the G0/G1 phase, 80% confluent CV-1 cells were placed in serum-free medium for 48 h. For synchronization to G1/S, S (Stephens et
al., 1977
), and M (Paulson and Taylor, 1982
) phases, the procedure was modified as follows: 40% confluent CV-1 cells were treated with 2 mM thymidine (Sigma, St. Louis, MO) for 12 h, released for 9 h in regular medium without thymidine, and subsequently incubated for
12 h with 2 mM thymidine and 400 µM mimosine (Sigma). For S
phase synchronization the cells were released, from the thymidine/mimosine block, for 2 h in regular medium. For
synchronization to M phase the cells were released from the
thymidine/mimosine block in regular medium supplemented with 1 µg/ml
nocodazole (Sigma), for 14 h. Cell synchronization was monitored
by flow cytometry. Mouse embryonic fibroblasts (MEFs)
Ku80+/+ and Ku80
/
cells
(kindly provided by Dr. A. Nussenzweig), were cultured in DMEM
(Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen) at
37°C, as described in Nussenzweig et al. (1996)
.
In Vivo Cross-linking
In vivo cross-linking was performed as described in Ritzi
et al. (1998)
with some modifications. In brief, CV-1 cells,
Ku80+/+ and Ku80
/
MEFs,
grown as described above, were washed twice with phosphate-buffered saline to remove all traces of serum and then formaldehyde (1%) in
warm minimal essential medium
without serum was added for 10 min.
Cells were then lysed (at 4°C) in lysis buffer (50 mM HEPES/KOH pH
7.5, 140 mM NaCl, 1% Triton X-100, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, one capsule of protease inhibitors; Roche Molecular Biochemicals) and drawn into and out of a
21-gauge hypodermic needle three times to effect cell lysis and
dispersion of nuclei. Cell lysates were then layered over 4 ml of
12.5% glycerol in lysis buffer and nuclei were pelleted by spinning at
750 × g for 5 min in a benchtop centrifuge. The
nuclear pellet was resuspended in 1 ml of lysis buffer.
Chromatin Fragmentation
Cross-linked or noncross-linked cell nuclei were sonicated 10 times for 30 s each time, and the chromatin size was monitored by
electrophoresis (Hecht and Grunstein, 1999
). This treatment generated
fragments of ~20 kb. To further reduce the chromatin size into
smaller fragments of 1.5 to 3.5 kb, DNA was then digested with
SphI, HindIII, PstI, and
EcoRI restriction endonucleases in NEB2 buffer (100 U of
each; New England Biolabs, Beverly, MA) at 37°C for 6 h.
Immunoprecipitation and DNA Isolation
Sheared chromatin lysed extracts were incubated with 50 µl of protein G-agarose (Roche Molecular Biochemicals), to reduce background caused by nonspecific adsorption of irrelevant cellular proteins/DNA to protein G-agarose beads (as described in the protein G-agarose protocol). These cleared chromatin lysates were incubated, at
4°C for 6 h on a rocker platform, with either 50 µl of
preimmune goat serum (Santa Cruz Biotechnology, Santa Cruz, CA), or 20 µg of anti-Ku70 (M-19) or anti-Ku86 (C-20) goat polyclonal antibodies (Santa Cruz Biotechnology), or anti-Ku70/86 heterodimer (clone162) mouse monoclonal antibody (NeoMarker), or anti-NF-
B p65 (C-20) goat
polyclonal antibody (Santa Cruz Biotechnology) directed against the
transcription factor nuclear factor-
B (NF-
B) p65, or anti-SC35 (Sigma) rabbit monoclonal antibody against the splicing factor SC-35.
Protein G-agarose (50 µl) was then added and the incubation was
continued for 12 h. The precipitates were successively washed two
times for 5 min with 1 ml of each buffer: lysis buffer, WB1 (50 mM
Tris-HCl pH 7.5, 500 mM NaCl, 0.1% Nonidet P-40, 0.05% sodium
deoxycholate), WB2 (as WB1 with no NaCl), and 1 ml of TE (20 mM
Tris-HCl pH 8.0, 1 mm EDTA). The precipitates were finally resuspended
in 200 µl of extraction buffer (1% SDS/TE). Half of the sample was
then incubated at 65°C overnight to reverse the protein/DNA
cross-links, followed by 2-h incubation at 37°C with 100 µg of
proteinase K (Roche Molecular Biochemicals). The other half
(nonreversed cross-link) was incubated at 50°C for 1 h with 100 µg of proteinase K. Finally, the samples were processed for DNA
purification by passing them through QIAquick PCR purification columns
(QIAGEN, Valencia, CA).
Blocking of Anti-Ku Antibodies with Ku70 and Ku86 Blocking Peptides
The anti-Ku70 and anti-Ku86 antibodies were neutralized
with a sevenfold (by weight) excess of the Ku70 (sc-1486 P; Santa Cruz
Biotechnology) or the Ku86 (sc-1484 P; Santa Cruz Biotechnology) blocking peptides, as previously described (Ruiz et al.,
1999
). The incubations were carried out overnight at 4°C, and the
neutralized antibodies were then incubated with extracts of
cross-linked CV-1 cells, as described above.
Western Blotting
Immunoprecipitates were resuspended in electrophoresis sample
buffer (50 mM Tris-HCl pH 6.8, 100 mM dithiothreitol, 2% SDS, 0.1%
bromophenol blue, 10% glycerol) and resolved on 8% SDS-polyacrylamide gels, transferred to Immobilon-P membranes (Millipore, Bedford, MA) and
probed with anti-Ku70, anti-Ku86, anti-NF-
B p65, or anti-SC35 antibodies. Protein-antibody complexes were visualized by enhanced chemiluminescence with the use of the Amersham Pharmacia Biotech ECL
system (Arlington Heights, IL), with the appropriate horseradish peroxidase-labeled conjugated antibodies (Santa Cruz Biotechnology).
PCR Analysis of Immunoprecipitated DNA
Conventional PCR reactions were carried out in 25 µl with 1/200th of the immunoprecipitated material with the use of the Ready-To-Go PCR Beads from Amersham Pharmacia Biotech. The PCR reaction contained 1 µM of each primer (for primers sets AF, AC, DF, BE, and ADA A), which were designed as 20- or 24-mers with ~50% GC content. Sequence for the CV-1 ors8 (accession no. M26221) and mouse genomic adenosine deaminase (ADA; accession no. L20424) amplicon primers used:
|
||||||||||||||||||||||||||||||||||
Genomic CV-1, Ku80+/+, or
Ku80
/
DNA (10 ng), used for the control
reactions, was obtained from total cell lysates of noncross-linked cells. Typically, an initial denaturation for 2 min at 94°C was followed by 30 cycles with denaturation for 30 s at 94°C,
annealing for 30 s at 55 or 50°C, polymerization for 30 s
at 72°C, and a final extension for 5 min at 72°C. PCR products were
separated on 2% agarose gels, visualized with ethidium bromide, and
photographed with an Eagle Eye apparatus (Speed Light/BT
Sciencetech-LT1000).
Competitive PCR Analysis of Immunoprecipitated DNA
The primers, competitors and PCR conditions used are described below.
|
|||||||||||||||||||||||||||||||||||||||
PCR reactions were performed with Ready-To-Go PCR Beads (Amersham
Pharmacia Biotech), and primer concentrations were as for conventional
PCR (see above). The difference lies in the addition of the appropriate
competitor molecules to the reaction mixture. Each competitor was
generated with the use of a third primer, as described by Forster
(1994)
. Ors8 competitor (ors8c) was generated with primers ors8 330 and 8C
(5'TGAGCAGTCATGAAGAAACCTAACTGAGATG). BB' and EE' competitors were
generated as described in Pelletier et al. (1999)
.
Real-time PCR Quantification Analysis of Immunoprecipitated DNA
PCR reactions were carried out in 20 µl with 1/200th of the
immunoprecipitated material with the use of LightCycler capillaries (Roche Molecular Biochemicals) and the LightCycler-FastStart DNA Master
SYBR Green I (Roche Molecular Biochemicals). The PCR reaction contained
3 mM Mg2+ and 1 µM of each primer of the
appropriate primers set used; ors8 150, ors12
JJ', ors12 MM', EE', BRCA, or CD4 intron. Because the
optimal conditions for real-time PCR sometimes requires specific primer
sets that differ from those with the use of conventional PCR, primer
set ors8 150 was used to amplify a 150-bp genomic fragment
of ors8 (Figure 3A). Primer set ors12 JJ' and
ors12 MM' were used to amplify a 360- or a 303-bp
corresponding genomic fragment of ors12 (Figure 3B). Primer
set EE' was used to amplify a 250-bp genomic fragment, which was mapped
~5 kbp downstream of the origin of replication ors12
(Figure 3B). A control set of primers from the African Green Monkey
BRCA2 gene (accession no. Z75666; Bignell, Micklem, Stratton, Ashworth,
and Wooster, unpublished data; Pelletier et al.,
1999
) and the CV-1 CD4 gene (accession no. AB052204; Matsunaga et
al., 2000
) were also used. Primer sets BRCA and CD4 intron amplify
a fragment of 459 and 258 bp, respectively, from genomic CV-1 DNA.
Primers were designed as 20-22 mers with ~50% GC content. Sequence
for the primers used was as follows:
|
||||||||||||||||||||||||||||||||||||||||||||
Genomic CV-1 DNA (9.3, 18.6, 27.9, 37.2, and 55.8 ng), used for the
standard curve reactions (necessary for quantification of the PCR
products) (Figure 5A), was obtained from total cell lysates of
noncross-linked logarithmic 80% confluent cells. The quantification of
the PCR products was assessed by the LightCycler (Roche Molecular
Biochemicals), with the use of SYBR Green I dye as detection format
(Pfitzner et al., 2000
). The quantification program used a
single fluorescence reading at the end of each elongation step.
Arithmetic background subtraction was used and the fluorescence channel
was set to F1. Typically, an initial denaturation for 10 min at 95°C
was followed by 35 cycles with denaturation for 15 s at 95°C,
annealing for 10 s at 45°C (primer set ors8 150) or
50°C (primer sets ors12 JJ', ors12 MM', EE', BRCA, or CD4 intron), and polymerization for 15 s at 72°C. The specificity of the amplified PCR products was assessed by performing a
melting curve analysis cycle with a first segment set at 95°C for
0 s and a temperature transition of 20°C/s, a second segment set
at 45°C or 50°C (depending on the annealing temperature of primer
set used) with a temperature transition rate of 20°C/s, and a third
segment set at 95°C with a temperature transition rate set at
0.2°C/s. PCR products were also separated on 2% agarose gels,
visualized with ethidium bromide, and photographed with an Eagle Eye
apparatus (Speed Light/BT Sciencetech-LT1000) (our unpublished results).
In Vitro Mammalian DNA Replication Assay
Ku80+/+ and
Ku80
/
MEFs nuclear and cytosolic extracts
were prepared as previously described (Pearson et al.,
1991
), from logarithmically growing cell monolayers. The protein
concentrations of the nuclear and cytoplasmic extracts were 3.0 and 3.5 mg/ml, respectively. In vitro replication was performed as previously
described (Matheos et al., 1998
), with slight modifications.
Standard reactions included cytoplasmic (52.5 µg) and nuclear (21.0 µg) extracts from either Ku80+/+ or
Ku80
/
cells, 2 mM ATP, 100 mM each CTP, GTP,
UTP, dATP, and dGTP, 10 µCi each of
[
-32P]dCTP and
[
-32P]dTTP, 2 U of pyruvate kinase, and 200 ng of input p186 plasmid (Todd et al., 1995
). A control
reaction with pBR322, a plasmid lacking a mammalian origin of DNA
replication, was also included to show origin-dependent DNA replication
of the p186 plasmid. The reactions were performed at 30°C for 1 h. The reaction products were purified with the use of the QIAquick PCR
purification kit (QIAGEN). Samples were digested with 0.8 U of
DpnI (New England Biolabs) for 45 min at 37°C in the
presence of 1× NEB 4 buffer and 100 mM NaCl. The samples were
separated on 1% agarose gel in 1× TAE buffer (16-20 h, 50-55 V).
Quantification was performed on DpnI-digested products with the use of a Fuji BAS2000 phosphorimager analyzer. These results were typically corrected for the amount of DNA recovered from the in vitro replication assay by quantitative analysis of the ethidium bromide picture of the gel (not shown). This method of quantification for DNA recovery was also verified by quantifying and correcting for the amount of radionucleotide incorporated in unmethylated pBluescript DNA, included in each reaction (not shown). The amount of radioactive precursor incorporated into the DNA was expressed as a percentage of the wild-type reaction with Ku80+/+ cell extracts.
| |
RESULTS |
|---|
|
|
|---|
Immunoprecipitation of Ku70, Ku86, SC-35, and NF-
B p65 Proteins
from Lysed Cell Extracts
The Ku heterodimer as well as its Ku70- and Ku86-kDa
subunits were separately immunoprecipitated, with anti-clone162,
anti-Ku70, or anti-Ku86 antibodies, respectively, from extracts of
monkey (CV-1) cells that had been previously treated or not with
formaldehyde, to cross-link proteins bound to DNA in vivo. As negative
control, antibodies against the spliceosome-specific protein, SC-35, a nuclear protein that does not bind to DNA (Fu and Maniatis, 1990
), or
the transcription factor NF-
B p65, a nuclear protein that binds DNA
but does not associate with origins of DNA replication (Meyer et
al. 1991
), were used. Western blot analyses showed that CV-1
whole-cell-extracts (CV-1 WCE), prepared from either cross-linked or
noncross-linked cells, contained all three proteins, Ku, SC-35, and
NF-
B p65 proteins (Figure 1, A-E,
lanes 1 and 2). In contrast, when normal goat serum (NGS) was used,
neither Ku, NF-
B p65, nor SC-35 was immunoprecipitated in either the
cross-linked or untreated cells (Figure 1, A-E, lanes 5 and 6).
Furthermore, Western blot analyses with the use of anti-Ku70 and
anti-Ku86 antibodies verified that the immunoprecipitated material from
either the cross-linked or the untreated cells did contain Ku protein
(Figure 1, A-C, lanes 3 and 4). Western blot analyses performed with
anti-SC-35 antibody showed that the material immunoprecipitated from
cross-linked cells contained ~10 times less SC-35 protein than the
untreated ones (Figure 1D, lanes 3 and 4), indicating some nonspecific
precipitation of this protein, whereas similar analyses performed with
the anti-NF-
B p65 antibody showed that the material
immunoprecipitated from either the cross-linked or untreated cells
(Figure 1E, lanes 3 and 4) contained equivalent amount of NF-
B p65
protein. The specificity of the anti-Ku70 and anti-Ku86 antibodies used
was assayed by blocking with the corresponding Ku70 and Ku86 peptides.
Western blot analyses showed that neither the Ku70 nor the Ku86
subunits of Ku protein were immunoprecipitated from cross-linked CV-1
cells, when the Ku antibodies were treated with the respective blocking peptide before immunoprecipitation (Figure 1, A and B, lane 7).
|
Ku70 and Ku86 Association with ors 8 and ors 12 Detected by Formaldehyde Cross-linking
The abundance of ors8- and
ors12-containing genomic sequences bound to Ku protein,
after formaldehyde cross-linking and immunoprecipitation, was measured
by PCR. Four sets of primers, AC, DF, BE, and AF, were used to amplify
four respective regions in ors8 (Figure
2A). When the immunoprecipitated
protein-DNA cross-links were reversed, by incubating at 65°C
overnight, all four regions of ors8 were amplified, giving
the expected 197-, 212-, 320-, and 480-bp products, respectively
(Figure 2B, lanes 1 and 3). In contrast, the immunoprecipitated material from the noncross-linked cells did not result in PCR amplification of any of the four ors8 fragments (Figure 2B,
lanes 2 and 4), indicating first that cross-linking was required before immunoprecipitation with anti-Ku antibodies, and second that the material that was immunoprecipitated with these antibodies from the
noncross-linked cells did not contain detectable amounts of contaminating DNA, with the use of either the same amount of template as from the cross-linked cells, or 10 times more (our unpublished results) for the PCR reaction. The genomic DNA of noncross-linked cells
gave the expected amplification products with the corresponding primer
sets (Figure 2, B and C, lane 5). A similar procedure was used with the
monkey ors12 (Kaufmann et al., 1985
), human
c-myc (Vassilev and Johnson, 1990
) and human
dnmt1 (Araujo et al., 1999
) origins of
replication and specific origin-containing fragments from each locus
were similarly amplified (our unpublished results).
|
PCR Amplification across Ku Binding Site in ors8 Is Blocked If Cross-link Is not Reversed before PCR
When proteinase K was added without reversing the
protein-DNA formaldehyde cross-link, the 480- and 320-bp
ors8 fragments were not amplified, whereas the 197- and
212-bp fragments were (Figure 2C, lanes 1-4). The region containing
the OBA/Ku binding site of ors8 (Ruiz et al.,
1999
), located within the 186-bp minimal ori, was not part
of the amplified fragments when primer sets AC (197-bp product) and DF
(212-bp) were used (Figure 2A). Most likely, as a result of the
cross-linking, an adduct-like structure may have been left within the
Ku binding region that inhibited the amplification of the 480- and
320-bp fragments. Amplification of these fragments containing Ku
binding sites was possible with total genomic DNA from noncross-linked
cells (Figure 2, B and C).
Competitive PCR with DNA Immunoprecipitated with Anti-Ku70, Anti-Ku86, Anti-SC-35, and NGS
To analyze whether the DNA that was immunoprecipitated
with the anti-Ku antibodies after cross-linking with formaldehyde was enriched in origin-containing sequences, and to quantify this association, competitive PCR was performed, with the use of specific primers of ors8 and ors12. This was compared with
DNA obtained by immunoprecipitation with an anti-SC-35 antibody or NGS,
both used as negative controls (see competitive PCR raw data, Figure 4B). Competitive PCR was also used to standardize the differences among
primers and competitors with respect to their amplification efficiencies. CV-1 genomic DNA, obtained from different regions that
are either containing replication origins or not, was used to normalize
the reaction products (Figure 3, A and
B). The linearity of each competitor was verified by plotting the ratio
of competitor DNA product to target DNA product (ordinate) versus the
number of competitor molecules used (abscissa) (Figure
4A). In logarithmically growing CV-1
cells, the immunoprecipitated DNA obtained with either anti-Ku86 or
anti-Ku70 antibodies was enriched in ors8 sequence by
approximately fivefold, in comparison with
anti-SC-35-immunoprecipitated DNA (Figure 4C, ors8c).
Similar results were obtained with ors12 sequence, where DNA
that was immunoprecipitated with either anti-Ku86 or anti-Ku70
antibodies was enriched in origin sequence by approximately six- and
fivefold, respectively, in comparison with
anti-SC-35-immunoprecipitated DNA (Figure 4C, ors12 BB').
When NGS was used, ors8 and ors12 sequences were
amplified by approximately eight- and sixfold less, respectively, than
when DNA was immunoprecipitated with the use of anti-Ku86 and anti-Ku70
(Figure 4C). In contrast, a sequence situated ~5 kb downstream of
ors12 was amplified by primer set EE' by approximately
fourfold less than the sequence amplified by primer set BB', which
contains ors12 when anti-Ku70 or anti-Ku80 antibodies were
used for the immunoprecipitation (Figure 4C, ors12 EE'). In
addition, the DNA abundance in the region amplified by primer set EE',
corresponded to ~3.0 × 104-4.5 × 104 molecules, when the immunoprecipitation was
performed with either Ku antibodies, anti-SC-35 antibody, or NGS
(Figure 4C, ors12 EE').
|
|
Real-time PCR with DNA Immunoprecipitated with Anti-Clone162,
anti-NF-
B p65, and NGS
The association of Ku heterodimer (immunoprecipitated with
anti-clone162 antibody), NF-
B p65, and NGS with origin-containing sequences ors8 and ors12 and nonorigin-containing
sequences EE', BRCA, and CD4 intron was assayed by the real-time PCR
quantification method with the use of the LightCycler (Roche Molecular
Biochemicals). Genomic CV-1 DNA was used to build the standard curves
necessary for the quantification of the immunoprecipitated DNA in
different genomic regions (Figure 5A). In
agreement with the results obtained with the use of the competitive PCR
quantification methodology (see above), the association of Ku with
ors8 and ors12 in logarithmically growing CV-1
cross-linked cells was approximately 3- and 4-fold higher,
respectively, than that of NF-
B p65, and 3.5-fold and 5-fold higher,
respectively, than NGS (Figure 5B, ors8 150, ors12 JJ', ors12 MM). In comparison, the
association of Ku with three genomic regions that do not contain an
origin of DNA replication, EE', BRCA, and CD4 was lower: the region
amplified by primer sets EE' was ~3.5-fold lower and those amplified
by primer sets BRCA and CD4 intron were ~5-fold lower, respectively,
than with the ors8 and ors12 origin-containing
regions (Figure 5B). Finally, the amount of DNA immunoprecipitated with
anti-NF-
B p65 and NGS in origin-containing regions was similar to
that in nonorigin-containing regions (Figure 5B).
|
Cell Cycle-dependent Association of Ku with Origins of Replication
Competitive PCR was also used to quantitatively assess whether Ku
associated with replication origins as a function of the cell cycle.
CV-1 cells were synchronized to G0, G1/S, S, and M phase (see
EXPERIMENTAL PROCEDURES) and synchronization was monitored by
fluorescence-activated cell sorting analysis (Figure
6A).
|
The association of Ku with ors8 and ors12 was the highest at the G1/S boundary, decreased by approximately twofold at the start of S phase, remained low at G2/M, by decreasing approximately another twofold, and reached background levels in serum-starved G0 cells (Figure 6B). Background was considered to be the DNA that was brought down nonspecifically by anti-SC35 antibody (estimated as ~2.2 × 104-4 × 104 molecules/1.5 × 107 cross-linked CV-1 cells), presumably as a result of the cross-linking with SC-35, a protein that does not bind to DNA (Figure 1D). If the association of Ku with ors8 and ors12 was set at 100% (Figure 4C), the background was determined to be 15% (Figure 6B).
The amount of Ku present in the different phases of the cell
cycle was also analyzed, by Western blotting analyses and no significant differences were found (our unpublished results), in
agreement with previous observations by Koike et al. (1999)
. Similarly, Western blot analyses showed that approximately similar amounts of Ku70 and Ku86 immunoprecipitated at each cell cycle stage,
when cells were previously treated with formaldehyde (Figure 6C).
Replication Activity and Ku Immunoprecipitation from
Ku80+/+ and Ku80
/
MEF Cells
Western blot analyses of Ku80+/+
wild-type MEF cells, with the use of anti-Ku70 and anti-Ku86
antibodies, showed that both subunits of the Ku protein were
immunoprecipitated with anti-clone162 antibody from logarithmically
growing cells that were either cross-linked or not (Figure
7A, lanes 1 and 2). In contrast, neither
subunit of Ku was detected when immunoprecipitation of either
cross-linked or untreated Ku80
/
cells was
performed with either clone162 antibody (Figure 7A, lanes 3 and 4) or
anti-Ku86 (our unpublished results).
|
The abundance of origin-containing genomic sequence bound to Ku
protein, after formaldehyde cross-linking and immunoprecipitation, was
measured by conventional PCR (35 cycles). Primer set ADA A, which
amplifies a 230-bp fragment of the adenosine deaminase amplicon (ADA)
(Valerie et al., 1993) was used to verify that
genomic DNA from both noncross-linked Ku80+/+ and
Ku80
/
cells gave the expected amplification
product (Figure 7B, lanes 1 and 2). A PCR reaction with the use of
water instead of template DNA was performed to verify that the primers
were free of contaminating DNA (Figure 7B, lane 3).
When the DNA immunoprecipitated by anti-clone162, anti-Ku70, or
anti-Ku86 antibodies from cross-linked Ku80+/+
cells were used as template DNA for the PCR reaction, the expected 230-bp fragment was amplified by the ADA A primer set (Figure 7B, lanes
4, 6, and 8), whereas no product was detected when the DNA
immunoprecipitated from the Ku80
/
cross-linked cells was used as template (Figure 7B, lanes 5, 7, and 9).
When either the Ku80+/+ or
Ku80
/
cells were not treated with
formaldehyde before immunoprecipitation with anti-clone162, anti-Ku70,
and anti-Ku86 antibodies, no PCR product was amplified by primer set
ADA A (our unpublished results), indicating first that cross-linking
was required before immunoprecipitation with anti-Ku antibodies, and
second that the material that was immunoprecipitated with these
antibodies from the noncross-linked cells did not contain detectable
amounts of contaminating DNA for the PCR reaction.
Because Ku has been implicated in mammalian DNA replication (de Vries
et al., 1989
; Toth et al., 1993
; Araujo et
al., 1999
; Ruiz et al., 1999
; our unpublished results),
in vitro DNA replication experiments were performed with the use of
extracts prepared from both the Ku80+/+ or
Ku80
/
MEFs (Figure 7C) in a mammalian in
vitro replication system (Pearson et al., 1991
;
Zannis-Hadjopoulos et al., 1994
; Diaz-Perez et
al., 1996
, 1998
; Matheos et al., 1998
; Jilani et
al., 1999
; Ruiz et al., 1999
). Approximately a 70%
decrease in in vitro DNA replication was observed when the
Ku80
/
extracts were used, compared with the
Ku80+/+ extracts.
| |
DISCUSSION |
|---|
|
|
|---|
There is increasing evidence suggesting that Ku is involved in DNA
replication, through binding to replication origins (Ruiz et
al., 1999
, and references therein). In the present study, we have
investigated the association of Ku with specific genomic regions,
containing origins of replication. These origins (ors8, ors12, c-myc, and dnmt-1) contain
sequences homologous to the A3/4 sequence element that is present in
mammalian replication origins (our unpublished results);
ors8 contains a sequence that is 85% homologous to A3/4 in
the 186-bp minimal ori, ors12 has a 94%
homologous sequence close to its 5' end, c-myc has a 88% homologous sequence (our unpublished results), and dnmt-1
has a 86% homologous sequence (Araujo et al., 1999
). There
are three types of in vivo DNA binding assays: genomic footprinting
(Diffley and Cocker, 1994
), immunolocalization (Lewis et
al., 1992
), and cross-linking followed by chromatin
immunoprecipitation (Aparicio et al., 1997
; Tanaka et
al., 1997
). The formaldehyde cross-linking approach consists of
using formaldehyde to covalently couple endogenous proteins to DNA, via
2-Å-long methylene bridges. Formaldehyde is a high-resolution easily
reversible cross-linking agent that efficiently produces both
DNA-protein and protein-protein cross-links in vivo. These
characteristics reduce the risk of redistribution or reassociation of
chromosomal proteins during the preparation of cellular extracts.
Antibodies are then used to immunoprecipitate proteins coupled to their
target DNA. This approach, unlike footprinting, permits the
identification of the proteins bound to a specific region. The
efficiency of this approach has been demonstrated in a number of
studies (Jackson, 1978
, 1999
; Solomon and Varshavsky, 1985
; Solomon
et al., 1988
; Gohring and Fackelmayer, 1997
; Nickerson et al., 1997
; Orlando et al., 1997
;
Strahl-Bolsinger et al., 1997
; Tanaka et al.,
1997
; Ritzi et al., 1998
; Treuner et al., 1998
; Homesley et al., 2000
). Because Ku has been shown to bind to
DNA ends, nicks, and structural transitions (reviewed in Tuteja and Tuteja, 2000
) as well as to specific internal sequences (Giffin et al., 1996
; Ruiz et al., 1999
), it was
important to include a number of controls to ensure that the
amplification signals obtained were due to specific protein-DNA
interactions. First, immunoprecipitation with a nonspecific antibody,
NGS, was performed and no DNA was amplified (i.e., no signal was
detected) by conventional PCR. Second, the more sensitive competitive
PCR method permitted quantification of the signal. The background
signal arising from DNA that was immunoprecipitated with the anti-SC-35
antibody, directed against the non-DNA binding protein SC-35 was
quantified. In addition, the DNA that was immunoprecipitated with
anti-NF-
B p65 antibody, a DNA binding protein that does not
associate with origins of DNA replication, was also quantified. These
three negative controls permitted us to estimate the background
nonspecific DNA as ~2.2 × 104-4 × 104 molecules/1.5 × 107 cross-linked CV-1 cells. Immunoprecipitated
material from cells that were not treated with formaldehyde was also
analyzed by conventional (Figure 2, B and C) and competitive PCR (our
unpublished results) and did not contain any DNA fragments from the
origin regions under investigation. The three anti-Ku antibodies
(anti-clone162, anti-Ku70, and anti-Ku86) used in immunoprecipitation,
which recognize the Ku heterodimer or the two Ku subunits separately,
respectively, gave similar results. The consistently slightly higher
amount of molecules immunoprecipitated with anti-Ku86 (Figures 4C and 6B) might be due to a higher efficiency of the anti-Ku86 than the
anti-Ku70 antibody in immunoprecipitation reactions or to a higher
availability of Ku86 epitopes in the cross-linked Ku-DNA complexes.
Interestingly, Ku binding to A3/4 is accomplished by the 86-kDa subunit
(Ruiz et al., 1999
; Schild-Poulter et al., unpublished data), whereas the 70-kDa subunit is mostly
responsible for binding to DNA ends and other Ku-responsive sequences
(Chou et al., 1992
; Schild-Poulter et al.,
unpublished data). Both subunits of Ku are required for DNA
binding activity of the protein (Griffith et al., 1992
; Ono
et al., 1994
; Wu and Lieber, 1996
; Ochem et al.,
1997
) and are functionally dependent on each other, in that neither
subunit can bind DNA alone (Wu and Lieber, 1996
; Ochem et
al., 1997
).
The abundance of origin-containing genomic sequences (ors8
and ors12) bound to Ku protein, after cross-linking and
immunoprecipitation, was measured by PCR-based methods, namely,
conventional, competitive, and real-time PCR (Figures 2, B and C, 4B,
and 5B). Quantification of Ku association with replication origins,
performed by both competitive and real-time PCR, gave similar results.
Ku's association with origin-containing genomic regions of DNA
replication was approximately fivefold higher than with
nonorigin-containing ones. When binding of Ku to a genomic region of
ors12 that does not contain a detectable replication origin
(amplified by primer set EE'; Pelletier et al., 1999
) was
tested by the same methods, the immunoprecipitates containing this
region were comparable to background DNA levels (Figures 4C, 5B, and
6B). In addition, other nonorigin-containing genomic regions were
tested, such as those amplified by primer sets specific for the BRCA
gene and the CD4 intron, and the DNA that was immunoprecipitated with
anti-Ku, anti-NF-
B p65, or NGS antibodies was again comparable with
background DNA levels (Figure 5B). These data suggest that Ku binds to
genomic regions that contain origins of DNA replication.
Formaldehyde is an easily reversible cross-linking agent (Jackson,
1978
) When proteinase K was added to the immunoprecipitated material
before reversal of the protein-DNA cross-links, an adduct-like structure was likely left by the cross-linked protein complex, which
blocked amplification of these genomic regions (Figure 2C). These data
suggest that the Ku-containing complex is positioned near or at the
A3/4 homologous region of origins (Araujo et al., 1999
; Ruiz
et al., 1999
; our unpublished results).
Finally, the cell cycle studies indicated that the association of Ku
with ors8 and ors12 was the highest at the onset
of S phase, being approximately fivefold higher in cells synchronized at the G1/S boundary, compared with that in cells that were blocked at
G0 by serum starvation. When the cells were released from G1/S boundary
into S phase, Ku association decreased by twofold and further decreased
by a factor of 2 in cells that were blocked at G2/M. The differences of
Ku association with ors8 and ors12 in vivo during
the cell cycle were not due to different amounts of Ku present in the
cell extracts, and the association was the critical step in Ku being
immunoprecipitated. The recovery of Ku subunits from cross-linked cells
showed that approximately similar amounts of Ku were immunoprecipitated
at each cell cycle stage (Figure 6C). In view of the recent finding,
which is corroborated in this study, that the total amount of Ku
protein does not change during the cell cycle (Koike et al.,
1999
), the higher association of Ku with ors8 and
ors12 at the onset of S phase is specific and occurs at a
time when these origins become activated (Kaufmann et al.,
1985
). Furthermore, it was also recently reported that the DNA-end
binding activity of Ku remains constant during the cell cycle (Chou and
Chou, 1999
). Thus, the findings in this study suggest a role for Ku in
the initiation of DNA replication, supporting our previous findings
(Ruiz et al., 1995
, 1999
; our unpublished results). Its
higher association with origins at the G1/S phase of the cell cycle
suggests that Ku acts at the level of initiation of replication and
dissociates after origin firing.
Ku knockout mice and Ku-deficient cell lines have been recently
generated (Nussenzweig et al., 1996
; Gu et al.,
1997
). Ku80 knockout mice are viable but they exhibit defective V(D)J
recombination, which result in the absence of T- and B-lymphocyte
maturation (Nussenzweig et al., 1996
; Gu et al.,
1997
). Furthermore, these mice are less than one-half the size of their
heterozygous littermates and exhibit severe growth retardation
(Nussenzweig et al., 1996
). Ku80
/
MEF cells have prolonged doubling times, and the nonproliferating cells
arrest at G1 phase in early passages, indicating premature senescence
(Nussenzweig et al., 1996
; Gu et al., 1997
). The
knockout cells are radiosensitive and fail to resume the cell cycle
after radiation-induced checkpoint arrest. These phenotypes correlate well with Ku's involvement in DNA repair, but are also compatible with
a possible participation of Ku in DNA replication. Arrington et
al. (2000)
observed that
H2O2-treated
Ku80
/
MEFs were unable to traverse the G2
phase and that this defect was not due to deficiencies in DNA repair.
Instead, they observed important differences in the expression of key
cell cycle regulatory genes affecting progression through G2, which
suggests a role for Ku in cell cycle regulated cellular processes, such
as DNA replication.
Because previous reports had implicated the Ku protein in DNA repair
and possibly DNA replication based on the phenotypes of the knockout
mice and their cells (Nussenzweig et al., 1996
; Gu et
al., 1997
; Featherstone and Jackson, 1999), the in vivo association of Ku with a known mouse origin-containing (ADA) genomic sequence was examined in both Ku80+/+ and
Ku80
/
MEFs, by measuring the DNA abundance in
that region when immunoprecipitating with anti-Ku antibodies. Only the
Ku wild-type (Ku80+/+) MEFs showed specific PCR
amplification of that region (Figure 7B). In contrast, in the Ku80
knockout cells, which do not contain detectable amount of Ku protein,
anti-Ku antibodies did not immunoprecipitate a detectable amount of the
ADA origin-containing sequence (Figure 7B). Furthermore, extracts from
Ku80
/
MEFs, had an ~70% decrease in their
replication activity, compared with the Ku80+/+
extracts, in a mammalian in vitro replication system (Figure 7C). Taken
together, these data suggest that the Ku protein plays an important
role in the initiation of mammalian DNA replication, through its
binding to Ku-responsive origins.
In S. cerevisiae, a Ku-like protein was shown to be required
in vitro for the assembly of a complex at a replication origin, suggesting that Ku participates directly in the formation or
establishment of a regulated complex involved in initiation of
replication (Shakibai et al., 1996
). To date, several human
proteins have been shown to be required for initiation of DNA
replication and a replication-competent multiprotein complex has also
been isolated from human cells, including proteins such as DNA
polymerases
and
, proliferating cell nuclear antigen, DNA
primase, replication protein A, topoisomerases I and II, DNA ligase I,
replication factor C, and DNA helicases I and IV (Malkas et
al., 1990
; Wu et al., 1994; Applegreen et al., 1995
; Coll et al., 1996
; Tom et al.
1996
; Lin et al., 1997
; Jiang et al., 1998
;
Malkas, 1998
; Sekowski et al., 1998
). Our data indicate that
the majority, not all, of mammalian replication origins are
Ku-responsive, i.e., they contain an A3/4 homologous element(s) to
which Ku binds specifically at the onset of S phase.
| |
ACKNOWLEDGMENTS |
|---|
This research was supported by grants from the CIHR (to M.Z-H.), the Cancer Research Society (to G.B.P.), and REPLICor Inc.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
mzannis{at}med.mcgill.ca
| |
REFERENCES |
|---|
|
|
|---|
B: the leel of its mRNA is strongly regulated by phorbol ester or tumor necrosis factor alpha.
Proc. Natl. Acad. Sci. USA
88, 966-970
.
Gene
151, 273-277[Medline].This article has been cited by other articles:
![]() |
C. L. Vandre, R. T. Kamakaka, and D. H. Rivier The DNA End-Binding Protein Ku Regulates Silencing at the Internal HML and HMR Loci in Saccharomyces cerevisiae Genetics, November 1, 2008; 180(3): 1407 - 1418. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Patterson and C. A. Fox The Ku Complex in Silencing the Cryptic Mating-Type Loci of Saccharomyces cerevisiae Genetics, October 1, 2008; 180(2): 771 - 783. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Rampakakis, D. Di Paola, and M. Zannis-Hadjopoulos Ku is involved in cell growth, DNA replication and G1-S transition J. Cell Sci., March 1, 2008; 121(5): 590 - 600. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Shi, W. R. Godfrey, J. Lin, G. Zhao, and P. N. Kao NF90 regulates inducible IL-2 gene expression in T cells J. Exp. Med., May 14, 2007; 204(5): 971 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Shi, D. Qiu, G. Zhao, B. Corthesy, S. Lees-Miller, W. H. Reeves, and P. N. Kao Dynamic binding of Ku80, Ku70 and NF90 to the IL-2 promoter in vivo in activated T-cells Nucleic Acids Res., April 1, 2007; 35(7): 2302 - 2310. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Di Paola, G. B. Price, and M. Zannis-Hadjopoulos Differentially Active Origins of DNA Replication in Tumor versus Normal Cells. Cancer Res., May 15, 2006; 66(10): 5094 - 5103. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sibani, G. B. Price, and M. Zannis-Hadjopoulos Decreased origin usage and initiation of DNA replication in haploinsufficient HCT116 Ku80+/- cells J. Cell Sci., August 1, 2005; 118(15): 3247 - 3261. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Miccoli, I. Frouin, O. Novac, D. Di Paola, F. Harper, M. Zannis-Hadjopoulos, G. Maga, D. S. F. Biard, and J. F. Angulo The Human Stress-Activated Protein kin17 Belongs to the Multiprotein DNA Replication Complex and Associates In Vivo with Mammalian Replication Origins Mol. Cell. Biol., May 1, 2005; 25(9): 3814 - 3830. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. B. Murata, M. S. Dodson, and J. D. Hall A Human Cellular Protein Activity (OF-1), Which Binds Herpes Simplex Virus Type 1 Origin, Contains the Ku70/Ku80 Heterodimer J. Virol., July 15, 2004; 78(14): 7839 - 7842. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. B. Price, M. Allarakhia, N. Cossons, T. Nielsen, M. Diaz-Perez, P. Friedlander, L. Tao, and M. Zannis-Hadjopoulos Identification of a cis-Element That Determines Autonomous DNA Replication in Eukaryotic Cells J. Biol. Chem., May 23, 2003; 278(22): 19649 - 19659. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Matheos, O. Novac, G. B. Price, and M. Zannis-Hadjopoulos Analysis of the DNA replication competence of the xrs-5 mutant cells defective in Ku86 J. Cell Sci., January 1, 2003; 116(1): 111 - 124. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Callejo, D. Alvarez, G. B. Price, and M. Zannis-Hadjopoulos The 14-3-3 Protein Homologues from Saccharomyces cerevisiae, Bmh1p and Bmh2p, Have Cruciform DNA-binding Activity and Associate in Vivo with ARS307 J. Biol. Chem., October 4, 2002; 277(41): 38416 - 38423. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Cosgrove, C. A. Nieduszynski, and A. D. Donaldson Ku complex controls the replication time of DNA in telomere regions Genes & Dev., October 1, 2002; 16(19): 2485 - 2490. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, X. Wang, X.-Y. Zhou, D. J. Chen, G. C. Li, G. Iliakis, and Y. Wang Ku Affects the Ataxia and Rad 3-related/CHK1-dependent S Phase Checkpoint Response after Camptothecin Treatment Cancer Res., May 1, 2002; 62(9): 2483 - 2487. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Novac, D. Alvarez, C. E. Pearson, G. B. Price, and M. Zannis-Hadjopoulos The Human Cruciform-binding Protein, CBP, Is Involved in DNA Replication and Associates in Vivo with Mammalian Replication Origins J. Biol. Chem., March 22, 2002; 277(13): 11174 - 11183. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Arosio, S. Cui, C. Ortega, M. Chovanec, S. Di Marco, G. Baldini, A. Falaschi, and A. Vindigni Studies on the Mode of Ku Interaction with DNA J. Biol. Chem., March 15, 2002; 277(12): 9741 - 9748. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||