![]() |
|
|
Vol. 12, Issue 11, 3428-3438, November 2001
School of Molecular Biosciences, Washington State University, Pullman, WA 99164-4234
Submitted April 25, 2001; Revised August 29, 2001; Accepted August 31, 2001| |
ABSTRACT |
|---|
|
|
|---|
The target of rapamycin (TOR) signaling pathway is an important mechanism by which cell growth is regulated by nutrient availability in eukaryotes. We provide evidence that the TOR signaling pathway controls mRNA turnover in Saccharomyces cerevisiae. During nutrient limitation (diauxic shift) or after treatment with rapamycin (a specific inhibitor of TOR), multiple mRNAs were destabilized, whereas the decay of other mRNAs was unaffected. Our findings suggest that the regulation of mRNA decay by the TOR pathway may play a significant role in controlling gene expression in response to nutrient depletion. The inhibition of the TOR pathway accelerated the major mRNA decay mechanism in yeast, the deadenylation-dependent decapping pathway. Of the destabilized mRNAs, two different responses to rapamycin were observed. Some mRNAs were destabilized rapidly, while others were affected only after prolonged exposure. Our data suggest that the mRNAs that respond rapidly are destabilized because they have short poly(A) tails prematurely either as a result of rapid deadenylation or reduced polyadenylation. In contrast, the mRNAs that respond slowly are destabilized by rapid decapping. In summary, the control of mRNA turnover by the TOR pathway is complex in that it specifically regulates the decay of some mRNAs and not others and that it appears to control decay by multiple mechanisms.
| |
INTRODUCTION |
|---|
|
|
|---|
It is estimated that most of the microorganisms in the environment
exist in conditions in which nutrients are limiting (Lewis and Gattie,
1991
). Nutrient availability is very important in controlling cell
division, growth, and physiology in microorganisms as well as in
multicellular organisms. One critical response in yeast to glucose
limitation is the switch from fermentation to respiration, which is
termed the diauxic shift. At the diauxic shift, major changes in gene
expression are induced (reviewed in Werner-Washburne et al.,
1996
) including a general repression of translation (Fuge et
al., 1994
) and extensive changes in the abundance of mRNAs (DeRisi
et al., 1997
). The target of rapamycin (TOR) signaling
pathway senses external nutrient availability and is involved in
mediating the changes in gene expression induced at the diauxic shift
(reviewed in Cutler et al., 1999
; Dennis et al.,
1999
; Thomas and Hall 1999
; Cardenas et al., 1999
).
Rapamycin artificially induces a starvation-like state in yeast (Barbet et al., 1996
) by first forming a complex with the yeast
FK506 binding protein, FKBP. This complex then binds to and represses the activity of the TOR1 and TOR2 proteins (Heitman et al.,
1991
). The TOR signaling transduction pathway is conserved among yeast, flies, and mammals. In mammalian cells, the TOR protein homolog mTOR/FRAP/RAFT1 also coordinates nutrient and mitogenic signals to
control cell growth and cell-cycle progression (reviewed in Cutler
et al., 1999
; Thomas and Hall, 1999
). The Drosophila TOR homolog dTOR also senses nutrient availability (Oldham et
al., 2000
; Zhang et al., 2000
). The TOR proteins are
protein kinases (Alarcon et al., 1999
) and are members of
the phosphatidylinositol kinase-related kinase superfamily
(Helliwell et al., 1994
), which includes the DNA-PK, ATM,
ATR, MEC1, and TEL1 proteins, all of which regulate cell-cycle
progression (reviewed in Keith and Schreiber, 1995
; Kuruvilla and
Schreiber, 1999
). Several downstream effectors of TOR have been
identified in yeast including the catalytic subunits of PP2A, TAP42p
(which regulates PP2A activity), Gln3p, and Ure2p (Di Como and Arndt,
1996
; Beck and Hall, 1999
; Bertram et al., 2000
).
Levels of yeast mRNAs are dramatically altered upon entry into
diauxic shift. Microarray analysis of mRNA expression in yeast shows
that nearly 20% of all yeast mRNAs are down-regulated and that nearly
14% are up-regulated at least twofold upon entering the diauxic shift
(DeRisi et al., 1997
). The treatment of yeast with rapamycin
causes changes in mRNA abundance that overlap with the changes induced
at the diauxic shift (Hardwick et al., 1999
). Some of the
changes in mRNA abundance that occur when TOR signaling is inhibited
are due to the regulation of transcription (Beck and Hall, 1999
;
Cardenas et al., 1999
; Hardwick et al., 1999
; Powers and Walter, 1999
). Translation also undergoes dramatic changes
at diauxic shift with translation rates decreasing to 2-25% of
log-phase values (Boucherie, 1985
; Fuge et al.,1994
). Likewise, the treatment of yeast with rapamycin reduces the translation initiation rates to <50% after only 15 min and to less that 20% after 60 min of exposure (Barbet et al., 1996
). The
translational down-regulation occurs at several levels, including
decreased synthesis of rRNAs (Ju and Warner, 1994
; Powers and Walter,
1999
), the down-regulation of mRNAs for ribosomal proteins, translation initiation and elongation factors (DeRisi et al., 1997
;
Powers and Walter, 1999
; Shamji et al., 2000
), and
degradation of the translation initiation factor eIF4Gp (Berset
et al.,1998
).
The regulation of mRNA turnover continues to emerge as an important way
in which cells control gene expression. Significant progress has been
made in understanding how mRNA turnover is controlled in yeast. There
are currently three known mRNA decay pathways in yeast, including the
deadenylation-dependent decapping decay pathway, the 3'-to-5'
exonucleolytic decay pathway, and the nonsense-mediated decay pathway
(reviewed in Beelman and Parker, 1995
; Decker, 1998
; Czaplinski
et al., 1999
). Under normal conditions, the
deadenylation-dependent decapping decay pathway appears to play the
most significant role in degrading mRNAs in yeast. Deadenylation
proceeds first (Decker and Parker, 1993
) through the action of the Ccr4
and Caf1 proteins (Tucker et al., 2001
). DCP1p
(decapping protein 1) next removes the
7mG cap (Muhlrad et al., 1994
; Muhlrad et al.,
1995
; Beelman et al., 1996
), which is closely followed by
5'-to-3' decay by XRN1p
(exoribonuclease 1) (Hsu and Stevens,
1993
; Muhlrad et al., 1994
; Muhlrad et al.,
1995
).
The experiments presented here provide evidence that the TOR signaling cascade controls mRNA turnover in yeast. We demonstrate that blocking TOR signaling, either through nutrient limitation (diauxic shift) or rapamycin treatment, causes the accelerated turnover of a subset of mRNAs, while others are not effected. Furthermore, the inhibition of TOR appears to destabilize mRNAs by at least two different mechanisms.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Strains
yRP384 (MATa ura3-52 leu2-3112 trp1-
1 his3-
200
mfa1::LEU2 mfa2::URA3 rbp1-1) (Muhlrad and Parker,
1992
) and yRP693 (MAT
ura3-52 leu2 rpb1-1) were used in these
studies. yRP693 was constructed by converting the mating type of yRP582
(Decker and Parker, 1993
) with HO endonuclease under the HO promoter.
To create yCD65 (MATa ura3-52 leu2 rpb1-1 tor1::APT), the
TOR1 gene (from nucleotide-4 relative to the start codon
through the stop codon) was deleted from yRP693 with the use of a PCR
fragment amplified with oCD148 and oCD149 as primers and with pCH153,
which contains the Tn903 APT gene flanked by the yeast PGK1
promoter and 3' end-formation sequences (Hadfield et al.,
1990
), as a template. yCD65 was transformed with either pPW2 (TOR1-1)
or pPW20 (TOR1) (Helliwell et al., 1994
). Yeast strains were
transformed by the lithium acetate method of Gietz and Schiestl (1995)
,
and plasmids were maintained by growth on selective media.
Plasmid Construction
The plasmids used in the MFA2M3pG transcriptional pulse-chase
experiment and a corresponding plasmid bearing the WT MFA2pG gene were
constructed by PCR amplification of the GAL1 promoter, MFA2
gene, and downstream flanking sequence either from pRP410, which
contains the wild-type (WT) MFA2 gene (Decker and Parker, 1993
), or pRP413, which contains the MFA2 gene with three
point mutations (M3) in its 3'UTR (U248C, U251G, and U282C) (Muhlrad and Parker, 1992
) with oCD33 (complementary to GAL1 UAS and introduces XbaI site) and oCD34 (introduces HindIII site 720 nucleotides 3' of MFA2 start codon). Amplified fragments
were inserted into the LEU2 CEN shuttle vector pRS405 (Sikorski and
Hieter, 1989
) that was cut with XbaI and HindIII
to make pCD30 (WT) and pCD31(M3). A poly(G) tract was inserted into the
3'UTRs of both the WT and M3 MFA2 genes at position B178
(Decker and Parker, 1993
). First, a BglII site was
introduced 178 nucleotides downstream of the transcription start site
(B178; Muhlrad and Parker, 1992
) with the use of the Quickchange Kit
(Stratagene, Burlingame, CA) with oCD79 and oCD80. oCD126 and oCD127
were inserted into the B178 site to make pCD56 (MFA2pG) and pCD58
(MFA2M3pG). The plasmids used to express MFA2pG (pCD61) and MFA2M3pG
(pCD62) from the endogenous MFA2 promoter were constructed by replacing
the 386-bp BamHI fragment encompassing the MFA2 3'UTR in
pRP264 (Muhlrad and Parker, 1992
) with the corresponding fragment from
pCD56 and pCD58. The plasmid used for the ARO4pG transcriptional pulse
chase (pCD116) was made by first cloning the ARO4 gene from yeast
chromosomal DNA by PCR with oCD152 and oCD153. The ARO4 PCR product was
digested with HindIII and BamHI and ligated to
HindIII/BamHI cleaved pRP22 (Heaton et
al., 1992
) to make pCD111. The poly(G) tract was inserted into pCD111 by introducing a BglII site into the ARO4 3'UTR with
the use of the Quickchange mutagenesis kit with oCD162 and oCD163. These oligonucleotides introduce two point mutations, T 1145 G, and A
1148 C, relative to the start codon (Kunzler et al., 1992
) The poly(G) tract formed by hybridization of oRP126 and oRP127 was
inserted at the newly created BglII site and was checked for proper orientation by sequencing with oCD153.
Oligonucleotides
oCD33 (for transferring galactose-regulated MFA2 genes into LEU2 CEN plasmid), 5'GGGTCTAGAGTACGGATTAGAAGCCGCCG;
oCD34 (for transferring galactose-regulated MFA2 genes into LEU2 CEN plasmid), 5'GGAAGCTTCGATTCGAAGTGGGCACCGGCG;
oCD79 (for creation of BglII site at nucleotide 178 of MFA2 mRNA), 5'CGACAACCAAGAGATCTAATCAATATCTACCC;
oCD80 (for creation BglII site at nucleotide 178 of MFA2 mRNA), 5'GGGTAGATATTGATTAGATCTCTTGGTTGTCG;
oCD113 (detects ARO4 mRNA), 5'TTTCCAGCCGACGGTTGTTC;
oCD114 (detects CRY1 mRNA), 5'TCTAGTACCACCGGTAGGTC;
oCD115 (detects CYS3 mRNA), 5'CGATTGCAAGATTGTGGCGG;
oCD117 (detects GRC5 mRNA), 5'GCGGCCAAACCGTGTGGCTT;
oCD118 (detects TIF51A mRNA), 5'GAAGGAGATGGCGGCTTCTT;
oCD148 (for deletion of TOR1 gene), 5'CATTGGTAAAGTGAAACA-T A C A T C A A C C G G C T A G C A G G T T T G C A T C C C T C A T A A A G C A C G T G G C C;
oCD149 (for deletion of TOR1 gene), 5'AAAATAAATAGTAAA-C A A A G C A C G A A A T G A A A A A T G A C A C C G C A G A C T T A A A A T A C G C T G A A C C C;
oCD152 (for cloning ARO4 and addition of BamHI site at 5' end), 5'GGGGGATCCCAACGATGAAATGAAAAAATTTTGCTTGAA;
oCD153 (for cloning ARO4 and addition of HindIII at 3' end), 5' T A G T C G T C G A T A T C A A A G G A A T A T C A A C T T A T G T A T G A A G C T T G G G;
oCD160 (for introduction of BglII site in ARO4 3'UTR), 5'GA-TGTTTTTTTAATGAGATCTGTAACGTACATTCTTTCCTCTACC ;
oCD161 (for introduction of BglII site in ARO4 3'UTR), 5'GGTAG A G G A A A G A A T G T A C G T T A C A G A T C T C A T T A A A A A A A C A T C;
oCD163 (for RNAse H cleavage of ARO4pG), 5'GTTAACTTCTCTTCTTTGTCTGAC;
oRP100 (detects 7S RNA, for correcting for differences in RNA loading on Northern blots), 5'GTCTAGCCGCGAGGAAGG;
oRP126 (for insertion of poly(G) tract) (Decker and Parker 1993
),
5'GATCTAGGAATTTGGGGGGGGGGGGGGGGGGAATTCCT; and
oRP127 (for insertion of poly(G) tract and detection of mRNAs with poly(G) insertion), 5'GATCCAGGAATCCCCCCCCCCCCCC-CCCCAAATCCTA.
RNA Analyses
RNA Preparation and Northern Analysis.
Total RNA was
isolated from frozen cell pellets, as previously described (Caponigro
et al., 1993
). Unless otherwise noted, RNA was fractionated
on 1.75% formaldehyde agarose gels run for 3.5 h at 70 V,
transferred to Zeta-Probe (Bio-Rad, Richmond, CA) with 10× SSC,
UV-cross-linked, and probed by standard methods. Northern analysis was
quantified with the use of a Storm860 Phosphorimager (Molecular
Dynamics, Eugene, OR) and ImageQuant software (Molecular Dynamics). A RNA polymerase III transcript, 7S RNA, which was detected
with oRP100, was used to correct for differences in RNA loading
(Caponigro et al., 1993
).
mRNA Half-life Analysis.
mRNA decay rates were determined by
thermal inactivation of rpb1-1 with the use of a protocol modified
from Herrick et al. (1990)
. Cultures of yRP384 carrying
either pCD61 or pCD62 were grown in 200 ml of synthetic selective media
with 2% glucose at 24°C from an OD600 of 0.1 to an OD600 of 0.3-0.4. Cells were harvested by
centrifugation and were resuspended in 10 ml of fresh media at 24°C.
The temperature of the culture was rapidly adjusted to 36°C by the
addition of 10 ml of media that was preheated to 58°C, and the entire
culture was transferred to a 36°C water bath. Aliquots were removed
at various times, cells were harvested by centrifugation, and cell
pellets were frozen on dry ice. When rapamycin was used, rapamycin (or
an equivalent amount of vehicle) was added to a final concentration of
0.2 µg/ml when the culture reached an OD600 of
0.3, the cells then were incubated for the indicated amount of time
before the temperature shift was performed. Rapamycin (Sigma, St.
Louis, MO) was diluted from a stock solution of 1 mg/ml in 90% ethanol
and 10% Tween-20. The media used for the transcriptional shut off also
contained rapamycin or vehicle. When mRNA half-life analysis was
performed at the diauxic shift, 25-ml cultures were grown from an
OD600 of 1 until the cell division rate decreased
relative to the rate during log-phase growth (as determined by
monitoring OD600 vs. time). Diauxic shift usually occurred at approximately OD600 5.0. At that
point, 20 ml of culture were harvested by centrifugation. Ten
milliliters of the recovered exhausted media were heated to 58°C. The
cells were resuspended in the remaining 10 ml of exhausted media, and
transcription was inhibited by the addition of the prewarmed exhausted media.
Analysis of the Mechanism of mRNA Decay in the Presence of
Rapamycin.
Transcriptional pulse-chase analysis was performed as
previously described (Decker and Parker, 1993
), except that the pH of the media was adjusted to 6.5 with ammonium hydroxide. Briefly, cultures of yRP693 carrying pCD58 (MFA2M3pG) or pCD116 (ARO4pG) were
grown in synthetic media containing 2% raffinose to an
OD600 of 0.3-0.4, the cultures were treated with
rapamycin or vehicle for 210 min (MFA2M3pG) or 60 min (ARO4pG),
transcription was induced for 10 min by the addition of galactose, and
transcription then was inhibited by simultaneously adding glucose and
rapidly shifting the temperature of the culture to 36°C. RNase H
reactions, RNA separation in 6% polyacrylamide (MFA2M3pG) or 8%
(ARO4pG)/7.7 M urea gels at 300 V for 9 h (MFA2M3pG) or 11 h
(ARO4pG), and transfer to the Zeta-Probe membrane were all performed as
described previously (Decker and Parker, 1993
).
Analysis of the MFA2pG mRNA Decay Fragment.
The amount of
decay fragment relative to the amount of the full-length MFA2pG mRNA
was measured in a culture of yRP384 containing pCD61 that was grown to
log phase or diauxic shift, or was measured in a culture of yCD65
containing pCD56 and either pPW20 (TOR1) or pPW2 (TOR1-1) (Helliwell
et al., 1994
) that was treated with rapamycin or vehicle for
210 min.
| |
RESULTS |
|---|
|
|
|---|
Multiple mRNAs Are Degraded Faster at Diauxic Shift Than in Log Growth
To determine whether changes in mRNA turnover were induced
at diauxic shift, we compared the rates of mRNA turnover between yeast
cultures in log phase or in cultures as they entered diauxic shift. We
initially investigated the turnover of the WT MFA2 mRNA (MFA2pG) and a
stable mutant form of this mRNA (MFA2M3pG), which carries three point
mutations in its 3'UTR (see MATERIALS AND METHODS; and Muhlrad and
Parker, 1992
). These mRNAs were driven from the same promoter, had
identical 5' leader sequences, and were marked with a poly(G) tract
insert in their 3'UTRs, which does not effect stability but allow for
the analysis of decay fragments (Decker and Parker, 1993
). mRNA
half-lives were measured with the use of a temperature-sensitive allele
of RNA polymerase II, rpb1-1, to inhibit transcription (Nonet et
al., 1987
). As has been shown previously (Muhlrad and Parker,
1992
), the mutant MFA2M3pG mRNA was more stable than the MFA2pG mRNA at
log phase, with a half-life of 12.5 min compared with 5 min for the WT
control (Figure 1A). At diauxic shift,
the half-life of the WT mRNA was unchanged compared with log phase. In
contrast, however, at diauxic shift the mutant mRNA was destabilized
approximately twofold to 5.6 min (Figure 1A). This result indicated
that the decay of the mutant MFA2M3pG mRNA is accelerated at diauxic
shift, whereas the WT mRNA is unaffected under these conditions.
|
It was important to determine whether mRNA destabilization was a
general phenomenon at diauxic shift or whether this effect was unique
to the MFA2M3pG mRNA. To address whether multiple mRNAs were
destabilized at diauxic shift, we compared the half-lives of several
mRNAs at early log phase with those at diauxic shift. We selected mRNAs
to examine which are less abundant at diauxic shift compared with log
phase (DeRisi et al., 1997
), because these mRNAs were more
likely to be destabilized. These mRNAs include those for 2-dehydro-3
deoxyphosphoheptonate-aldolase (ARO4), ribosomal protein S14A (CRY1),
cystathionine gamma lyase (CYS3), ribosomal protein L10 (also referred
to as growth control gene 5 [GRC5]), and eukaryotic translation
initiation factor 5A (TIF51A). The stable PGK1 mRNA also was analyzed
because its decay at log phase has been well-studied. The ARO4, CRY1,
and GRC5 mRNAs were significantly destabilized during diauxic shift
(Figure 1B). In contrast to the ARO4, CRY1, and GRC5 mRNAs, no
significant change in half-life was detected for the TIF51A, CYS3, and
PGK1 mRNAs (Figure 1B). These results, taken together with the
destabilization of the MFA2M3pG mRNA, suggest that mRNA turnover is an
important component of gene regulation at diauxic shift.
Blocking the TOR Signaling Pathway with Rapamycin also Induces Rapid mRNA Decay
To determine whether inhibiting TOR signaling with
rapamycin caused effects on mRNA turnover that were similar to those
observed at diauxic shift, log-phase yeast cultures expressing either
the MFA2pG or MFA2M3pG mRNAs were treated with either rapamycin in vehicle or with vehicle alone for 210 min. Treatment with vehicle had
no effect on the turnover of the MFA2pG or MFA2M3pG mRNAs (compare
Figure 1A log phase and Figure 2A rapamycin). The treatment of
log-phase cultures with rapamycin induced similar effects on mRNA
turnover compared with those at diauxic shift. The MFA2M3pG mRNA again
was destabilized approximately twofold to 5.5 min, while the turnover
of the MFA2pG mRNA remained unchanged (Figure 2A). This result suggested that turnover
of the MFA2M3pG mRNA is regulated by the TOR signaling pathway.
|
We next investigated the effects of rapamycin on mRNA turnover over a time course of rapamycin treatment. The half-lives of the ARO4, CRY1, GRC5, MFA2M3pG, and PGK1 mRNAs were measured after 10, 30, 60, and 210 min of rapamycin treatment and were compared with the half-life that was observed after treatment with vehicle for 210 min. Three distinctly different mRNA turnover phenotypes were observed after rapamycin treatment (Figure 2B). The ARO4, CRY1, and GRC5 mRNAs were rapidly destabilized after only 10-30 min of exposure to rapamycin and were further destabilized by 60 min of treatment. Surprisingly, however, at 210 min of rapamycin treatment, the ARO4, CRY1, and GRC5 mRNAs were restabilized close to their respective control half-lives. For example, the half-life of the ARO4 mRNA was 17.3 min in control cells. By 10 min of rapamycin treatment, the half-life was reduced to 15.6 min (90% of control). The ARO4 mRNA was destabilized even more after 30 min of treatment to a half-life of 10.9 min (58% of control) and remained destabilized after 60 min of rapamycin treatment. At 210 min of exposure to rapamycin, the ARO4 mRNA half-life restabilized to 17.5 min. In sharp contrast, the MFA2M3pG mRNA was not destabilized by 10, 30, or 60 min of rapamycin treatment but was only destabilized by 210 min of exposure to the drug. Finally, similar to what was observed at diauxic shift, no half-life change was detected for the PGK1 mRNA after any length of rapamycin treatment. Although the stability of mRNAs responded with different kinetics to rapamycin, the most important observation from these results is that, similiar to the situation at diauxic shift, rapamycin also destabilizes mRNAs. Furthermore, rapamycin destabilized the same mRNAs that were destabilized at diauxic shift (ARO4, CRY1, GRC5, and MFA2M3pG) and did not affect the stability of the mRNAs that had not been altered at diauxic shift (PGK1, MFA2pG).
Rapamycin Does Not Induce Accelerated mRNA Turnover in Rapamycin-resistant Yeast
To verify that rapamycin treatment accelerated mRNA turnover via
the TOR signaling pathway, rapamycin-resistant mutants were exposed to
the drug and were tested for accelerated turnover. Rapamycin resistance
can be conferred to yeast by the introduction of the TOR1-1 allele
(Helliwell et al., 1994
). The TOR1-1 allele is dominant at
24°C but is recessive at 36°C, which is the temperature needed to
inactivate the rpb1-1 allele. Therefore, to ensure that the TOR1-1
allele would be effective during half-life measurements, it was
necessary to delete the chromosomal TOR1 allele and introduce either
the TOR1 or TOR1-1 allele on a plasmid (Helliwell et al., 1994
). The half-life of the MFA2M3pG mRNA was measured in TOR1 and
TOR1-1 cell lines after 210 min of vehicle or rapamycin treatment (Figure 3). The MFA2M3pG mRNA was stable
in both TOR1 and TOR1-1 cells that were treated with vehicle. The mRNA
was destabilized by rapamycin treatment in TOR1 cells, however,
rapamycin treatment of the TOR1-1 cells did not result in the
destabilization of the MFA2M3pG mRNA. Furthermore, a strain carrying a
deletion of the FPR1 gene, which encodes the FK506 binding
protein (FKBP) required for rapamycin to inhibit the TOR proteins
(Heitman at al., 1991
), was also resistant to the destabilizing effect
of rapamycin (data not shown). From these results, we conclude that the
mRNA destabilizing effects mediated by rapamycin are due to the
inhibition of the TOR signaling pathway.
|
Rapamycin Destabilizes MFA2M3pG mRNA by Acceleration of Decapping
To begin to understand how the TOR signaling pathway regulates
mRNA decay, it was important to determine whether rapamycin treatment
accelerated the deadenylation-dependent decapping mechanism or induced
an alternative decay mechanism. Transcriptional pulse-chase experiments
allow the analysis of deadenylation, decapping, and the directionality
of mRNA decay (Decker and Parker, 1993
; Muhlrad et al.,
1994
) and, thus, were used to determine the mechanism by which mRNAs
are degraded after rapamycin treatment.
To determine how prolonged exposure to rapamycin (210 min) destabilized
the MFA2M3pG mRNA, a pulse of newly synthesized mRNA was created, then
transcription was rapidly repressed (see MATERIALS AND METHODS).
Deadenylation and decapping of these newly synthesized transcripts were
monitored by removing aliquots at various time intervals and analyzing
the MFA2M3pG mRNA (Figure 4). The length of the poly(A) tail on the mRNA was determined by comparing the size of
the mRNA at any given time to the size of the mRNA that has had its
poly(A) tail removed by treatment with oligo dT and RNase H (lane dT,
Figure 4). It is important to follow through the time course the pulse
of mRNA present at 0 min, which, at later time points, can be detected
above the uniform background that results from residual transcription.
|
In both the control and rapamycin-treated cells, the MFA2M3pG mRNA
decayed via the deadenylation-dependent mechanism. This is evident
because there is not a loss of intensity in the pulse of mRNA until the
transcripts have been deadenylated. In addition, a decay fragment
accumulates after deadenylation that is the correct size to be produced
by decapping and 5'-to-3' digestion up to the poly(G) structure at the
3' end of the mRNA (Decker and Parker, 1993
; Muhlrad et al.,
1994
). Furthermore, in a dcp1
cell line, the turnover of the
MFA2M3pG mRNA was not accelerated by rapamycin treatment (data not
shown), indicating that accelerated turnover in response to rapamycin
is still dependent on decapping and, therefore, proceeds via the
deadenylation-dependent decay mechanism. In both vehicle-treated and
rapamycin-treated cells, the pulse of mRNA deadenylates from 0-9 min,
thus, there is no significant increase in the rate of deadenylation
after rapamycin treatment. The most striking difference in the decay of
the MFA2M3pG mRNA after rapamycin treatment, as compared with control
cells, is the rapid disappearance of the pulse of mRNA after
deadenylation. The pulse of MFA2M3pG mRNA in the control cells is not
completely degraded until between 15 and 17 min, whereas in the
rapamycin-treated cells the pulse of mRNA disappears by 9 or 11 min.
The rapid degradation of the deadenylated mRNA in the presence of
rapamycin is most likely due to accelerated decapping since once an
mRNA is decapped it is immediately degraded by the XRN1 exonuclease. We
have found no evidence that the alternative 3'-to-5' decay pathway or
other decay mechanisms are induced by rapamycin or at diauxic shift (data not shown). Therefore, the inhibition of TOR signaling primarily destabilizes the MFA2M3pG mRNA by inducing rapid decapping.
ARO4 mRNA Is Destabilized by a Prematurely Short Poly(A) Tail
The ARO4 mRNA was used as a model to determine how rapamycin
effected the turnover of mRNAs after shorter intervals (60 min) of
rapamycin treatment. To perform transcriptional pulse-chase analysis on
the ARO4 mRNA, the ARO4 gene was first cloned under the
control of a galactose-regulated promoter and a poly(G) tract was
inserted into its 3'UTR (ARO4pG) (see MATERIALS AND METHODS). Like the
MFA2M3pG mRNA, the ARO4pG mRNA from control cells degraded through the
deadenylation-dependent decapping pathway (Figure 5). In our analysis, we focused on the
major ARO4pG mRNA species, however, a slightly longer transcript that
results from the use of an alternate 3' end signal is also present
(Kunzler et al., 1992
). The most obvious difference between
mRNAs from control cells and rapamycin-treated cells was that the
ARO4pG mRNA had a prematurely short poly(A) tail after rapamycin
treatment. In vehicle-treated cells, the pulse of mRNA had poly(A)
tails 50-10 adenylate residues long, whereas in the
rapamycin-treated cells, the mRNA at 0 min had tails of only 10-0
adenylate residues (in Figure 5 compare the dT lane to the 0 min
lane). Due to the extremely short poly(A) tails that were
present after rapamycin treatment, it was not possible to measure
deadenylation in the rapamycin-treated cells, however, the observed
decay fragment is identical to that in the control cells and is the
size expected from 5'-to-3' decay. Furthermore, in a dcp1
strain,
rapamycin was not able to stimulate rapid decay of the ARO4 mRNA (data
not shown), which indicates that decapping was still a prerequisite for
decay. The decapping rate can be compared between the vehicle-treated
cells and the rapamycin-treated cells by examining the time required to
degrade the deadenylated mRNA. In the control cells, the ARO4pG mRNA
reaches an oligo(A) tail by 15 min and the RNA was completely
degraded ~ 10 min after deadenylation was complete. In
rapamycin-treated cells, the ARO4pG mRNA already had an oligo(A) tail
at 0 min and was degraded by 10 min. The similarity between the time
needed to degrade the oligo(A) species in the control and
rapamycin-treated cells suggests that decapping is not a significant
factor in the destabilization of the ARO4 mRNA by rapamycin. Therefore,
the ARO4pG mRNA is destabilized after rapamycin treatment by the mRNA having a prematurely short poly(A) tail.
|
Diauxic Shift and Rapamycin Treatment Increase the Accumulation of 5'-to-3' Decay Intermediates
In addition to changes in mRNA turnover, we observed another
effect on mRNA metabolism when TOR signaling was inhibited. As shown in
Figure 6, the amount of the decay
fragment generated by 5'-to-3' exonucleolytic decay of the MFA2pG mRNA
increased relative to the amount of the full-length mRNA at diauxic
shift and after rapamycin treatment in TOR1 cells. This results in an increase in the ratio of the fragment to the full-length mRNA (F/FL).
The amount of the MFA2M3pG and ARO4pG mRNA decay fragments also
increased at diauxic shift and/or after rapamycin treatment (data not
shown). The accumulation of fragment is due, at least in part, to
inhibition of the TOR signaling pathway given that the MFA2pG decay
fragment did not accumulate to the same exent in TOR1-1 cells treated
with rapamycin as compared to TOR1 cells (Figure 6). The accumulation
of decay fragments is not solely due to faster degradation of the
corresponding full-length mRNA given that the half-life of the MFA2pG
mRNA is not accelerated when TOR signaling is inhibited. Another
possible explanation for the increased amount of fragment is that
turnover of the fragment is reduced when TOR is inhibited. The decay
fragments produced by the deadenylation-dependent decapping pathway are
degraded by the 3' to 5' exosome decay pathway (Anderson and Parker,
1998
). However, the accumulation of the MFA2pG fragment is not due to a
decrease in the rate of 3' to 5' degradation because its half-life is
the same in the presence or absence of rapamycin (data not shown). One
alternative explanation is that during log phase growth, 5' to 3'
exonucleolytic digestion stalls at the poly(G) block on only a fraction
of the MFA2pG transcripts and that inhibition of the TOR signaling
pathway leads to a more efficient blockage. Perhaps, for example, the
processivity of the XRN1p exonuclease may be reduced after rapamycin
treatment or an RNA helicase activity that aids XRN1p digestion through
the poly(G) structure could be downregulated.
|
| |
DISCUSSION |
|---|
|
|
|---|
The TOR Signaling Pathway Regulates mRNA Turnover in Response to Nutrient Availability
We provide three pieces of evidence that indicate that the TOR signaling pathway controls mRNA turnover in yeast. First, several mRNAs were destabilized at diauxic shift, a state of limited nutrients that is sensed by the TOR signaling pathway. Second, rapamycin induced almost identical effects on mRNA turnover as those observed at diauxic shift. Finally, the observation that the rapamycin-resistant TOR1-1 allele or the deletion of FKBP reversed the rapamycin-induced changes in mRNA turnover directly indicates that mRNA turnover is regulated by the TOR signaling pathway.
Significant, widespread changes in mRNA abundance occur at diauxic
shift and after TOR signaling has been blocked by rapamycin (DeRisi
et al., 1997
; Hardwick et al., 1999
; Shamji
et al., 2000
). The fact that the majority of the mRNAs that
we examined that are down-regulated at diauxic shift were destabilized
strongly suggests that the regulation of mRNA turnover by TOR plays an important role in controlling yeast gene expression in response to
nutrient limitation. Although the TOR signaling pathway has been
demonstrated to regulate the transcription of specific genes, in
particular genes for ribosomal proteins and proteins involved in
nitrogen catabolite repression (Cardenas et al., 1999
;
Hardwick et al., 1999
; Powers and Walter, 1999
), our
observation that the CRY1 and GRC5 ribosomal protein mRNAs are
destabilized illustrates that the regulation of both transcription and
stability contribute to the overall changes in mRNA abundance seen when
TOR signaling is blocked. Given the conservation of the TOR signaling
pathway, the regulation of mRNA turnover may be an important mechanism in controlling the balance between cell growth and proliferation in
multicellular eukaryotes as well. Indeed, rapamycin treatment of
mammalian cells has been shown to destabilize the interleukin 3 and
cyclin D1 mRNAs (Banholzer et al., 1997
; Hashemolhosseini et al., 1998
).
Previous research (Jona et al., 2000
) concluded that mRNAs
were stabilized by the rapid withdrawal of glucose from the growth media. This finding would seem to be in direct contrast to the results
presented in this report. However, recent data illustrate that rapid
depletion of glucose results in cellular responses that are not
TOR-dependent (Ashe et al., 2000
). Therefore, the stabilization of mRNAs after rapid glucose depletion is likely to be
due to a mechanism that is different from what we have observed. It
should also be noted that, unlike the destabilization of mRNAs that we
have observed at diauxic shift when glucose becomes limiting and cells
switch to respiration, the SDH1 and SDH2 mRNAs are stabilized when
cells are grown in carbon sources that require respiration and are
destabilized in the presence of glucose (Lombardo et al., 1992
; Cereghino et al., 1995
). Whether TOR is involved in
the regulation of the stability of these mRNAs remains to be determined.
The TOR Signaling Pathway Regulates the Deadenylation-dependent Decapping Pathway
Two general possibilities for how the blocking of TOR could destabilize mRNAs are that it could accelerate the decay pathways that are active during log phase or it could induce a new decay mechanism. From our transcriptional pulse-chase analyses, we conclude that the TOR signaling pathway regulates mRNA turnover by controlling the predominant log-phase decay mechanism, the deadenylation-dependent decapping pathway. Furthermore, TOR inactivation appears to accelerate the turnover of mRNAs by the deadenylation-dependent decapping pathway through at least two different mechanisms. This idea was first suggested by the difference in the rate of response of particular mRNAs to rapamycin. Moreover, the fact that the MFA2M3pG mRNA became destabilized at a time when the other mRNAs were being restabilized is most consistent with the turnover of the MFA2M3pG mRNA being affected by a different mechanism than the other mRNAs. Finally, the transcriptional pulse-chase analysis indicated that the MFA2M3pG mRNA was destabilized primarily by the acceleration of decapping. In contrast, the ARO4pG mRNA was destabilized primarily by a prematurely short poly(A) tail, which ultimately contributes to the accelerated 5'-to-3' decay by shortening the time necessary to reach the oligo(A) tail, which is required for decapping to occur. Therefore, to understand how TOR activity regulates mRNA decay it will be necessary to elucidate how both decapping and poly(A) tail metabolism are controlled.
How Are Decapping and Poly(A) Tail Length Controlled by the TOR Signaling Pathway?
mRNA decapping could be controlled by TOR at several levels. One
potential target of the TOR pathway is the decapping protein itself,
DCP1p, since it is a phosphoprotein (LaGrandeur and Parker, 1998
),
although it is not known whether its phosphorylation state affects its
activity. In addition to DCP1, many other genes such as
MRT4, GRC5, TIF51A, PAB1,
and EDC2 are known to effect the deadenylation-dependent
decapping pathway (Caponigro and Parker, 1995
; Zuk and Jacobson, 1998
;
Zuk et al., 1999
; Dunckley et al., 2001
). The
mRNA levels for these genes are regulated at diauxic shift and/or by
rapamycin treatment (DeRisi et al., 1997
; Hardwick et
al., 1999
; Shamji et al., 2000
). However, of these five
genes, the up-regulation of the mRNA encoding EDC2p, which enhances
decapping, is most consistent with the increase in decapping that we
have observed. Another mechanism by which the TOR signaling pathway could control mRNA decapping is indirectly through regulating mRNA
translation. This idea is based on the observation that, in general,
decreased translation initiation results in the destabilization of
mRNAs (Muhlrad et al., 1995
; LaGrandeur and Parker, 1999
;
Schwartz and Parker, 1999
). It is possible that decapping is
accelerated indirectly by TOR inhibition since translation is
dramatically reduced at diauxic shift and after rapamycin treatment
(Boucherie, 1985
; Fuge et al.,1994
; Barbet et
al., 1996
). In particular, several of the translation initiation
factors that are believed to protect the 7mG cap from DCP1p (Schwartz
and Parker, 2000
) are down-regulated at diauxic shift or after
rapamycin treatment (DeRisi et al., 1997
; Berset et
al.,1998
; Powers and Walter, 1999
; Shamji et al., 2000
). If changes in translation are responsible for the observed increase in decapping, then it will be important to understand how
mRNAs such as the PGK1 transcript, which have been shown to be
destabilized when translation initiation is reduced (Muhlrad et
al., 1995
; Schwartz and Parker, 1999
; LaGrandeur and Parker, 1999
), are not affected when TOR is inhibited.
The presence of prematurely short poly(A) tails on mRNAs when TOR is
inhibited could result from the extreme acceleration of cytoplasmic
deadenylation or alternatively from the loss of normal polyadenylation.
In either case, TOR signaling is likely to regulate poly(A) tail length
directly, given that the ARO4 mRNA begins to be destabilized after only
10 min of rapamycin treatment. If TOR regulates deadenylation, then the
major cytoplasmic deadenylation factors, Caf1p and Ccr4p (Tucker
et al., 2001
), and the PUF proteins that have been found to
control deadenylation in a mRNA-specific manner (Olivas and Parker,
2000
) are potential targets of regulation. If TOR controls the length
of the nascent poly(A) tail, any of the multitude of factors involved
in polyadenylation could be regulated, however, two particularly good
candidates are the PAN2/PAN3 nuclease, which is believed to trim new
poly(A) tails in the nucleus to a mRNA-specific length (Brown and
Sachs, 1998
), and PBP1p, which is required for the addition of long
poly(A) tails in vitro and is down-regulated at late log phase (Mangus et al., 1998
).
Two important questions arise from our results. Why are some mRNAs destabilized when TOR signaling is inhibited while others are unaffected? And, what determines whether a particular mRNA is susceptible to enhanced decapping or to alterations to poly(A) tail metabolism? It is especially intriguing that TOR inhibition somehow suppresses the stabilizing effects of the mutations located in the instability elements of the MFA2 mRNA. Thus, investigation into how TOR regulates mRNA turnover is not only essential to understanding how gene expression is controlled on a global level in response to nutrient availability, but it may also lead to a better understanding of how specific elements within mRNAs control mRNA stability.
| |
ACKNOWLEDGMENTS |
|---|
We thank Roy Parker and the members of his laboratory for the yeast strain yRP384 and for their helpful discussions. We also thank M. Hall for the TOR1 (pPW20) and TOR1-1 (pPW2) plasmids, and C. Hadfield for the PGK1 APT fusion (pCH153) plasmid. We especially thank Raymond Reeves, Roy Parker, and Kwan Hee Kim for their critical reading of the manuscript and for the past and present members of C. Decker's laboratory for their input during the course of these experiments. This work was supported by the National Institutes of Health grant GM55132 to C.J.D.
| |
FOOTNOTES |
|---|
* Present address: Department of Pediatrics, National Jewish Medical and Research Center, Denver, CO 80206.
Present address: Department of Molecular and Cellular Biology, University of Arizona, Tucson, AZ 85721. E-mail address: cjdecker{at}emailarizona.edu
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Ren, Z. Mi, N. A. Stewart, and E. K. Jackson Identification and Quantification of 2',3'-cAMP Release by the Kidney J. Pharmacol. Exp. Ther., March 1, 2009; 328(3): 855 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Zurita-Martinez, R. Puria, X. Pan, J. D. Boeke, and M. E. Cardenas Efficient Tor Signaling Requires a Functional Class C Vps Protein Complex in Saccharomyces cerevisiae Genetics, August 1, 2007; 176(4): 2139 - 2150. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Li, B. Ding, R. Chen, C. Ruggiero, and X. Chen Evidence that the Transcription Elongation Function of Rpb9 Is Involved in Transcription-Coupled DNA Repair in Saccharomyces cerevisiae Mol. Cell. Biol., December 15, 2006; 26(24): 9430 - 9441. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-L. Todeschini, C. Condon, and L. Benard Sodium-induced GCN4 Expression Controls the Accumulation of the 5' to 3' RNA Degradation Inhibitor, 3'-Phosphoadenosine 5'-Phosphate J. Biol. Chem., February 10, 2006; 281(6): 3276 - 3282. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Foat, S. S. Houshmandi, W. M. Olivas, and H. J. Bussemaker Profiling condition-specific, genome-wide regulation of mRNA stability in yeast PNAS, December 6, 2005; 102(49): 17675 - 17680. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Inoki, H. Ouyang, Y. Li, and K.-L. Guan Signaling by Target of Rapamycin Proteins in Cell Growth Control Microbiol. Mol. Biol. Rev., March 1, 2005; 69(1): 79 - 100. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Crespo and M. N. Hall Elucidating TOR Signaling and Rapamycin Action: Lessons from Saccharomyces cerevisiae Microbiol. Mol. Biol. Rev., December 1, 2002; 66(4): 579 - 591. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||