![]() |
|
|
Vol. 12, Issue 11, 3589-3600, November 2001



§
*Center for Molecular Oncology,
Committee on Cancer
Biology, and
Department of Molecular Genetics and Cell
Biology, The University of Chicago, Chicago, Illinois 60637
| |
ABSTRACT |
|---|
|
|
|---|
The yeast cyclin-dependent kinase Cdc28p regulates bud
morphogenesis and cell cycle progression via the antagonistic
activities of Cln and Clb cyclins. Cln G1 cyclins direct polarized
growth and bud emergence, whereas Clb G2 cyclins promote isotropic
growth of the bud and chromosome segregation. Using colony morphology as a screen to dissect regulation of polarity by Cdc28p, we identified nine point mutations that block the apical-isotropic switch while maintaining other functions. Like a clb2
mutation,
each confers tubular bud shape, apically polarized actin distribution,
unipolar budding, and delayed anaphase. The mutations are all
suppressed by CLB2 overexpression and are synthetically
lethal with a CLB2 deletion. However, defects in
multiple independent pathways may underlie their common phenotype,
because the mutations are scattered throughout the CDC28
sequence, complement each other, and confer diverse biochemical
properties. Glu12Gly, a mutation that alters a residue involved in
Swe1p inhibition of Cdc28p, was unique in being suppressed by
deficiency of SWE1 or CLN1. With
wild-type CDC28, filament formation induced by
CLN1 overexpression was markedly decreased in a
SWE1 deletion. These results suggest that Swe1p, via
inhibition of Clb2p/Cdc28p, may mediate much of the effect of Cln1p on
filamentous morphogenesis.
| |
INTRODUCTION |
|---|
|
|
|---|
From G1 exit to the completion of mitosis, the
growth of a yeast cell is limited to the bud (Lew et al.,
1997
). Delivery of cell wall components to the bud surface is under
close regulation during cell cycle progression (Lew and Reed, 1995
).
From bud emergence to the onset of mitosis, new cell wall is deposited
primarily at the bud tip, causing tubular growth. In mitosis, a switch
from apical to isotropic growth allows delivery of cell wall material over the entire bud surface, and the bud fattens to adopt a rugby-ball shape. The cyclin-dependent kinase Cdc28p not only maintains the order
of DNA replication and chromosome segregation but also regulates actin
localization (Lew and Reed, 1995
; Mendenhall and Hodge, 1998
; Pruyne
and Bretscher, 2000a
). Cell cycle regulation of cortical actin assembly
and the resulting control of localized secretion underlie bud
morphogenesis (Madden and Snyder, 1998
; Chant, 1999
; Pruyne and
Bretscher, 2000a
,b
). The G1 cyclins Cln1p and Cln2p activate Cdc28p to
promote S phase onset and restrict cortical actin to an apical
distribution, leading to polarized secretion and tubular growth. In
mitosis, the cyclins Clb1p and Clb2p activate Cdc28p to direct
chromosome segregation and to redistribute actin throughout the bud,
promoting isotropic growth until mitotic exit.
When activation of Cdc28p by Clb2p is slowed, both mitotic onset and
the apical-isotropic switch are delayed (Lew and Reed, 1993
).
CLB2-deletion cells display a pattern of mitotic delay, tubular bud shape, unipolar budding, and delayed cell separation (Surana et al., 1991
; Lew and Reed, 1993
; Sheu et
al., 2000
). A similar phenotype is conferred by overexpression of
Cln1p or Cln2p or by ectopic activation of the protein kinase Swe1p,
which provides inhibitory phosphorylation on Cdc28p Tyr19. This
response recapitulates the morphogenetic pattern of filamentous growth (Kron and Gow, 1995
), a developmental option in budding yeast that is
normally stimulated by nitrogen starvation (Gimeno et al.,
1992
). Indeed, mutations that delay the apical-isotropic switch
uniformly confer an enhanced filamentous growth phenotype. For example,
clb2 mutants exhibit dramatically enhanced filamentous growth (Ahn et al., 1999
; Edgington et al.,
1999
). In addition, overexpression of CLN1 (Oehlen and
Cross, 1998
; Loeb et al., 1999
), activation of Swe1p (Ahn
et al., 1999
; Edgington et al., 1999
), inactivation of the Mih1p phosphatase that antagonizes Swe1p (Ahn et al., 1999
), or loss of cell cycle-dependent expression of
CLB2 (Hollenhorst et al., 2000
; Zhu et
al., 2000
) all enhance filamentous differentiation. Directly
linking CDC28 to filamentous growth and the apical-isotropic
switch, the temperature-sensitive allele cdc28-1N
(Pro250Leu) confers persistently polarized cell shape, slow mitotic
progression, and constitutively enhanced filamentous growth at
permissive temperature (Surana et al., 1991
; Ahn et al., 1999
). A second mutant, cdc28-127 (Cys127Tyr), is
cold-sensitive, constitutively elongated (Blacketer et al.,
1995
; Edgington et al., 1999
), and has enhanced filamentous
growth. The defects in these mutants may derive from inadequate mitotic
activity of Cdc28p, because overexpression of CLB2
suppresses the enhanced polarity and blocks filamentous growth in both
the cdc28-1N and cdc28-127 mutants (Ahn et
al., 1999
; Edgington et al., 1999
).
Like cell cycle mutations, defects in actin cytoskeletal components,
bud site selection regulators, and other determinants of cell polarity
confer dramatic filamentous growth phenotypes (Gimeno et
al., 1992
; Mösch and Fink, 1997
; Cali et al.,
1998
). The sensitivity of filamentous growth to determinants of cell polarity and Cdc28p activity suggested that it would be a useful tool
for exploring links between cell cycle regulation and morphogenesis. We
hypothesized that screening a collection of CDC28 mutants
for constitutive filamentous growth might reveal alleles with specific defects in the apical-isotropic switch. We have isolated new
CDC28 alleles that enhance cell polarization without
affecting essential functions. The mutants share a constellation of
cell growth and cell polarity phenotypes. However, genetic analysis
suggests that these mutants do not identify a single pathway but
instead affect diverse functions of Cdc28p required for the
apical-isotropic switch and mitotic progression.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Strains, Media, and Molecular and Genetic Procedures
Yeast strains (Table 1) were
derived in the
1287b background (Grenson et al., 1966
;
Gimeno et al., 1992
). Genotypes were confirmed by marker
segregation, Southern blot, and/or polymerase chain reaction (PCR)
assay. Media and reagents were obtained from United States Biological
(Swampscott, MA), Fisher (Pittsburgh, PA), and Sigma (St. Louis,
MO) and were prepared as described by Ahn et al. (1999)
. YPG
contains 2% galactose and 2% raffinose.
|
Shuffle Mutagenesis of CDC28 and Screen for Enhanced Cell Polarity Mutants
A CDC28 deletion was constructed from pRD47 (kind
gift of R. Deshaies) by removing the coding sequences between an
NdeI site engineered at the initiation codon and an
HindIII site, leaving 51 carboxyl-terminal residues and
flanking regions. BglII linkers were added and a
BglII/BamHI TRP1 fragment was cloned
into the plasmid. The knockout construct was then excised with
PvuII and transformed into SKY723. The
XhoI/SpeI fragment of pRD47 cloned into the
SalI and XbaI sites of pCT3, a CEN
URA3 plasmid (kind gift of C. Thompson), was transformed into the
heterozygous cdc28::TRP1 diploid.
Trp+, 5-fluoro-orotic acid (5-FOA)-sensitive
meiotic segregants were mated to form SKY750, a diploid shuffle
mutagenesis strain. These segregants were crossed (e.g., to SKY772 for
the clb2
::LEU2 allele) or transformed and mated
to form other diploid shuffle strains. Wild-type CDC28 and
cdc28-1N were amplified with PCR primers, CDC28L,
GGAATAGAATTATCGTTCTCG, and CDC28R, GAGCAATGAATTTGCGGAGG, the
XhoI and MunI genomic sites were restricted, and
the fragment was ligated into SalI/EcoRI-digested
pRS413 (Sikorski and Hieter, 1989
). Inserts were confirmed by
sequencing. SKY750 transformed with pRS413-CDC28 or
pRS413-cdc28-1N was transferred to 5-FOA medium at 22°C to
evict pCT3-CDC28.
Error-prone PCR was used to construct a library of mutant
CDC28 genes. Thirty-five cycles of PCR were performed with 1 min of annealing at 55°C and 2 min of extension at 72°C using a
genomic DNA template, primers CDC28L and CDC28R, 50 µM
MnCl2, and 5% 2-mercaptoethanol, in four
reactions limiting dATP, dTTP, dCTP, or dGTP to 25 µM. The PCR
products were pooled, digested with XhoI/MunI,
ligated into SalI/EcoRI-digested pRS413, and
electroporated into Escherichia coli DH5
to recover
~106 clones, from which plasmid DNA was
prepared. SKY750 transformed with the mutant library was plated onto
5-FOA medium. When colonies were pooled, plated onto low-nitrogen
synthetic media, and incubated for 36 h at 30°C, nearly 0.5% of
the colonies displayed enhanced filamentous growth. When the
pRS413-cdc28 plasmids were recovered from 48 clones,
retransformed into SKY750, and plated on 5-FOA, 45 yielded colonies
with enhanced filamentous growth, of which 10 displayed a growth defect
at 37°C. The DNA sequences of the CDC28 open reading
frames (ORFs) were determined from the 35 non-ts CDC28
mutant candidates. Nine point mutants were selected for further
analysis; their sequences were confirmed, and they were designated the
cdc28ECP alleles. For further analysis, a
URA3-marked integrating plasmid carrying each
cdc28ECP allele was first constructed by
subcloning the insert from pRS413 into pRS306 (Sikorski and Hieter,
1989
). Haploid strains carrying the
cdc28ECP alleles at the CDC28
genomic locus were then constructed by transforming SKY2407 and SKY2415
with the pRS306-cdc28ECP plasmids after
digestion with HindIII, to direct integration and create a
tandem duplication of cdc28ECP and
cdc28-1N flanking URA3. After selection of
5-FOA-resistant segregants at 37°C, the CDC28 ORF was PCR
amplified and sequenced to confirm the presence of the
cdc28ECP allele and absence of the
cdc28-1N allele. The haploid
cdc28ECP integrants were backcrossed to
CDC28 wild-type strain SKY979 or SKY980, and the
cdc28ECP mutation was reconfirmed by
sequencing in each segregant used for further analysis.
Structural Modeling
Atomic models of Cdc28p were based on the crystallographic
structures of CDK2 in its inactive, dephosphorylated, and monomeric (De
Bondt et al., 1993
), active, phosphorylated and cyclin-bound (Russo et al., 1996b
), and active, phosphorylated, and
cyclin- and substrate-bound (Brown et al., 1999
) forms.
Monomeric and cyclin-bound models of Cdc28p were constructed manually
with Biosym Insight II Homology Modeling software and also by
subjecting the Cdc28p sequence to the SwissProt Modeling server after
initial threading with the SwissPDBViewer
(http://www.expasy.ch/spdbv/). When the Cdc28p models were compared,
C
traces of the Swiss and Biosym Cdc28p models based on 1FIN were
superimposable with an RMS deviation of 0.78 Å and varied from
the reference CDK2 structure by root mean square (RMS) values of 15.54 and 15.56 Å, respectively. These differences derive largely from
surface loops that include "inserted" residues in Cdc28p.
Phenotypic Analysis
Imaging of yeast colonies growing on agar in plastic Petri
dishes was performed with an Axiovert 25 (Zeiss, Oberkochen, Germany) with bright field illumination and a 32× LD Achroplan objective. Images were captured with a Pixera (Los Gatos, CA) Professional CCD camera at 1280 by 1024 resolution with Pixera VCS image acquisition software. Images were converted to gray scale, cropped, and assembled in Photoshop (Adobe Systems, Mountain View, CA). Analysis of cell elongation was performed at 22°C as described by Mösch and Fink (1997)
, with scores ranging from +/
(round) to ++++ (spindle shaped).
Staining of fixed cells with DAPI, Calcofluor, and rhodamine or
fluorescein phalloidin (Molecular Probes, Eugene, OR) and imaging were
as described by Ahn et al. (1999)
. Polarization of actin in
budded cells was scored based on the distribution of cortical actin
patches as apical, isotropic, septal, or intermediate/indeterminate. For flow cytometry, yeast cells at 22°C were stained with propidium iodide and analyzed as described previously (Ahn et al.,
1999
). The G2/G1 ratio was determined from the ratio of the percentages of cells in two fluorescence intensity (FL-2) gates that included the
majority of cells with G1 or G2/M DNA contents, respectively. To test
sensitivity to mating pheromone, log-phase cultures were spread onto
YPD medium onto which were then placed 1-cm-diameter glass fiber
filters saturated with 10 µl of 3 mM
-factor in dimethyl sulfoxide. The diameters of cleared halos were measured after 2 d
at 22°C.
Molecular and Biochemical Assays
For Northern analyses, 20-µg samples of total cellular RNA
were separated on 1% agarose-formaldehyde gels and transferred to
Nytran membranes (Schleicher & Schuell, Keene, NH). Probes for
ACT1. CDC28, CLB2, CLN2, and
CLN1 were labeled by PCR performed with
[32P] dATP using the ORFs as templates.
Whole-cell extracts were prepared and subjected to Western analysis as
described before (Ahn et al., 1999
). Yeast extracts were
assayed for p13suc1-associated and
Clb2p-associated Cdc28p histone H1 kinase activity by a
modification of published methods (Surana et al., 1991
; Amon et al., 1994
). 32P labeling of histone
H1 was detected by phosphorimager analysis (Molecular Dynamics,
Sunnyvale, CA) of SDS-PAGE gels. Quantitation of band intensity with
Imagequant (Molecular Dynamics) and IPLab (Scanalytics, Billerica, MA)
showed that both kinase activities were specific and linear with
respect to extract and incubation. H1 kinase activity that
immunoprecipitated from wild-type cell lysate by anti-Clb2p antibody
was completely absent from the clb2
::LEU2 mutant, confirming the specificity of this assay (Ahn, Tobe, Fitz Gerald, Anderson, Acurio, and Kron, unpublished results). For the
two-hybrid analysis, the CDC28 ORF was amplified from
genomic DNA with primers CCTGAATTCATGAGCGGTGAATTAGC
and GTGGTCGACTAATG CTTATGATTCTTGG, and the in-frame
EcoRI and SalI (indicated in bold) restriction
sites were used to clone CDC28 into the two-hybrid vectors
pEG202 and pJG4-5 (Golemis et al., 1999
).
pEG202-CDC28 complements a cdc28 shuffle strain,
and pJG4-5-CDC28 complements cdc28-4 and
cdc28-1N. Plasmids were transformed into yeast strain EGY48
(James et al., 1996
), and the transformants were examined for growth on selective media. Primers CGCGGATCCATGAGA TCTAGCGTGAATTAGCAAATTACAAAAGA and GTAATACGACTCACTATAGGGC were used to
amplify the CDC28 ORF from a genomic clone. BamHI
and PstI were then used to clone CDC28 into the
GBDU-C1 and GAD-C1 two-hybrid vectors (James et al., 1996
).
Both complement cdc28-4 and cdc28-1N.
GBDU-C1-CDC28 and GAD-C1-CDC28 were transformed into yeast strain pJ69-4
(James et al., 1996
).
Transformants were examined on selective medium to detect possible
interactions. For coimmunoprecipitation analysis, extracts from strain
L5977 carrying pEG202-CDC28 and pJG4-5-CDC28
were analyzed by immunoprecipitation with 12-CA5 anti-hemagglutinin
(HA) antibody (Roche, Gipf-Oberfrick, Switzerland), SDS-PAGE, and
transfer to a polyvinylidene difluoride membrane. With the use of
standard procedures, the blots were blocked, incubated with 16 B12
anti-HA (Berkeley Antibody, Berkeley, CA) or anti-LexA (Golemis
et al., 1999
) antibody, probed with sheep
anti-mouse-immunoglobulin (Ig)-horseradish peroxidase (HRP) conjugate
(Amersham, Arlington Heights, IL) or donkey anti-rabbit- Ig-HRP
conjugate (Amersham), respectively, and developed with enhanced
chemiluminescence as described by the manufacturer (Pierce, Rockford,
IL). In a separate experiment, the CDC28,
cdc28-E12K (kind gift of D. Lew), and cdc28-E12G
ORFs were cloned into the pEG202 vector. Each plasmid was transformed
into a strain homozygous for Myc-tagged SWE1 (SKY2671).
Incubation of extracts prepared from these strains with protein
A-Sepharose beads was followed by immunoprecipitation with 9E10 anti-HA
(Berkeley Antibody, Berkeley, CA), SDS-PAGE, and transfer to a
nitrocellulose membrane. The blots were blocked, incubated with 1:1000
A14 anti-MYC antibody (Santa Cruz) or 1:5000 anti-LexA (gift of E. Golemis) antibody, probed with donkey anti-rabbit-Ig-HRP conjugate
(Amersham), and developed with the use of enhanced chemiluminescence.
| |
RESULTS |
|---|
|
|
|---|
New CDC28 Point Mutations That Promote Polar Bud Growth
To investigate the role of the cyclin-dependent kinase in
polarized morphogenesis, we mutagenized CDC28 and screened
for altered filamentous growth in a
1278b background (see MATERIALS
AND METHODS). We isolated nine point mutations in CDC28 that
confer enhanced filamentation in otherwise wild-type cells (Figure
1). Like cdc28-1N or
clb2
::LEU2 (Ahn et al., 1999
), the
cdc28ECP mutant diploids display a high
proportion of highly elongated buds and other markers of enhanced cell
polarity. Whereas budded wild-type cells score +/
(round) in a visual
cell elongation assay and display ~40% apically polarized actin
distribution, cdc28-1N and
clb2
::LEU2 each score ++++ (spindle shaped) and display 83 and 82% polar actin, respectively. In the same assays, each
cdc28ECP mutant scored ++++ and displayed
71-81% apical polar actin distribution. By contrast to wild-type,
very few of the remaining cells displayed actin patches distributed
over the bud cortex. In addition, like cdc28-1N and
clb2
::LEU2 (Ahn et al., 1999
), the
mutants perform unipolar budding, with the majority of mother cells
displaying all bud scars localized to the same pole as the bud.
|
Like cdc28-1N, the mutants remain filamentous even on rich
medium and do not require an intact Ras-signaling pathway (Gimeno et al., 1992
), because all retain their phenotypes in a
RAS2-deficient shuffle strain (Ahn, Tobe, Fitz Gerald,
Anderson, Acurio, and Kron, unpublished results). However, by
comparison to cdc28-1N, the defects are relatively specific
to morphogenesis. The cdc28ECP mutants grow
well at 14, 22, 30, and 37°C and they are similar to wild type in
sensitivity to
-mating pheromone, as measured by halo assay; growth
on plates containing 200 mM hydroxyurea, 1 M NaCl, or 12 µg/ml
benomyl; and recovery from 25 mJ/cm2 254-nm UV irradiation.
The Enhanced Cell Polarity Mutations Alter Structurally Distinct Residues
The cdc28ECP mutations are scattered
throughout the primary sequence. Mutated residues include kinase
consensus sites considered important for catalysis and
CDK-specific residues shown to participate in regulation (Figure
2A). To gain further insight into the
likely structural consequences of the mutations, we derived atomic
models of Cdc28p from crystal structures of human CDK2 (Figure 2B). The models share a small amino-terminal domain composed primarily of
-sheet that includes Hanks domains I to III and a large
-helical carboxyl-terminal domain formed from subdomains VI through XI. The
catalytic core, Hanks subdomains IV and V, forms a hinge between the
two domains. Placing the cdc28ECP
mutations onto the models revealed that seven of the nine residues are
exposed on the solvent-accessible surface.
|
Based on this modeling, the Glu89, Ala55, and Ile59 side chains should
directly contact cyclin. Rotation of the PSTAIRE helix upon cyclin
binding moves the catalytic residue Glu51 into the active site and
exposes hydrophobic residues including Ala55 and Ile59 at the
CDK/cyclin interface (Figure 2C). The Ala55Thr or Ile59Asn substitution
may stabilize the monomer and/or disrupt Van der Waals interactions
with cyclin partners. Similarly, Glu89Lys may restrict mobility of the
amino-terminal domain during cyclin binding and/or alter specificity
toward cyclin partners. Based on Cdc28p modeled with bound ATP and
peptide substrate (Figure 2D), Glu12, Val21, and Leu137 may influence
kinase activity and/or interactions with substrates or binding
partners. Glu12 and Val21 lie above the active site in the
amino-terminal domain. In CDK2 and CDK6, the corresponding residues
contact stoichiometric inhibitors (Russo et al., 1996a
,
1998
). Leu137 sits below the T loop. The additional methyl group in
Leu137Ile may affect substrate contacts directly or by displacing
neighboring residues such as Ser197. Phe116, Ile221, and Phe202 are all
hydrophobic residues in the carboxyl-terminal domain (Figure 2B). In
both inactive and cyclin-bound conformations, these side chains are
predicted to be partially or completely buried at sites distant from
known CDK protein-protein interaction surfaces.
Cell Cycle and Biochemical Defects in cdc28ECP Mutants
Flow cytometry of cdc28ECP mutant
diploids revealed a shift toward 4N DNA content equivalent to that of a
clb2
::LEU2/clb2
::LEU2 mutant
(Figure 3A). Moreover, disproportionately
many large-budded cdc28ECP cells contain a
single round or oblong nucleus at or near the bud neck (>75% for
mutant, 35% for wild-type), consistent with a preanaphase delay. To
test for altered expression or stability of the
cdc28ECP mutant proteins or cyclins, we
performed Northern and Western analyses. Expression analysis of
CDC28, CLB2, and CLN2 in comparison to
ACT1 in log-phase cultures revealed little or no change in the abundance of CDC28 or cyclin message (Figure 3B). In
turn, Western analysis revealed amounts of Cdc28p and Clb2p comparable to those in wild type in each cdc28ECP
mutant (Figure 3C). To test whether the
cdc28ECP mutant proteins are specifically
defective in activation by the Clb2p cyclin, we compared their
Clb2p-associated H1 kinase activity to total
p13Suc1-associated H1 kinase activity. Whole-cell
lysates from cdc28-1N, cdc28-4, and the
cdc28efg alleles were analyzed similarly
(Figure 3D). As previously reported for W303-related strains (Surana
et al., 1991
), wild-type, cdc28-1N, and
cdc28-4 strains yielded high Clb2p-/high
p13Suc1-, high Clb2p-/high
p13Suc1-, and low Clb2p-/low
p13Suc1-associated kinase activities,
respectively, in the
1278b background. In contrast, the
cdc28ECP alleles yielded several different
patterns of activity. None appeared to be profoundly catalytically
defective, like cdc28-4. Val21Glu expressed activities
indistinguishable from those in wild type, and two mutants, Ala55Thr
and Phe202Tyr, appeared to have enhanced in vitro activities. Leu137Ile
and Phe116Leu yielded low Clb2p-associated kinase activities but
retained proportionately higher
p13Suc1-associated kinase activities. Only one
allele, Ile59Asn, yielded a markedly decreased
p13Suc1-associated kinase activity, but this
mutant expressed a near-wild-type level of Clb2p-associated activity.
|
The cdc28ECP Mutants Define Multiple Complementation Groups Modulating Cell Morphogenesis
When haploids carrying the cdc28ECP
alleles were mated to wild type, the
cdc28ECP phenotypes were almost completely
recessive (Figure 4, top row; Table
2). In turn, pairs of haploids carrying
the same cdc28ECP allele yielded
homozygous diploids indistinguishable from the original shuffle strain
carrying the plasmid-borne allele (Figure 4). We then tested for
possible interallelic complementation. Although heteroallelic
combinations of Ala55Thr and Ile59Asn yielded highly polarized cells
(Figure 4), indicating noncomplementation, other pairs of alleles
displayed complementation for the enhanced cell polarity and G2/M-shift
phenotypes (Figure 4; Table 2). This pattern of complementation
suggested that Cdc28p might function as a dimer as had been observed
for Cdc7p (Shellman et al., 1998
). To test this possibility,
the CDC28 ORF was cloned into bait-and-prey yeast two-hybrid
expression vectors in each of two experimental systems. Both the
bait-and-prey constructs complemented the essential functions of
CDC28 in
1278b strains. However, when coexpressed in the
appropriate strains, unlike Cdc7p, no interaction was observed as
assayed by growth on selective media (Ahn, Tobe, Fitz Gerald, Anderson,
Acurio, and Kron, unpublished results). Moreover, no coimmunoprecipitation of an amino-terminal LexA DNA-binding domain Cdc28p fusion with a carboxyl-terminal HA epitope-tagged Cdc28p was
detected when they were coexpressed in strain
1278b (Ahn, Tobe, Fitz
Gerald, Anderson, Acurio, and Kron, unpublished results).
|
|
Genetic Interactions Of Cdc28ECP Alleles with Mitotic Cyclins
The morphogenetic and cell cycle phenotypes are consistent with
the cdc28ECP alleles being deficient in
functions of Cdc28p directed by Clb mitotic cyclins. To explore this
possibility further, we constructed diploid shuffle strains carrying a
GAL1 promoter fused to the CLB1, 2, 3, 4, or 5 gene (Stueland et al., 1993
) or
carrying a homozygous deletion of CLB1, 2, 3, 4, 5, or 6. Inducing GAL-CLB1 or
GAL-CLB2 completely suppressed the cell elongation phenotype of the cdc28ECP alleles (Figure
5A, top 2 rows; Table
3; Ahn, Tobe, Fitz Gerald, Anderson,
Acurio, and Kron, unpublished results), but little or no suppression
was observed in strains carrying GAL-CLB3,
GAL-CLB4, or GAL-CLB5. In addition, expression in
a CLB1-deficient shuffle strain or in strains deficient for
CLB5 and CLB6 or CLB3 and
CLB4 did not markedly affect the
cdc28ECP phenotypes (Ahn, Tobe, Fitz
Gerald, Anderson, Acurio, and Kron, unpublished results). However, a
marked synthetic enhancement or synthetic lethality was observed in a
CLB2 mutant shuffle strain (Table 3). Segregants presumed to
carry a cdc28ECP allele in a
clb2
::LEU2/clb2
::LEU2 shuffle
strain isolated from 5-FOA and transferred to rich medium at 22°C
grew only as abortive microcolonies of highly elongated cells. We used
the integrated cdc28ECP alleles to confirm
this result in a standard cross to a clb2
::LEU2 mutant. Viable meiotic segregants carrying both
clb2
::LEU2 and cdc28-1N, Val21Asp,
Ala55Thr, Ile59Asn, Phe116Leu, Leu137Ile, Phe202Tyr, or Ile221Thr were
not recovered. Glu12Gly clb2
::LEU2 double
mutants were slow growing, whereas Glu89Lys
clb2
::LEU2 haploid cells demonstrated little
growth defect. However, both Glu12Gly/Glu12Gly
clb2
::LEU2/clb2
::LEU2 and
Glu89Lys/Glu89Lys clb2
::LEU2/clb2
::LEU2 diploids
could form only abortive microcolonies of highly elongated cells.
|
|
Interactions of cdc28ECP Alleles with Mitotic Antagonists
Using additional diploid shuffle strains, we also tested the
effects of modulating negative regulators of Clb2p/Cdc28p on polarized
morphogenesis in cdc28ECP mutants. Results
ranged from a SIC1-deficient strain that had only subtle
effects on morphogenesis to CLN3 deficiency, which conferred
a complex pattern of suppression (Table 3; Ahn, Tobe, Fitz Gerald,
Anderson, Acurio, and Kron, unpublished observations). Strikingly,
genetic interactions with CLN1 and SWE1 were
limited to a single mutant, Glu12Gly (Figure 5A, bottom four rows;
Table 3): Induction of GAL-CLN1 markedly enhanced the
polarity of this mutant, whereas CLN1 or SWE1
deficiency suppressed its elongation. Glu12Gly might sensitize
Clb2p/Cdc28p to the antagonistic effects of Cln1p and Swe1p
independently or via a single pathway. A related mutant, Glu12Lys, has
been shown to resist the inhibitory effects of Swe1p, perhaps by
altered Cdc28p-Swe1p interaction (McMillan et al., 1999
).
Thus, we examined whether Cdc28p-Glu12Gly, Cdc28p-Glu12Lys, or
wild-type Cdc28 may interact differently with Swe1p through a
coimmunoprecipitation test. Similar interaction of Swe1p-13Myc with
LexA-Cdc28p-Glu12Gly, LexA-Cdc28p-Glu12Lys, and LexA-Cdc28p was
detected (Ahn, Tobe, Fitz Gerald, Anderson, Acurio, and Kron, unpublished results). Therefore, the importance of Swe1p in mediating the hyperfilamentous growth induced by Cdc28p-Glu12Gly may involve a
direct or indirect mechanism. Next, we investigated the link to Cln1p.
To establish the order of function, we examined the effects of
GAL-CLN1 and GAL-CLN2 on cell polarity in
SWE1- and MIH1-deficient strains carrying
wild-type CDC28 (Figure 5B; Ahn, Tobe, Fitz Gerald,
Anderson, Acurio, and Kron, unpublished observations). Whereas
GAL-CLN1 and GAL-CLN2 strongly enhanced polarized
morphogenesis in the wild-type strain and in the mih1 mutant
diploid, this effect was attenuated in the swe1 mutant,
suggesting that CLN1 is upstream of SWE1 in a
pathway to CDC28.
| |
DISCUSSION |
|---|
|
|
|---|
Multiple Functions of Cdc28p affecting Mitotic Progression and Polarized Morphogenesis
We used filamentous growth as a sensitive reporter of cell polarity to investigate the regulation of bud morphogenesis by the cyclin-dependent kinase Cdc28p. We isolated mutations in CDC28 that confer constitutively enhanced cell polarity (cdc28ECP) without critically affecting essential functions of the kinase. All of the mutants are characterized by apically polarized actin distribution, unipolar bud-site selection, and tube-like bud growth. These phenotypes are associated with a shift in cell cycle kinetics toward G2/M. This pattern is a close phenocopy of a deletion of the CLB2 mitotic cyclin gene. Indeed, the cdc28ECP phenotypes are suppressed by overexpression of CLB2. However, each cdc28ECP mutation is also synthetically lethal with a deletion of CLB2, indicating that the defects extend beyond a deficit in Clb2p-dependent Cdc28p activity per se. This pattern of morphogenetic phenotypes and genetic interactions is also like that of the well described mutant cdc28-1N, a ts allele with critical defects in mitotic progression. Based on the growth phenotypes of the mutants and their interactions with CLB2, a conservative hypothesis would be that the cdc28ECP mutations are each functionally equivalent to cdc28-1N, although they are weaker alleles that do not confer temperature sensitivity. However, our other genetic data suggest that the cdc28ECP alleles are fundamentally distinct from cdc28-1N and each other.
First, rather than identifying a single domain of Cdc28p, such as the
Cks1p-binding site disturbed by the Pro250Leu mutation in
cdc28-1N, the cdc28ECP
mutations are scattered along the amino acid sequence and predicted to
alter spatially distinct surfaces of the Cdc28p molecule. Certainly, residues distributed over the molecular surface might collaborate in a
single process. Cyclins, via their binding to Cdc28p and the resulting
conformational change, reorganize the catalytic site and recruit Cdc28p
to particular substrates. By this reasoning, the structurally diverse
cdc28ECP mutations might all disrupt
functions of cyclins or other regulators. A genetic test of this model
is to examine cells carrying combinations of mutations for their cell
polarity and cell cycle phenotypes. Noncomplementation would strongly
suggest a single pathway involving the two sites on the molecular
surface. However, to our surprise, cells carrying nearly all the
combinations of mutations exhibited a return to nearly normal cell
shape and cell cycle parameters. These results favor a second model in
which multiple independent activities of Cdc28p modulate cell polarity
and mitotic progression. A single case of noncomplementation was
observed, between Ala55Thr and Ile59Asn. The side chains of these two
highly conserved residues lie adjacent to each other on the
solvent-exposed surface of the PSTAIRE helix. Both residues are likely
to participate in a hydrophobic interaction with cyclins. In the
CDK2/cyclin A structure (Russo et al., 1996b
), the Ala and
Ile side chains form walls of a pocket occupied by the benzene ring of
a Phe on the surface of cyclin A. Modeling suggests that the
structurally equivalent residue is also a Phe in Clb2p but a Tyr in
Cln1p (Ahn, Tobe, Fitz Gerald, Anderson, Acurio, and Kron, unpublished results).
Alternatively, the observed pattern of interallelic complementation
might derive from a mechanism other than the disruption of multiple
independent functions. In particular, one explanation may be that
Cdc28p functions as a dimer. In this case, the ability of two different
alleles to form dimers may be the determinant of complementation.
Interallelic complementation based on dimerization has been
observed with Cdc7p (Shellman et al., 1998
). However, our
two-hybrid and coimmunoprecipitation tests were unable to detect
interaction between Cdc28p monomers. Results consistent with monomeric
Cdc28p being the physiologically active form have also been obtained by
Sclafani and colleagues (Shellman, 1997
). Thus, Cdc28p dimerization is
not likely to underlie the pattern of interallelic complementation
among the cdc28ECP mutants.
Thus, a picture of Cdc28p emerges as a polypeptide that via its
multiple individual and combinatorial interactions with regulators and
substrates performs a wide range of functions each independently required for mitotic progression. A similarly complex view of a
conserved, globular protein with significant conformational flexibility
has emerged from alanine-scanning mutagenesis of Act1 (Amberg et
al., 1995
; Cali et al., 1998
). Based on this paradigm, the cdc28ECP complementation groups may
reflect defects in binding various specific Cdc28p partners. Clearly,
defining these partners will be of great interest.
Linking Cln1p and Swe1p-dependent Modulation of Polarity
Significantly, our studies suggest that the activities of Cln1p
and Swe1p as morphogenetic regulators may be mediated through a single
pathway. The enhanced cell polarity of one mutant, Glu12Gly, was
markedly suppressed by deletion of SWE1. Via a Glu12Lys
mutation that confers Swe1p resistance, the Glu12 residue was shown to be involved in Swe1p inhibition of Cdc28p activity (McMillan et al., 1999
). Much like the nonphosphorylatable CDC28
allele Thr18Ala, Tyr19Phe (Ahn et al., 1999
), Glu12Lys does
not abrogate low-nitrogen or STE11-4-induced filamentous
growth but confers resistance to GAL-SWE1 (Ahn, Tobe, Fitz
Gerald, Anderson, Acurio, and Kron, unpublished results). Combined with
the data of McMillan et al. (1999)
, our results suggest that
much or all of the hyperpolarized phenotype of the Glu12Gly strain
might derive from altered binding and/or phosphorylation of Cdc28p by
Swe1p. Nonetheless, an indirect role for Swe1p in the Glu12Gly
phenotype cannot be ruled out. With the use of a simple
coimmunoprecipitation assay, we were unable to detect a difference in
association between Swe1p and wild-type Cdc28p or Glu12Gly-mutant
Cdc28p; nor did we observe lack of association of Swe1p with
Glu12Lys-mutant Cdc28p.
In further analyzing the Glu12Gly mutation, we made the surprising
observation that hyperpolarization in Glu12Gly cells is abrogated in a
CLN1-deficient mutant and markedly enhanced by CLN1 overexpression. Similar effects were not observed with
any other cdc28ECP allele. Rather than
invoking direct regulation of cell polarization or filamentous growth
by CLN1, we infer that the effects of Cln1p may be mediated
by Swe1p-dependent down-regulation of Clb2p/Cdc28p. We tested this
model directly by introducing GAL-CLN1 and
GAL-CLN2 into a swe1
background. Unlike the
markedly filamentous and hyperpolarized phenotype on galactose media of
a wild-type strain carrying GAL-CLN1 or GAL-CLN2,
these cells remain similarly nonpolarized on glucose or galactose
media. These results implicate negative regulation of Cdc28p by Swe1p
as the relevant determinant of response to Cln1p dose and suggest a
model for cell cycle control of the apical-isotropic switch (Figure
6). Here, Cln1p/Cdc28p complexes promote
apical growth from G1 exit to mitotic onset via Swe1p-dependent
inhibition of Clb2p/Cdc28p complexes. During mitosis, a combination of
destruction of Cln1p and Swe1p, accumulation of Clb2p, and activation
of Mih1p may release sufficient active Clb2p/Cdc28p to phosphorylate
cytoskeletal targets and flip the switch to isotropic growth. This
model offers a simple and attractive alternative to competitive
regulation of cytoskeletal targets by Cln and Clb cyclins during S
phase and G2. Further work to establish a biochemical pathway from
Cln1p/Cdc28p to Clb2p/Cdc28p via Swe1p may provide insights regarding
Swe1p regulation in normal growth and Swe1p activation in the
morphogenesis checkpoint. In turn, placing Cln1p, Swe1p, and Clb2p in a
single linear pathway reconciles previously incompatible models that propose each regulator as an independent determinant of filamentous growth.
|
| |
ACKNOWLEDGMENTS |
|---|
The authors wish to thank A. Amon, R. Deschaies, G. Fink, E. Golemis, P. James, D. Lew, H. Liu, A. Myers, S. Reed, P. Sorger, R. Sclafani, and the present and former members of the Kron and Fink laboratories for generously sharing reagents, unpublished results, enthusiasm, and advice. S.J.K. acknowledges his postdoctoral mentor, Dr. Gerald R. Fink, for generous support at the initiation of this project. B.T.T. is a trainee of the National Institutes of Health Medical Scientist Training Program. These studies were supported by the Arnold and Mabel Beckman Foundation, the Cancer Research Foundation, a Howard Hughes Medical Institute Research Resources for Medical Schools award, and National Science Foundation CAREER grant MCB9875976 to S.J.K.
| |
FOOTNOTES |
|---|
§ Corresponding author. E-mail address: skron{at}midway.uchicago.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Clemente-Blanco, A. Gonzalez-Novo, F. Machin, D. Caballero-Lima, L. Aragon, M. Sanchez, C. R. V. de Aldana, J. Jimenez, and J. Correa-Bordes The Cdc14p phosphatase affects late cell-cycle events and morphogenesis in Candida albicans J. Cell Sci., March 15, 2006; 119(6): 1130 - 1143. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Bensen, A. Clemente-Blanco, K. R. Finley, J. Correa-Bordes, and J. Berman The Mitotic Cyclins Clb2p and Clb4p Affect Morphogenesis in Candida albicans Mol. Biol. Cell, July 1, 2005; 16(7): 3387 - 3400. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. van Dyk, I. S. Pretorius, and F. F. Bauer Mss11p Is a Central Element of the Regulatory Network That Controls FLO11 Expression and Invasive Growth in Saccharomyces cerevisiae Genetics, January 1, 2005; 169(1): 91 - 106. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Pruyne, L. Gao, E. Bi, and A. Bretscher Stable and Dynamic Axes of Polarity Use Distinct Formin Isoforms in Budding Yeast Mol. Biol. Cell, November 1, 2004; 15(11): 4971 - 4989. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Queralt and J. C. Igual Functional Distinction Between Cln1p and Cln2p Cyclins in the Control of the Saccharomyces cerevisiae Mitotic Cycle Genetics, September 1, 2004; 168(1): 129 - 140. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Grandin and M. Charbonneau Mitotic Cyclins Regulate Telomeric Recombination in Telomerase-Deficient Yeast Cells Mol. Cell. Biol., December 15, 2003; 23(24): 9162 - 9177. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. G. Toby, W. Gherraby, T. R. Coleman, and E. A. Golemis A Novel RING Finger Protein, Human Enhancer of Invasion 10, Alters Mitotic Progression through Regulation of Cyclin B Levels Mol. Cell. Biol., March 15, 2003; 23(6): 2109 - 2122. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Rives and T. Galitski Modular organization of cellular networks PNAS, February 4, 2003; 100(3): 1128 - 1133. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Cid, J. Jimenez, M. Molina, M. Sanchez, C. Nombela, and J. W. Thorner Orchestrating the cell cycle in yeast: sequential localization of key mitotic regulators at the spindle pole and the bud neck Microbiology, September 1, 2002; 148(9): 2647 - 2659. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||