![]() |
|
|
Vol. 12, Issue 12, 3733-3743, December 2001
and
§
*Department of Energy Plant Research Laboratory, Michigan State
University, East Lansing, Michigan 48824-1312; and
Department of Biochemistry, Michigan State University,
East Lansing, Michigan 48824-1319
| |
ABSTRACT |
|---|
|
|
|---|
The syntaxin family of soluble N-ethyl maleimide sensitive factor adaptor protein receptors (SNAREs) is known to play an important role in the fusion of transport vesicles with specific organelles. Twenty-four syntaxins are encoded in the genome of the model plant Arabidopsis thaliana. These 24 genes are found in 10 gene families and have been reclassified as syntaxins of plants (SYPs). Some of these gene families have been previously characterized, with the SYP2-type syntaxins being found in the prevacuolar compartment (PVC) and the SYP4-type syntaxins on the trans-Golgi network (TGN). Here we report on two previously uncharacterized syntaxin groups. The SYP5 group is encoded by a two-member gene family, whereas SYP61 is a single gene. Both types of syntaxins are localized to multiple compartments of the endomembrane system, including the TGN and the PVC. These two groups of syntaxins form SNARE complexes with each other, and with other Arabidopsis SNAREs. On the TGN, SYP61 forms complexes with the SNARE VTI12 and either SYP41 or SYP42. SYP51 and SYP61 interact with each other and with VTI12, most likely also on the TGN. On the PVC, a SYP5-type syntaxin interacts specifically with a SYP2-type syntaxin, as well as the SNARE VTI11, forming a SNARE complex likely involved in TGN-to-PVC trafficking.
| |
INTRODUCTION |
|---|
|
|
|---|
Vesicle trafficking is an essential function in all eukaryotic
cells (reviewed in Sanderfoot and Raikhel, 1999
). The formation, targeting, and fusion of a transport vesicle with its correct target
membrane are required for movement of cargo between the various
endomembrane organelles, as well as for recovery of proteins that have
escaped their resident organelle. A class of proteins called syntaxins
is required on the target membrane for selection and fusion of
vesicles. Syntaxins are a part of a larger structural group of proteins
called soluble N-ethyl malemide sensitive factor adaptor
protein receptors (SNAREs), all of which are membrane proteins that
contain a conserved coiled-coil domain (called a SNARE helix) proximal
to a C-terminal transmembrane domain or lipid anchor. The function of
the SNAREs in membrane fusion has been recently made clear in a series
of articles (Fukuda et al., 2000
; McNew et al.,
2000
; Parlati et al., 2000
). Syntaxins are involved in
recognizing and complexing with one or two other SNAREs on the target
membrane creating a three-helix bundle called the t-SNARE complex. This
tertiary complex is then primed to recognize a fourth helix derived
from a v-SNARE, which resides on the vesicle membrane. The creation of
the four-helix bundle, called a trans-SNARE complex or
"SNAREpin," leads eventually to vesicle fusion with the target
membrane and delivery of the cargo into the lumen or limiting membrane
of a particular organelle.
Analysis of the genome of the model plant Arabidopsis
thaliana (The Arabidopsis Genome Initiative, 2000
) revealed 24 genes that encoded members of the syntaxin family, each recently being reclassified with the name "syntaxin of plants" or SYP (Sanderfoot et al., 2000
). These 24 genes comprise 10 gene families that
each contain one to five members (Sanderfoot et al., 2000
).
The presence of the gene families does not necessarily indicate genetic
redundancy, because gene disruptions of single members of three gene
families lead to a lethal phenotype. The knolle mutation (in
the SYP111 gene) results in a seedling lethal phenotype
(Lukowitz et al. 1996
) despite the presence of a second gene
in the SYP11 gene family. Disruption of either
SYP21 or SYP22 in the three member SYP2 gene family results in lethality at the gametophytic
stage; a similar phenotype occurs within the SYP4 gene
family when either SYP41 or SYP42 is disrupted
(Sanderfoot et al., 2001
). These results indicate that each
syntaxin has unique essential functions, despite the fact that a high
degree of sequence homology exists within a particular gene family.
Distinct types of syntaxins are found resident on the various membranes
of the secretory pathway. The Arabidopsis syntaxins that have been
characterized appear to be distributed similar to their yeast or
mammalian orthologs upon the endomembrane compartments of the plant
cell. The Arabidopsis SYP2-type syntaxins SYP21 and SYP22 are both
found on the prevacuolar compartment (PVC; Conceição et al., 1997
; Sanderfoot et al., 1998
, 1999
),
although others have reported that SYP22 may be found on the tonoplast
in the shoot apical meristem (Sato et al., 1997
). This
localization is consistent with the PVC or endosomal localization of
the SYP2-type orthologs from yeast (Pep12p; Becherer et al.,
1996
) and mammals (syntaxins 7 and 13; Prekeris et al.,
1999
). Similarly, the Arabidopsis SYP4-type syntaxins and their
orthologs from yeast (Tlg2p) and mammals (syntaxin 16) have all been
localized to the trans-Golgi network (TGN) (Holthuis
et al., 1998
; Simonsen et al., 1998
; Bassham et al., 2000
). Interestingly, the two most divergent members
(SYP41 and SYP42) are found on distinct domains of the TGN (Bassham
et al., 2000
), suggesting distinct functions for each in
vesicle trafficking at the plant TGN.
To further our studies on vesicle trafficking, we have begun to characterize syntaxin gene families that may have roles in the late secretory/endosomal system of Arabidopsis cells. Here, we report that both SYP51 and SYP61 are found on multiple organelles in the late secretory system, and interact with other syntaxins and SNAREs of the VTI1-type. On the TGN, SYP61 forms separate complexes with the SNARE VTI12 and either SYP41 or SYP42, as well as a distinct complex with SYP51 and a member of the VTI1-type SNAREs. SYP5-type syntaxins show an interaction with SYP2-type syntaxins on the PVC. In addition, because both SYP21 and SYP51 interact with the SNARE VTI11, we propose that these three proteins are part of a SNARE complex on the PVC involved in TGN-to-PVC trafficking.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning of New Arabidopsis SYP Genes
A recent examination of the completed genome sequence of
Arabidopsis thaliana revealed 24 syntaxins representing 10 gene families and 8 sequence-homology groups (Sanderfoot et
al., 2000
). Three of the gene families were most homologous to the
yeast syntaxin Tlg1p and were further examined. The SYP5
gene family was represented by two genes, SYP51 (identified
as open reading frame [ORF] F3O9.4, At1g15930; The Arabidopsis Genome
Initiative, 2000
) and SYP52 (F20B17.2, At1g73260), each of
which was represented by expressed sequence tags (ESTs), although none
the ESTs for SYP52 were full length. A full-length clone of
SYP52 was acquired from a cDNA library. The SYP6
gene family was represented by a single gene, SYP61 (F3
M18.7, At1g27550). No full-length EST was found for this gene, so the
ORF was acquired by reverse transcriptase-polymerase chain reaction
(RT-PCR) with the use of specific primers (61NdeF: CATATGTTCTCAGCTCAAGATCCATTC; 61SacIR:
GAGCTCTGTTCTTTAGGTCAAGAAGAC). The SYP7 family
was represented by three genes: SYP71 (F11F8.33, At3g09740),
SYP72 (F18N11.40, At3g45280), and SYP73
(F2A19.50, At3g61450). The full-length cDNA of SYP71 was
acquired from an EST, whereas the other two members of this gene family
were acquired by RT-PCR with the use of gene-specific primers (72F:
GAGACATTCCACAAGAAGAAGAAGAAG; 72R: CCAGAAGAATTTCGGAGTGGGACATC; 73F:
CCTGAAAAAAACCTTTCGTCGGAGAAATCT; 73R: GTGTAATGTAAATGACAGGCATCACCA). The
full sequence of each cDNA clone was determined at the Michigan State
University Sequencing Center (East Lansing, MI). The sequences of each
of these SYPs have been deposited in GenBank under the following
accession numbers: SYP51, AF355755; SYP52, AF355756; SYP61, AF355754;
SYP71, AF355757; SYP72, AF355758; and SYP73, AF355759.
To examine the expression pattern of the SYP genes, total
RNA was extracted from various tissues of Arabidopsis (roots, stems, leaves, flowers, siliques, and total seedlings). Equal amounts of total
RNA were reverse transcribed with the use of oligo-dT as a primer under
a manufacturer's protocol (Invitrogen, Carlsbad, CA). These
cDNAs were subsequently used in PCR with gene-specific primers for each
of the Arabidopsis SYP genes. The PCR products were separated by
agarose gels and the amount of the appropriate sized product visually
quantified. Total genomic DNA was used as a control for the specificity
and fidelity of the primers, and products were also sequenced to
confirm amplification. As a control, the pattern of SYP21
and SYP22 expression seen by RT-PCR matched that seen
previously by Northern analysis (Bassham et al., 1995
; Sato
et al., 1997
), suggesting that this method was adequate for
qualitatively judging the expression pattern of these genes.
Bacterial Overexpression and Antisera Production
The full-length cDNAs of the SYPs were each further modified by PCR with the use of a specific primer for each, which included an NdeI restriction site immediately before the start codon of each open reading frame (51NdeF: AGATCTCATATGGCGTCTTCATCGGATTC; 61NdeF listed above; 71NdeF: CATATGACTGTGATCGATATTCTGACT; reverse primers were same as listed above), and the amplified products of each were cloned into the pGEM-T Easy vector (Promega, Madison, WI), creating pNde-SYP51, pNde-SYP61, and pNde-SYP71. The sequence of each plasmid was verified by dideoxy sequencing.
To produce antibodies to each of these classes of syntaxins, N-terminal fragments of SYP51, 61, and 71 (encoding amino acids 1-189, 1-168, and 1-144, respectively) were fused to a C-terminal 6xHis tag, and separately expressed in Escherichia coli stain BL21 (DE3) pLysS. Protein was purified by Ni-affinity chromatography, dialyzed, and concentrated before injection into rabbits at Cocalico Biologicals (Reamstown, PA).
Glutathione-S-transferase (GST) fusions of SYP51, 61, and 71 were
created similarly by fusing amino acids 1-189, 1-168, and 1-236,
respectively, to the C terminus of GST, and expressed in E. coli stain BL21. Protein was bound to a glutathione-affinity chromatography column, washed extensively, and then cross-linked with
dimethyl pimelimidate as previously described (Bassham et al., 2000
). Antisera raised against SYP51, 61, or 71 were affinity purified over the appropriate columns with the use of a procedure described previously (Bassham et al., 2000
).
To test the specificity of the antibodies, we produced full-length
fusions of several Arabidopsis SYPs in bacteria. pNde-SYP21 (previously
called pNde-AtPEP12) is described in Sanderfoot et al.
(1999)
, whereas pNde-SYP31 (previously called pNde-AtSED5) and
pNdeSYP41 (previously called pNde-AtTLG2a) are described in Bassham
et al. (2000)
. Each was cloned into an appropriately
digested pET-28a (Novagen, Madison, WI) creating an N-terminal 6xHis
fusion to each full-length ORF. The pET-28a-derived fusions were each transformed into E. coli stain BL21 (DE3) pLysS, and protein
overexpressed by induction with isopropyl
-D-thiogalactoside. All of the
6xHis-tagged SYPs were soluble and could be purified by Ni-affinity
chromatography. The purified proteins were separated by SDS-PAGE,
transferred to nitrocellulose, and then probed with the various
antisera raised to the Arabidopsis SYPs. Each antiserum recognized its
cognate antigen, but no cross-reactivity was seen with noncognate SYPs, indicating the antiserum was specific for the products of its particular gene family.
SYP21 chicken antibodies are described in Sanderfoot et al.
(2001)
, rabbit antisera specific to either SYP21 or SYP22 are described
in Sanderfoot et al. (1999)
, and SYP41 rabbit antibodies are
described in Bassham et al. (2000)
.
Epitope Tagging of SYP51 and 52
The plant binary plasmids pCAMBIA1300MCS1 and 3300MCS1 are derivatives of the pCAMBIA series of plasmids (Cambia GPO, Canberra, Australia) in which the endogenous multicloning site is replaced with the cauliflower mosaic virus 35S promoter and nopaline synthase terminator from pBI121 separated by a new multicloning site. These plasmids allow constitutive expression of proteins in plants after Agrobacterium-mediated transformation with selection based on either hygromycin (1300MCS1) or glufosinate (3300MCS1).
SYP51 was epitope tagged with a T7 peptide by cloning the BglII to NotI (found in the vector downstream of the stop codon) fragment of pNde-SYP51 into a BamHI to NotI digested pET-21a. This plasmid encodes for a T7-epitope tag fused to the N terminus of the full-length SYP51 ORF. The sequence of this plasmid was confirmed before cloning of the XbaI to XhoI fragment (containing the T7-SYP51 ORF) into XbaI and SalI digested pCAMBIA-3300MCS.
SYP52 was tagged with an CRUZ22 peptide (Santa Cruz Biotechnology, Santa Cruz, CA) by introducing an EcoRI site at the start of the ORF by PCR (52EcoRIF: GAATTCATGGCCTCTTCTTCGGATC, 52SacIR: CTCGAGCCACCACATTGGCATTACAGG), and then cloning the EcoRI to PstI fragment of the amplified product into the pCRUZ22B vector. A primer specific to the 5' region of the CRUZ22 tag preceded by an XbaI restriction site (TCTAGAATGGATATGCGCGACGCCCTG) was used with a primer within the SYP52 fragment (52R2: ACATGGTAATCTAAGTCATCAATAAGCCT) in PCR to retrieve the tagged fragment from the pCRUZ22B plasmid. This amplified product was cloned into pGEM-T Easy, and the sequence confirmed before the XbaI to PstI fragment was rejoined with the rest of the SYP52 ORF (digested with PstI and XhoI) by ligating to XbaI and SalI digested pCAMBIA-1300MCS.
Both of the binary plasmids were transformed into Agrobacterium
tumefaciens, and subsequently vacuum infiltrated into Arabidopsis ecotype Columbia as described previously (Bent et al.,
1994
). Transformants were screened based upon the appropriate
selectable marker and expression of the epitope-tagged proteins
verified by T7 monoclonal antibodies (Novagen) or CRUZ22 rabbit
polyclonal antibodies (Santa Cruz Biotechnology).
Immunoprecipitation of Arabidopsis SYPs
Root cultured Arabidopsis plants (wild-type,
T7-SYP51, C22-SYP52, or
T7-SYP42-expressing) were grown as described previously (Bar-Peled et al., 1995
). Detergent extracts of microsomes
and subsequent immunoprecipitations (IPs) were performed essentially as
described in Bassham et al. (2000)
. Immobilized antibodies to the CRUZ22 tag were acquired from Santa Cruz Biotechnology, and used
in IPs in a manner similar to that described for immobilized T7
monoclonal antibodies (Bassham et al., 2000
). Each IP was
repeated at least twice from independent plants, and representative
results are shown in the figures.
Similar extracts were made from suspension cultures of Arabidopsis cell
lines (cultured as described in Conceição et
al., 1997
) and were used in similar experiments to those listed
above, as well as for the large-scale IPs used in our proteomic
approach. The details of this method will be described elsewhere in
detail, but briefly, after elution from the immobilized antibody
column, proteins were precipitated by 5% trichloroacetic acid, washed in cold acetone, and then resuspended in SDS sample buffer. After separation by SDS-PAGE, proteins were visualized by silver staining, and specific bands excised. Bands were provided to the Protein Microsequencing and Proteomic Mass Spectroscopy Lab at the University of Massachusetts Medical School (Worchester, MA). After in-gel tryptic digestion, eluted peptides were applied to a Finnigan Electrospray LCQ Deca ion trap mass spectrometer, and the resulting peptide masses used to identify potential matches within the
Arabidopsis proteome.
Electron Microscopy
Cryosections of Arabidopsis root tips were prepared as described
in Sanderfoot et al. (1998)
and used for all immunogold
labeling experiments. Immunolabeling was performed as described in
Sanderfoot et al. (1998)
and Zheng et al. (1999)
.
For double-labeling experiments, after incubation of the grids with the
first antibody, a second fixation step followed by a second blocking
step was used to prevent cross-reactivity of the antibodies in later
stages of the protocol. Many sections from independent plants were
observed for each combination of antibodies. Controls were performed
with the use of the corresponding preimmune serum substituted for one
or both of the antisera. In all cases, these controls demonstrated that
the labeling seen was highly specific.
| |
RESULTS |
|---|
|
|
|---|
SYP5- and SYP6-Group of Arabidopsis Syntaxins
Analysis of the completed Arabidopsis genome identified three
syntaxin gene families (SYP5, SYP6, and
SYP7) that had not been previously characterized (Sanderfoot
et al., 2000
). Based on secondary structure predictions
(NNPredict; Kneller et al., 1990
), the members of each of
these groups of syntaxins have a secondary structure very similar to
that of mammalian syntaxin 1, whose crystal structure has been solved
(Misura et al., 2000
). With respect to the eight yeast syntaxins, the members of each of these families showed homology
with the late-Golgi/endosomal syntaxin Tlg1p. The SYP5 family contained two members (SYP51 and SYP52),
whose gene products share 82% sequence identity and were most similar
in sequence to mammalian syntaxin 8 (37% sequence identity; Figure
1A). SYP51/52 (as well as syntaxin 8)
also shared ~20% sequence identity with the yeast vacuolar SNARE
Vam7p (Sato et al., 1998
). However, the SYP5/syntaxin 8-type
proteins lack the essential PX-domain found at the N terminus of Vam7p,
whereas Vam7p does not contain a transmembrane domain at the C terminus
like the SYP5/syntaxin8-type proteins. Comparisons between SYP51 and
Vam7p with the PX-sequence deleted (i.e., the syntaxin-like domain)
showed a higher level (28%) of sequence identity. The SYP6-group is
encoded by a single gene (SYP61), the product of which shows
highest sequence identity to mammalian syntaxins 6 and 10 (16 and 20%
sequence identity, respectively), as well as yeast Tlg1p (19.2%
sequence identity). The SYP7-gene family encompasses three
genes that show ~15% sequence identity to Tlg1p, and lower identity
with the mammalian syntaxins listed above. SYP7-type syntaxins show no
obvious mammalian homologs and may be a distinct subgroup of Tlg1p-like
syntaxins.
|
Based upon RT-PCR analysis, members of the SYP5- and
SYP7-families and SYP61 are expressed widely in
plant tissues. Like other previously characterized Arabidopsis
syntaxins (Bassham et al., 1995
; Sato et al.,
1997
), these genes typically had their highest expression levels in
roots and seedlings, but detectable levels were observed in all other
tissues (our unpublished results). Analysis of the EST databases from
other plants revealed that orthologs of these syntaxins are found in
other dicotyledonous plants such as soybean (Glycine max),
barrel medic (Medicago truncatula), and tomato
(Lycopersicon esculentum), as well as several monocots (Zea mays, Triticum aestivum, Sorghum bicolor), indicating
that Arabidopsis is typical with respect to these gene families (see http://www.msu.edu/~sanderfo/atsnare.htm).
To better study these syntaxins, a polyclonal antiserum was raised to
an N-terminal fragment of SYP51. The affinity-purified SYP51 antibodies
recognized a single band of ~30 kDa (Figure 1B) that was found in
microsomes extracted from all major tissues of Arabidopsis (Figures
1C). The molecular mass of the SYP51-cross-reacting band was of a
larger apparent size than predicted, but this is typical of syntaxins,
which often migrate as larger proteins in SDS-PAGE
(Conceição et al., 1997
; Bassham et
al., 2000
). The antiserum was found to cross-react with both
SYP5-type syntaxins, and this cross-reactivity could not be reduced by
affinity purification procedures (our unpublished results). This was
not surprising considering the high degree of sequence homology between
SYP51 and SYP52. Because both SYP51 and SYP52
have a similar expression pattern, the bands observed in Figure 1, B
and C, are likely to be a summation of both proteins. Antisera were
also raised to N-terminal fragments of SYP61 and SYP71. These antisera
recognized bands of ~35 and ~36 kDa (respectively; Figure 1B) in
microsomes from all major organs (Figure 1C). The SYP71-antiserum is
likely to recognize all three of the SYP7-type syntaxins. The
specificity of all the antisera was checked against bacterially
expressed Arabidopsis syntaxins (see MATERIALS AND METHODS), and each
was found to be specific to its cognate antigen.
In examining the localization and protein-protein complexes between these groups of syntaxins, we observed an overall similarity between the SYP5- and SYP6-type syntaxins that was not shared with the SYP7-group (see below). For this reason, we will focus here on the SYP5- and SYP6-type syntaxins, whereas SYP7-type syntaxins will be covered in more detail elsewhere.
SYP51 Is Found on PVC and SYP42-Domain of TGN
To examine the intracellular localization of SYP51, cryosections
of Arabidopsis roots were probed with affinity-purified antibodies specific to SYP51 (Figure 2). Labeling
with the preimmune serum to each protein showed no significant staining
of any organelles (Figure 2, A and E). Use of the SYP51 immune serum
showed a significant labeling of the TGN region of the Golgi (Figure
2B). No significant labeling of the nuclei, endoplasmic reticulum,
plasma membrane, cell wall, or of the vacuole was seen with SYP51
antibodies (our unpublished results). In addition, gold label was seen
on other organelles that were found distal to the Golgi and
occasionally in perivacuolar regions (Figure 2, C and D) that resembled
the PVC. This was confirmed by performing double immunolabeling with antisera specific for the PVC marker SYP21. Cryosections of Arabidopsis roots were stained with affinity-purified SYP51 antibodies, followed by
10 nm of gold; then with rabbit affinity-purified SYP21 antibodies, followed by 5 nm of gold. As a control, preimmune antiserum was used in
place of one or both (Figure 2, E and F) of the antisera. As has been
found previously (Conceição et al., 1997
;
Sanderfoot et al., 1998
, 1999
), the SYP21 antibodies was
found only on the PVC, electron-dense organelles that lie either
proximal to the Golgi stacks or are found in the perivacuolar region
(Figure 2, G and H). Many of the PVC structures stained by SYP21
antibodies were also labeled by the SYP51 antibodies (Figure 2, G and
H, and Table 1). Occasionally, PVC
structures stained with only SYP21 were observed, and SYP51 was found
alone, especially over the Golgi stacks. Identical results were found
in double immunolabeling when SYP22 antiserum was used in place of
SYP21 (Table 1). All of the colocalization between SYP22 and SYP51 was
found over prevacuolar-like structures, which is consistent with the
colocalization of SYP21 and SYP22 on the PVC in these root cells
(Sanderfoot et al., 1999
). SYP22 may be found on other
organelles such as the tonoplast in other cell types (Sato et
al., 1997
; Rojo, Zouhar, and Raikhel, unpublished results),
although we have no evidence for SYP51 being found on organelles other
than the PVC or TGN in any cell type (our unpublished results).
|
|
SYP41 and SYP42 define distinct domains of the plant TGN (Bassham
et al., 2000
). Because SYP51 was found to label the TGN, we
attempted to determine whether this syntaxin was restricted to a
particular domain of the TGN (as defined by SYP41 or SYP42). We
produced cryosections of plants expressing both HA-SYP41 and T7-SYP42. The sections were incubated with SYP51 antibodies
detected with 10 nm of gold, followed by incubation with either HA- or T7-specific antibodies (for HA-SYP41 or T7-SYP42, respectively) detected with 5 nm of gold. Controls where preimmune serum was used in
place of one or both of the antisera during the double labeling ensured
that the staining was specific (Figure 2I). We found that SYP51
significantly colocalized with T7-SYP42 on the TGN (Figure 2, J and K,
and Table 1), although SYP51 was found separate from T7-SYP42 in a
small percentage of sections (Table 1). On the other hand,
colocalization of SYP51 with HA-SYP41 was rare, with the majority of
the labeling for each marker being found on distinct regions of the TGN
(Figure 2, L and M, and Table 1).
SYP61 Is Found on TGN and PVC
In a similar manner as described above, we examined the
localization of SYP61 with the use of cryosections and immunolabeling with affinity-purified SYP61 antibodies. SYP61 immunolabeling was found
over the Golgi and TGN (Figure 3, B and
C), and occasionally over regions distal from the Golgi (Figure 3D). No
specific labeling with the SYP61 antibodies was found over the nuclei,
endoplasmic reticulum, plasma membrane, cell wall, or the tonoplast
membrane (our unpublished results). With the use of SYP21 as a marker
for the PVC in double immunolabeling, we were able to show significant colocalization of SYP61 and SYP21 (Figure 3F and Table 1), indicating that SYP61 is also found on the PVC. When double labeling was performed
on cryosections from the HA-SYP41- and
T7-SYP42-expressing plants, we found that SYP61 colocalized
with both SYP41 and SYP42 to approximately equal extent (Figure 3, G
and H, and Table 1). These results suggested that SYP61 was distributed
across both domains of the TGN.
|
Double immunolabeling with SYP51 and SYP61 (on sections of wild-type Arabidopsis) showed that both colocalized extensively (Figure 3I and Table 1). The colocalization occurred both near the Golgi as well as distal from the stacks (likely the PVC) with approximately equal extent. Meanwhile, some of the Golgi staining for SYP61 was unique, probably representing the pool of SYP61 found on the SYP41-domain of the TGN where SYP51 staining is rare. These results suggest that SYP51 and SYP61 colocalize both on the TGN and PVC.
Interactions between Arabidopsis SYPs
Because recent results have suggested that different syntaxins may
interact in vivo (Holthuis et al., 1998
; Antonin
et al., 2000
; Wade et al., 2001
), we examined the
potential interactions between Arabidopsis syntaxins with the use of IP
of detergent extracts of Arabidopsis microsomes. Extracts of
Arabidopsis root-cultured tissue were immunoprecipitated (IPd) with
antisera to various SYPs, and then the eluates of these experiments
were probed with the antisera indicated in Figure
4. Similar results were found if extracts
from suspension cultured cell lines of Arabidopsis were used instead
for the IPs (our unpublished results).
|
We found many distinct complexes between the TGN and PVC SYPs that are
shown in Figure 4A. Use of SYP21-specific antibodies showed that SYP51
was coimmunoprecipitated, although no interaction was seen with other
SYPs (including SYP22). A similar pattern was observed by IP with SYP22
antibodies (our unpublished results). This interaction was confirmed in
reverse by the use of SYP51 antibodies to coimmunoprecipitated SYP21.
The fact that SYP21 and SYP22 do not coimmunoprecipitate, yet SYP51
interacts with both indicates that two distinct SYP21 + SYP51 and SYP22 + SYP51 complexes must form. SYP51 also coimmunoprecipitated SYP61, and because no interaction was found between SYP21 and SYP61, the SYP51 + SYP61 interaction is again distinct. Use of SYP41 antibodies showed a
coimmunoprecipitation with SYP61, but not with other SYPs. It should be
noted that the SYP41 antibodies used here cross-react with SYP42
(Bassham et al., 2000
). Extracts of
T7-SYP42-expressing plants were used in parallel experiments
to clarify any potential distinctions between SYP41 and SYP42, although
none were identified in these experiments (Figure 4B). Because SYP41
and SYP42 are found on distinct domains of the TGN, and T7-SYP42 does
not coimmunoprecipitate SYP41 (Bassham et al., 2000
), it is
clear that distinct SYP41 + SYP61 and SYP42 + SYP61 complexes must
form. None of these SYPs were found to interact with SYP71, indicating
that this group is distinct from the SYP5- or SYP6-type syntaxins. As
should be expected, the complexes between the SYPs were restricted to
those proteins that have been shown to colocalize (i.e., SYP21 + SYP51 or SYP41 + SYP61), although, importantly, not all SYPs that are found
on the same organelle were found to interact (i.e., SYP51 does not
coimmunoprecipitate SYP42, and SYP21 does not coimmunoprecipitate SYP61). In summary, our results indicated PVC-localized complexes of
SYP21 + SYP51 and SYP22 + SYP51, TGN-localized complexes of SYP41 + SYP61, SYP42 + SYP61, and a fifth complex containing SYP51 + SYP61 that
may be either on the PVC or the TGN.
As an independent verification of the above-mentioned results, we
also used a proteomic approach to identify potential partners for the
various SYPs. Much of this analysis will be presented elsewhere, but
the following is of relevance to this work. We performed a large-scale
IP of Arabidopsis suspension cell extract with SYP41 antibodies,
followed by separation of the eluate by SDS-PAGE, silver staining, and
excision of specific bands. Peptides were then subjected to in-gel
tryptic digestion and mass identification with the use of electron
spray ion trap mass spectroscopy. Aside from identifying peptides known
from previous analysis (i.e., VPS45; Bassham et al., 2000
),
we were able to identify a peptide corresponding to SYP61
(195IGGVGLTIHDELVAQER211),
as well as peptides corresponding to SYP41, SYP42, and SYP43 (recall
that the SYP41 antibodies cross-react with other members of the
SYP4-group; Bassham et al., 2000
). Peptides from no other SYPs could be identified, consistent with the results presented above.
Interactions with Arabidopsis Vti1p-Homologs
Arabidopsis encodes three homologs of the yeast SNARE Vti1p (Zheng
et al., 1999
; Sanderfoot et al., 2000
). VTI11 and
VTI12 (formerly VTI1a and VTI1b) show the lowest degree of sequence identity (58%) among the Arabidopsis homologs, yet have a similar distribution pattern within the endomembrane system, both being found
on the TGN and Golgi-derived vesicles, as well as on the PVC (Zheng
et al., 1999
). However, each is believed to serve distinct functions in vesicle trafficking based upon their differential ability
to complement aspects of yeast Vti1p functions (Zheng et
al., 1999
). Furthermore, it has been previously shown that the
members of the SYP4 family interact only with the VTI12 paralog, having
no detectable interaction with VTI11 (Bassham et al., 2000
). Members of the SYP2 family have previously been shown to interact with
VTI11 (Sanderfoot et al., 1999
; Zheng et al.,
1999
), and we now show that the PVC syntaxins coimmunoprecipitate very
little VTI12 (Figure 4C). Thus, there seems to be a clear preference for VTI11 to form complexes with the PVC syntaxins, whereas VTI12 interacts with the TGN syntaxins.
To investigate any preference between VTI11 and VTI12 with respect to the other SYPs, we examined detergent extracts of Arabidopsis microsomes. In this experiment, the eluate was substantially overloaded with respect to the total and flow-through (10-fold) so as to allow comparison between the two VTI1 paralogs. SYP51 antibodies coimmunoprecipitated a much greater amount of VTI11 compared with VTI12 (Figure 4C), indicating a potentially greater affinity for VTI11. Unlike the SYP2-type syntaxins, however, some VTI12 was coimmunoprecipitated with SYP51. On the other hand, SYP61 antibodies coimmunoprecipitated a much greater amount of VTI12 than VTI11 (Figure 4C). Unlike the SYP4-type syntaxins, a small amount of VTI11 was coimmunoprecipitated by SYP61. Consistent with the previous results, VTI11 may preferentially form PVC-localized complexes (i.e., with SYP2- and SYP5-type syntaxins), whereas VTI12 preferentially forms TGN-localized complexes (i.e., with SYP4-, SYP5-, and SYP6-type syntaxins. These results further strengthen the hypothesis that VTI11 and VTI12 serve distinct functions in vesicle trafficking.
SYP51 and SYP52 May Have Redundant Functions
Because the SYP51 antibodies cross-reacted with SYP52, to clearly distinguish each member of the SYP5 gene family, we labeled each with a distinct epitope tag. SYP51 was epitope tagged with a T7-peptide (T7-SYP51), whereas SYP52 was tagged with a CRUZ22 epitope (C22-SYP52). Arabidopsis plants stably expressing both epitope-tagged proteins were produced by Agrobacterium-mediated transformation. Arabidopsis plants were chosen that expressed only a moderate amount of each epitope-tagged protein to prevent any potential problems due to overexpression. Based upon density gradient analysis of the transgenic plants, the epitope-tagged proteins were found to fractionate identically to that of the endogenous SYP5 (our unpublished results), suggesting that the epitope tags did not affect the intracellular localization.
To determine whether there was any difference between the two SYP5-type
syntaxins, we made microsomal extracts from root cultures expressing
T7-SYP51 and C22-SYP52, and used immobilized
antibodies specific for each tag to immunoprecipitate them individually
(Figure 5). The two SYP5-type syntaxins
do not interact with each other, similar to what was found for the
SYP2-type syntaxins mentioned above, indicating that distinct complexes
must exist for SYP51 and SYP52. No other distinctions were found
between the SYP5 paralogs with respect to interaction with other SYPs,
and identical interactions were observed for the epitope-tagged
versions as was found above for the polyclonal antiserum. Because of
the high degree of sequence identity, together with an identical
expression pattern and biochemical behavior, we believe that SYP51 and
SYP52 may serve redundant functions, although this will require future
analysis of gene disruptions.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this work, we have examined the intracellular localization and
protein-protein interactions of the SYP5- and SYP6-type syntaxins,
previously undescribed groups of Arabidopsis syntaxins. Among the eight
yeast syntaxins, both SYP5- and SYP6-type syntaxins show highest
overall sequence identity with the early endosomal syntaxin Tlg1p.
SYP61 shows further homology to the mammalian TGN-localized syntaxins 6 and 10 (Bock et al., 1997
; Tang et al., 1998
).
SYP5-type syntaxins, also show similarity to the SNARE domain of the
yeast vacuolar SNARE Vam7p (Sato et al., 1998
) and to
mammalian syntaxin 8, a syntaxin found on many organelles within the
late endocytic system of the mammalian cell (Prekeris et
al., 1999
). Based upon these similarities, we propose the
multicellular eukaryotes may have subgroups of the Tlg1p-like
syntaxins: one including SYP61 and mammalian syntaxins 6 and 10, and a
second of SYP51/52 and mammalian syntaxin 8.
The yeast syntaxin Tlg1p is required for the endocytosis and correct
Golgi localization of many membrane proteins in yeast, and consistent
with this role is generally reported to be localized to the equivalent
of an early endosome in yeast cells, although it is also found on the
TGN and the PVC (Holthuis et al., 1999
; Gurunathan et
al., 2000
; Lewis et al., 2000
). Yeast Vam7p is found mostly in the soluble fraction (Sato et al., 1998
), although
it is also found associated with the vacuolar membrane (Sato et
al., 1998
; Ungermann and Wickner, 1998
). The Ustilago
maydis ortholog of Vam7p (Yup1p) is found to localize to small
vesicles and the equivalent of an early endosome (Wedlich-Söldner
et al., 2000
), suggesting that this SNARE may function on
organelles other than the vacuole. Mammalian syntaxins 6 and 8 are each
found on many organelles, including the TGN and early and late
endosomes, as well as at lower levels on the plasma membrane and
lysosomes (Bock et al., 1997
; Klumperman et
al., 1998
; Prekeris et al., 1999
). Here, we have shown
that SYP51 and SYP61 are found on multiple organelles, including the
TGN and PVC. Note that we have found no evidence of vacuolar or plasma
membrane localization for either SYP51 or SYP61. The finding
that, while on the TGN, SYP51 preferentially localizes with SYP42
(compared with SYP41) is further evidence that the TGN has distinct
domains. Because SYP51 and SYP42 do not directly interact, these two
syntaxins probably have distinct functions on this particular domain of
the TGN. The vacuolar cargo receptor AtELP also preferentially
localizes with SYP42 on this TGN domain (Bassham et al.,
2000
). At this point, it is unclear whether the colocalization of these
markers to a particular domain of the TGN has any significance, but
future studies may clarify the distinct roles of the domains of the
TGN.
The yeast SNAREs Tlg1p and Vam7p interact with other syntaxins. For
example, Tlg1p interacts with the TGN-localized syntaxin Tlg2p
(Holthuis et al., 1998
). Vam7p has been shown to interact with the vacuolar syntaxin Vam3p (Sato et al., 1998
). With
respect to the Tlg1p + Tlg2p interaction, we find one orthologous
interaction between SYP41 or 42 + SYP61, but not between SYP41 or 42 + SYP51; perhaps indicating a functional distinction between the
Arabidopsis SYPs. With respect to the Vam7p + Vam3p interaction, this
becomes contentious. No other eukaryote aside from budding yeast has a clear ortholog of Vam3p (Pelham, 1999
; Sanderfoot et al.,
1999
, 2000
). Most commonly, the members of the plant SYP2-type
syntaxins and mammalian syntaxins 7/13 are described as
Pep12p-orthologs because they are found in most cells on prevacuolar or
endosomal compartments (Prekeris et al., 1999
; Sanderfoot
et al., 1999
). However, in some cells types, representatives
of each of these groups (SYP22 and syntaxin 7) have been reported to be
localized to the tonoplast or lysosomal membranes (Sato et
al., 1997
; Mullock et al., 2000
), suggesting that
perhaps particular members of these groups may also play similar roles
as yeast Vam3p. It is therefore possible that the Vam7p + Vam3p
interaction represents an analog of the SYP2 + SYP5 interaction we
observe, or the orthologous syntaxin 7 + 8 interaction observed in
mammalian cells by Antonin et al. (2000)
. We have also shown
an interaction between SYP5-type syntaxins and SYP61. Thus far, no
equivalent interaction between the mammalian orthologs of these
syntaxins (syntaxin 8 and syntaxin 6) has been reported. On the
contrary, a recent report has indicated an interaction between
mammalian syntaxins 6 and 7 (Wade et al., 2001
), an
interaction we do not observe between the orthologous plant proteins
(SYP2 and SYP6; Figure 4). Clearly, significant differences remain
between plants and animals with respect to SNARE-SNARE interactions.
We have also identified other members of the SYP-complexes within the
VTI1-like family of Arabidopsis SNAREs. Because both SYP2-type and
SYP5-type syntaxins each interact with VTI11, and all three SNAREs can
be found localized on the PVC (Conceição et al.,
1997
; Sanderfoot et al., 1999
; Zheng et al.,
1999
), it seems reasonable to suggest that these three SNAREs may form
a complex (SYP2 + SYP5 + VTI11). Because the amount of VTI11 IPd with
either SYP21 or SYP51 is very small, it is possible that VTI11 may be
acting as a v-SNARE for a SYP21 + SYP51 t-SNARE complex. It is typical
that the amount of v-SNARE IPd from detergent extracts is quite small
relative to other members of the t-SNARE complex (Holthuis et
al., 1998
; Antonin et al., 2000
; Gurunathan et
al., 2000
; Lewis et al., 2000
). Similar arguments can
be made to show that there exist TGN complexes of SYP4 + SYP6 + VTI12
where VTI12 may act as a v-SNARE. In the case of the SYP5 + SYP6
complex, because both interact to some extent with both VTI11 and
VTI12, it is not immediately apparent which VTI1-type SNARE may be a part of this complex. It is most likely that this complex contains VTI12, considering the very small amount of VTI11 coimmunoprecipitated by SYP61, but we cannot be sure at this time. With preliminary experiments attempting IPs with either VTI11 or VTI12 antibodies, we
have not observed any interactions between VTI11 and VTI12 (our
unpublished results), suggesting that the SYP5 + SYP6 complex must
contain one or the other, not both. Regardless of the order of the
tertiary complex between these SNAREs, a fourth SNARE is required to
form a functional SNARE complex. Preliminary evidence indicates that
none of the members of the VAMP72-group nor of the novel NPSN-group of
SNAREs (Sanderfoot et al., 2000
) are IPd by any of the
above-mentioned syntaxins (our unpublished results), suggesting that
these SNAREs are unlikely to be part of this complex. Many other SNAREs
are found in Arabidopsis (Sanderfoot et al., 2000
), and we
are currently investigating the possibility that any of these may be a
part of these complexes. At this point, little can be gained from
examining the other members of the mammalian syntaxin complexes. For
example, the SNAREs mVti1b and VAMP8 constitute the other members of
the syntaxin 7 + 8 complex (Antonin et al., 2000
). Although
Arabidopsis encodes for three Vti1p-type SNAREs (including VTI11), all
are more homologous to mVti1a as opposed to the much more divergent
mVti1b (Zheng et al., 1999
; Sanderfoot et al.,
2000
). Similarly, none of the large number VAMP-homologs found in
plants show homology to VAMP8 (Sanderfoot et al., 2000
). It
is therefore clear that the SYP2/SYP5 complex will be distinct from the
analogous mammalian complex, and research into the fourth member of the
SYP2 + SYP5 + VTI11 complex continues.
In conclusion, we have identified at least five distinct SNARE
complexes on the TGN or PVC of Arabidopsis cells that contain more than
one member of the syntaxin-group of SNAREs (Figure
6). We have tentatively placed the
SYP51/SYP61 complex on the TGN due to the likelihood of it containing
VTI12 (which seems to prefer TGN-localized SYPs), but we cannot rule
out the possibility of this complex forming on the PVC or other
endosomal organelles. At this point, we are not able to clearly assign
a function to any of these complexes. Gene disruptions of many
Arabidopsis syntaxins have shown that each are essential genes;
however, the lethality associated with loss of gene function occurs too
early in development to allow analysis of the defects (Sanderfoot
et al., 2001
). Based on several lines of evidence, including
intracellular localization and the interactions listed above, we
believe we can give a preliminary model for at least one of these
complexes. VTI11 is found on the TGN, and on TGN-derived vesicles where
it is in proximity to the vacuolar cargo receptor AtELP (Zheng et
al., 1999
). Because VTI11 interacts with the PVC SYP21 + SYP51
t-SNARE complex (which requires a third, as yet unidentified SNARE), we
propose that VTI11 is mediating the trafficking of the
AtELP-bound vacuolar cargo to the PVC. Much more work is
required to prove this hypothesis, as well as to identify functions for
the other SNARE complexes we have characterized in this work.
|
| |
ACKNOWLEDGMENTS |
|---|
We thank Emily Avila-Teeguarden for donating RNA from various Arabidopsis tissues, the Arabidopsis Biological Resource Center for providing ESTs, and John Leszyk for performing the mass spectroscopy analysis. A.A.S. was partially supported by a National Institute of Health postdoctoral fellowship (GM-18861). N.V.R. was supported by funds from the Department of Energy (DE-FG02-91ER-20021) and the National Science Foundation (MCB-9507030).
| |
FOOTNOTES |
|---|
§ Corresponding author. E-mail address: nraikhel{at}msu.edu.
Current address: Department of Botany and Center
for Plant Responses to Environmental Stresses, 353 Bessey Hall, Iowa
State University, Ames, IA 50011.
| |
ABBREVIATIONS |
|---|
Abbreviations used: IP, immunoprecipitate; IPd, immunoprecipitated; PVC, prevacuolar compartment; SNARE, soluble N-ethyl maleimide sensitive factor adaptor protein receptors; SYP, syntaxin of plants; TGN, trans-Golgi network.
| |
REFERENCES |
|---|
|
|
|---|
Lessons from yeast.
Exp. Cell Res.
247, 1-8[Medline].This article has been cited by other articles:
![]() |
S. J. Liljegren, M. E. Leslie, L. Darnielle, M. W. Lewis, S. M. Taylor, R. Luo, N. Geldner, J. Chory, P. A. Randazzo, M. F. Yanofsky, et al. Regulation of membrane trafficking and organ separation by the NEVERSHED ARF-GAP protein Development, June 1, 2009; 136(11): 1909 - 1918. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zouhar, E. Rojo, and D. C. Bassham AtVPS45 Is a Positive Regulator of the SYP41/SYP61/VTI12 SNARE Complex Involved in Trafficking of Vacuolar Cargo Plant Physiology, April 1, 2009; 149(4): 1668 - 1678. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ebine, Y. Okatani, T. Uemura, T. Goh, K. Shoda, M. Niihama, M. T. Morita, C. Spitzer, M. S. Otegui, A. Nakano, et al. A SNARE Complex Unique to Seed Plants Is Required for Protein Storage Vacuole Biogenesis and Seed Development of Arabidopsis thaliana PLANT CELL, November 1, 2008; 20(11): 3006 - 3021. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wang, X. Yang, S. Tangchaiburana, R. Ndeh, J. E. Markham, Y. Tsegaye, T. M. Dunn, G.-L. Wang, M. Bellizzi, J. F. Parsons, et al. An Inositolphosphorylceramide Synthase Is Involved in Regulation of Plant Programmed Cell Death Associated with Defense in Arabidopsis PLANT CELL, November 1, 2008; 20(11): 3163 - 3179. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hwang Sorting and Anterograde Trafficking at the Golgi Apparatus Plant Physiology, October 1, 2008; 148(2): 673 - 683. [Full Text] [PDF] |
||||
![]() |
D. C. Bassham and M. R. Blatt SNAREs: Cogs and Coordinators in Signaling and Development Plant Physiology, August 1, 2008; 147(4): 1504 - 1515. [Full Text] [PDF] |
||||
![]() |
S. Robert, S. N. Chary, G. Drakakaki, S. Li, Z. Yang, N. V. Raikhel, and G. R. Hicks Endosidin1 defines a compartment involved in endocytosis of the brassinosteroid receptor BRI1 and the auxin transporters PIN2 and AUX1 PNAS, June 17, 2008; 105(24): 8464 - 8469. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sanderfoot Increases in the Number of SNARE Genes Parallels the Rise of Multicellularity among the Green Plants Plant Physiology, May 1, 2007; 144(1): 6 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sanmartin, A. Ordonez, E. J. Sohn, S. Robert, J. J. Sanchez-Serrano, M. A. Surpin, N. V. Raikhel, and E. Rojo Divergent functions of VTI12 and VTI11 in trafficking to storage and lytic vacuoles in Arabidopsis PNAS, February 27, 2007; 104(9): 3645 - 3650. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Moreau, F. Brandizzi, S. Hanton, L. Chatre, S. Melser, C. Hawes, and B. Satiat-Jeunemaitre The plant ER-Golgi interface: a highly structured and dynamic membrane complex J. Exp. Bot., January 1, 2007; 58(1): 49 - 64. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Foresti, L. L.P. daSilva, and J. Denecke Overexpression of the Arabidopsis Syntaxin PEP12/SYP21 Inhibits Transport from the Prevacuolar Compartment to the Lytic Vacuole in Vivo PLANT CELL, September 1, 2006; 18(9): 2275 - 2293. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dettmer, A. Hong-Hermesdorf, Y.-D. Stierhof, and K. Schumacher Vacuolar H+-ATPase Activity Is Required for Endocytic and Secretory Trafficking in Arabidopsis PLANT CELL, March 1, 2006; 18(3): 715 - 730. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ueda, C. Nishiyama, T. Shimada, Y. Koumoto, Y. Hayashi, M. Kondo, T. Takahashi, I. Ohtomo, M. Nishimura, and I. Hara-Nishimura AtVAM3 is Required for Normal Specification of Idioblasts, Myrosin Cells Plant Cell Physiol., January 1, 2006; 47(1): 164 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ohtomo, H. Ueda, T. Shimada, C. Nishiyama, Y. Komoto, I. Hara-Nishimura, and T. Takahashi Identification of an Allele of VAM3/SYP22 that Confers a Semi-dwarf Phenotype in Arabidopsis thaliana Plant Cell Physiol., August 1, 2005; 46(8): 1358 - 1365. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Carter, S. Pan, J. Zouhar, E. L. Avila, T. Girke, and N. V. Raikhel The Vegetative Vacuole Proteome of Arabidopsis thaliana Reveals Predicted and Unexpected Proteins PLANT CELL, December 1, 2004; 16(12): 3285 - 3303. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Swarup, J. Kargul, A. Marchant, D. Zadik, A. Rahman, R. Mills, A. Yemm, S. May, L. Williams, P. Millner, et al. Structure-Function Analysis of the Presumptive Arabidopsis Auxin Permease AUX1 PLANT CELL, November 1, 2004; 16(11): 3069 - 3083. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zouhar, G. R. Hicks, and N. V. Raikhel Sorting inhibitors (Sortins): Chemical compounds to study vacuolar sorting in Arabidopsis PNAS, June 22, 2004; 101(25): 9497 - 9501. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Preuss, J. Serna, T. G. Falbel, S. Y. Bednarek, and E. Nielsen The Arabidopsis Rab GTPase RabA4b Localizes to the Tips of Growing Root Hair Cells PLANT CELL, June 1, 2004; 16(6): 1589 - 1603. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Park, S. J. Kim, A. Vitale, and I. Hwang Identification of the Protein Storage Vacuole and Protein Targeting to the Vacuole in Leaf Cells of Three Plant Species Plant Physiology, February 1, 2004; 134(2): 625 - 639. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. B. Blancaflor and P. H. Masson Plant Gravitropism. Unraveling the Ups and Downs of a Complex Process Plant Physiology, December 1, 2003; 133(4): 1677 - 1690. [Full Text] [PDF] |
||||
![]() |
M. Surpin, H. Zheng, M. T. Morita, C. Saito, E. Avila, J. J. Blakeslee, A. Bandyopadhyay, V. Kovaleva, D. Carter, A. Murphy, et al. The VTI Family of SNARE Proteins Is Necessary for Plant Viability and Mediates Different Protein Transport Pathways PLANT CELL, December 1, 2003; 15(12): 2885 - 2899. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yano, M. Sato, C. Saito, M. H. Sato, M. T. Morita, and M. Tasaka A SNARE complex containing SGR3/AtVAM3 and ZIG/VTI11 in gravity-sensing cells is important for Arabidopsis shoot gravitropism PNAS, July 8, 2003; 100(14): 8589 - 8594. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Rojo, J. Zouhar, V. Kovaleva, S. Hong, and N. V. Raikhel The AtC-VPS Protein Complex Is Localized to the Tonoplast and the Prevacuolar Compartment in Arabidopsis Mol. Biol. Cell, February 1, 2003; 14(2): 361 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhu, Z. Gong, C. Zhang, C.-P. Song, B. Damsz, G. Inan, H. Koiwa, J.-K. Zhu, P. M. Hasegawa, and R. A. Bressan OSM1/SYP61: A Syntaxin Protein in Arabidopsis Controls Abscisic Acid-Mediated and Non-Abscisic Acid-Mediated Responses to Abiotic Stress PLANT CELL, December 1, 2002; 14(12): 3009 - 3028. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zheng, S. Y. Bednarek, A. A. Sanderfoot, J. Alonso, J. R. Ecker, and N. V. Raikhel NPSN11 Is a Cell Plate-Associated SNARE Protein That Interacts with the Syntaxin KNOLLE Plant Physiology, June 1, 2002; 129(2): 530 - 539. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||