![]() |
|
|
Vol. 12, Issue 2, 407-419, February 2001





¶ and
Division of Yeast Genetics and §Protein
Structure, National Institute for Medical Research, The Ridgeway, Mill
Hill, London, NW7 1AA United Kingdom; and
School of
Biochemistry and Genetics, University of Newcastle-upon-Tyne, Tyne and
Wear, NE2 4HH United Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
The Schizosaccharomyces pombe stress-activated Sty1p/Spc1p mitogen-activated protein (MAP) kinase regulates gene expression through the Atf1p and Pap1p transcription factors, homologs of human ATF2 and c-Jun, respectively. Mcs4p, a response regulator protein, acts upstream of Sty1p by binding the Wak1p/Wis4p MAP kinase kinase kinase. We show that phosphorylation of Mcs4p on a conserved aspartic acid residue is required for activation of Sty1p only in response to peroxide stress. Mcs4p acts in a conserved phospho-relay system initiated by two PAS/PAC domain-containing histidine kinases, Mak2p and Mak3p. In the absence of Mak2p or Mak3p, Sty1p fails to phosphorylate the Atf1p transcription factor or induce Atf1p-dependent gene expression. As a consequence, cells lacking Mak2p and Mak3p are sensitive to peroxide attack in the absence of Prr1p, a distinct response regulator protein that functions in association with Pap1p. The Mak1p histidine kinase, which also contains PAS/PAC repeats, does not regulate Sty1p or Atf1p but is partially required for Pap1p- and Prr1p-dependent transcription. We conclude that the transcriptional response to free radical attack is initiated by at least two distinct phospho-relay pathways in fission yeast.
| |
INTRODUCTION |
|---|
|
|
|---|
The mitogen-activated protein (MAP) kinase (MAPK) signaling
pathways are critical for the response of cells to changes in their
environment (Marshall, 1994
; Herskowitz, 1995
; Waskiewicz and Cooper,
1995
; Treisman, 1996
). They serve to transduce signals generated
at the cell surface or in the cytoplasm to the nucleus, where changes
in gene expression result. In mammalian cells, multiple distinct MAP
kinases have been identified, including a large subset whose members
are activated by a variety of environmental stress conditions,
DNA-damaging agents, inflammatory cytokines, and certain vasoactive
neuropeptides (Dérijard et al., 1994
; Freshney
et al., 1994
; Galcheva-Gargova et al., 1994
; Han
et al., 1994
; Kyriakis et al., 1994
; Lee et
al., 1994
; Rouse et al., 1994
; Sluss et al., 1994
). These stress-activated MAP kinases (SAPKs) fall into two distinct classes, termed the C-Jun N-terminal kinase
(JNK) and p38 kinases, based on their sequences (Davies,
1994; Waskiewicz and Cooper, 1995
). A number of transcription
factors are phosphorylated in response to SAPK activation; for example,
the c-Jun factor is regulated by JNK (Hibi et al., 1993
;
Derijard et al., 1994
; Kyriakis et al.,
1994
) but not by p38, whereas ATF2 is phosphorylated and regulated by
both JNK (Gupta et al., 1995
; Livingstone et al.,
1995
; van Dam et al., 1995
) and p38 (Raingeaud et
al., 1995
). Although a number of MAPK kinases (MAPKKs) and MAPKK
kinases (MAPKKKs) that activate the SAPKs have been identified in
mammalian cells, very little is known about how these are regulated by
stress stimuli (reviewed in Ichijo, 1999
; Tibbles and Woodgett, 1999
).
This is probably due to the multiplicity of SAPK pathways in mammalian cells and the difficulties of genetic analysis in these organisms.
Recently, a single member of the SAPK family, called Sty1p (also known
as Spc1p or Phh1p), has been identified in the fission yeast
Schizosaccharomyces pombe (Millar et al., 1995
;
Shiozaki and Russell, 1995
; Kato et al., 1996
). The Sty1p
MAP kinase stimulates gene expression via the Atf1p and Pap1p
transcription factors, homologs of human ATF2 and c-Jun, respectively,
suggesting that the transcriptional targets of the S. pombe
pathway are closely related to those in mammalian cells (Toda et
al., 1991
; Takeda et al., 1995
; Wilkinson et
al., 1996
; Shiozaki and Russell, 1996
; Gaits et al.,
1998
; Toone et al., 1998
; Wilkinson and Millar, 1998
).
Stress-induced nuclear translocation of activated Sty1p causes it to
bind and phosphorylate Atf1p, although the precise mechanism by which
this phosphorylation induces transcriptional activation is not known
(Wilkinson et al., 1996
; Shiozaki and Russell, 1996
; Gaits
et al., 1998
). Sty1p also binds to Pap1p but in this case
the mechanism of activation appears to be distinct. In contrast to
Atf1p, the bulk of the Pap1p protein is cytoplasmic in unstressed cells
and is translocated to the nucleus only in response to an oxidative
stress (Toone et al., 1998
). This translocation requires
Sty1p, although activation of Pap1p may not involve phosphorylation, because Pap1p is not a phosphorylation target of Sty1p in vitro. Instead, interaction of Pap1p with the nuclear export factor Crm1p is
disturbed by oxidation of the cysteine residues in the C terminus of
Pap1p. The role of Sty1p in this process is not understood (reviewed in
Wilkinson and Millar, 1998
). Nevertheless, many of the genes induced
after Sty1p activation in S. pombe are similar to those
induced by SAPK activation in mammals.
Sty1p is activated by a similar range of environmental stimuli to the
mammalian SAPKs, including oxidative stress, UV light, DNA-damaging
agents, osmotic stress, physical stresses, heat shock, and the protein
synthesis inhibitor anisomycin (Millar et al., 1995
;
Shiozaki and Russell, 1995
; Degols et al., 1996
; Degols and
Russell, 1997
; Shieh et al., 1997
, 1998
). Thus, one might postulate that the mechanisms controlling SAPK activation are similar
in S. pombe and mammalian cells. However, we recently demonstrated that activation of Sty1p is regulated by Mcs4p, a protein
that is homologous to the Saccharomyces cerevisiae Ssk1p response regulator protein, which is similar to a number of
two-component systems that function in bacteria but have yet to be
identified in mammals (Stock et al., 1989
; Parkinson, 1993
).
Ssk1p acts in a multistep phospho-relay system to control the activity
of the Hog1p MAPK (Maeda et al., 1994
, 1995
; Posas et
al., 1996
; Shieh et al., 1997
; Posas and Saito, 1998
).
Although Hog1p is structurally related to the SAPK family, it is
activated only by increases in external osmolarity (Brewster et
al., 1993
; Schüller et al., 1994
). In hypotonic
medium, a transmembrane histidine kinase, Sln1p, initiates a
phospho-relay system in which a phosphate group is transferred from the
Sln1p response-regulator domain to a histidine residue in Ypd1p and
then to a conserved aspartate residue in Ssk1p (Posas et
al., 1996
). In response to hypertonic stress, Sln1p is inactivated
and Ssk1p is dephosphorylated. In this state, Ssk1p binds and activates
one of two functionally overlapping MAPKKKs, Ssk2p and Ssk22p (Maeda
et al., 1994
, 1995
; Posas and Saito, 1998
). Ssk2p and Ssk22p
kinase activation leads to the sequential phosphorylation and
activation of the Pbs2p MAPKK and Hog1p MAPK (Brewster et
al., 1993
; Maeda et al., 1994
, 1995
). Activation of
Hog1p leads to the induction of a number of genes whose products
protect the cells in hypertonic medium.
It has been shown previously that in S. pombe, Mcs4p acts
upstream of the Wak1/Wis4p and Win1p kinases, homologs of the Ssk2p and
Ssk22p MAPKKKs, which in turn transmit the stress signal to the Wis1p
MAPKK, the direct activator of Sty1p (Warbrick and Fantes, 1991
; Millar
et al., 1995
; Shiozaki and Russell, 1995
; Shieh et al., 1997
, 1998
; Samejima et al., 1998
). Recently, an
S. pombe homolog of Ypd1p, Mpr1p, was found to be required
for the activation of Sty1p in response to an oxidative but not osmotic
stress (Nguyen et al., 2000
). This suggests that the Sty1p
MAPK pathway may be regulated by a phospho-relay system similar to the
Sln1p-Ypd1p-Ssk1p pathway in S. cerevisiae. However, the
sensors that initiate this signal in S. pombe have not been
identified. Moreover, because deletion of mcs4 abrogrates
the activation of Sty1p in response to multiple environmental stresses,
it is not clear what role Mcs4p phosphorylation may play in
transmitting these signals.
In this article, we describe the role of Mcs4p in stress-induced activation of Sty1p in more detail. We present evidence that S. pombe contains at least two phospho-relay signaling systems that are specifically involved in sensing peroxide stress and that one of these directly controls the activity of the Sty1p MAPK. We discuss the implications of these results both in relation to the ability of microbial pathogens to survive free radical attack and the mechanisms controlling SAPK activation in metazoans.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Media and General Techniques
Media and genetic methods for studying S. pombe were
as described by Moreno et al. (1991)
. Standard DNA methods
were used (Sambrook et al., 1989
). Cell length measurements
were made by using log-phase cells with a Nikon filar eyepiece drum
micrometer at 1200× magnification. Transformations were regularly
performed by the lithium acetate method (Moreno et al.,
1991
) or by electroporation (Prentice, 1991
) with a Bio-Rad gene pulser.
To isolate DNA S. pombe cells were cultured in YES medium to
stationary phase. Chromosomal DNA isolated (Moreno et al.,
1991
) from a 10-ml culture was dissolved in 25 ml of TE, and
one-fifth was digested and subjected to electrophoresis and Southern
blot hybridization. To isolate RNA, S. pombe cells were
cultured in YES to exponential phase. Approximately 10 µg of total
RNA was isolated (Moreno et al., 1991
) and resolved by
agarose gel electrophoresis before transfer to nitrocellulose for
hybridization as described previously (Wilkinson et al.,
1996
). Probes for pyp2, gpx1, ctt1, and cdc2 were prepared as described previously (Wilkinson
et al., 1996
; Toone et al., 1998
).
Detection of Mcs4p-Wak1p Interaction and of Activated Sty1p
The catalytic domain of wak1 was cloned by polymerase chain reaction (PCR) amplification from S. pombe genomic DNA. The 5' oligonucleotide TAACTAGATCTATGGCTTTCTGTTAACGCAT, incorporating a BglII site (italicized), hybridized to sequences 5' to the catalytic domain, whereas the 3' oligonucleotide TATTAGCGGCCGCGGTCAACACTATAGTTTATTGTG, incorporating a NotI site (italicized), hybridized to sequences surrounding the TGA termination codon. The fragment generated was digested with BglII and NotI and cloned into the BglII and NotI sites of pBSSK-ura4 (Millar, unpublished data) to form pBSSK-ura4-wak1. A tandem 9-myc epitope was amplified by PCR from plasmid pC3280 (a gift of K. Nasmyth, Research Institute of Molecular Pathology, Vienna, Austria) by using the 5' oligonucleotide GAAAAAGGGCGGCCGCATGGTTCAC and the 3' oligonucleotide ATATATATGCGGCCGCCTTATGTCGGCATATTCGAG, which incorporate NotI sites (italicized). The resulting fragment was cloned into pBSSK-ura4-wak1 that had been digested with NotI to form pBSSK-ura4-wak1(9myc). pBSSK-ura4-wak1(9myc) was linearized with NdeI before being transformed into CH429 cells. Stable integration of the tagged wak1-9myc gene at the genomic wak1 locus was confirmed by Southern blot and PCR.
The mcs4 open reading frame (ORF) was amplified by PCR from
S. pombe genomic DNA. The 5' oligonucleotide
CCCGGATCCATGCGCATTTGGTTTAAAAAAGTT incorporates a
BamHI site (italicized) and hybridized to sequences near the
start codon, whereas the 3' oligonucleotide
CCCGGATCCTCATCGACCGCGAAAACGGCA incorporates a
BamHI site (italicized) and hybridized to sequences surrounding the TGA termination codon. The amplified fragment was
digested with BamHI and cloned into the BamHI
site of pDS472a (Forsburg and Sherman, 1997
) to form pDS472a-mcs4,
which expresses GST-Mcs4 from an attenuated version of the
thiamine-repressible nmt promoter (nmt41) (Basi
et al., 1993
). mcs4::his7 wak1-9myc cells (HM1830) transformed with either pDS472a or pDS472a-mcs4 were
grown in minimal medium lacking leucine and thiamine for at least
24 h. Pelleted cells were lysed by using glass beads into lysis
buffer (0.5% NP-40, 150 mM NaCl, 50 mM NaF, 10% glycerol, 2 mM
Na-orthovanadate, 10 mM
-mercaptoethanol, 10 µg/ml aprotonin, 10 µg/ml benzamidine, 2 mM phenylmethylsulfonyl fluoride, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 50 mM HEPES; pH 7.4) and proteins were partially purified by affinity precipitation on
glutathione-agarose beads. Precipitated proteins were eluted in the
presence of 10 mM reduced glutathione, resolved by SDS-PAGE, and
blotted to nitrocellulose membranes. Membranes were probed with a
monoclonal antibody to the myc epitope (9E10; Covance,
Richmond, CA) according to the manufacturer's instructions.
Phosphorylated and activated Sty1p was detected by Western blot exactly
as described previously (Shieh et al., 1997
; Gaits et
al., 1998
).
Construction of mcs4::his7 and mcs4(D412N) Alleles
mcs4 was disrupted with his7 as follows.
First, the EcoRI/SphI fragment of pURB1-Mcs4-1
(Shieh et al., 1997
) was cloned into pT7T318u
(Amersham-Pharmacia, Little Chalfont, Buckinghamshire, United
Kingdom) to create pT7T318u-mcs4. Next, a 642-bp
XbaI/KpnI fragment of pT7T318u-mcs4 was replaced
with an XbaI/KpnI fragment from pEA2 (a gift from
C. Hoffman, Boston College, MA) that carries his7.
The mcs4::his7 fragment was then excised from
pT7T318u-mcs4::his7 by digestion with EcoRI and
SphI, gel purified, and transformed into CH429 cells.
Haploid disruptants were isolated on minimal medium lacking histidine
and stable integrants were confirmed by Southern blot.
The wild-type mcs4 genomic locus was replaced with
mcs4(D412N) as follows. A 1.56-kb fragment carrying the
mcs4(D412N) allele was excised from pREP41HM-Mcs4(D412N)
(Shieh et al., 1997
) by using NdeI and
BamHI and cotransformed with plasmid pIRT2(LEU2) (Basi
et al., 1993
) into a
mcs4::ura4 haploid (Shieh et
al., 1997
). Transformants were selected on minimal medium lacking
leucine and then replica-plated onto complete minimal medium containing 5-fluoro-orotic acid to select for uracil auxotrophs. Genomic DNA from these strains was subjected to PCR amplification by using the
oligonucleotides Mcs4-N1 and Mcs4-C1 (Shieh et al., 1997
), which generated a single 1.56-kb band in strains carrying the mcs4(D412N) allele. Successful gene replacement was
confirmed by sequencing of PCR-amplified DNA.
Isolation and Sequencing of mak1
PCR amplification was performed on genomic S. pombe
DNA by using the 5' oligonucleotide
CTI(A/G/C)TIGTIGA(G/A)GA(C/T)(A/G/C)A and the 3' oligonucleotide
GGCAT(C/T)TGI(A/C)I(A/G)TCCATIA, where I is inosine. The reaction was
performed for 30 cycles at an annealing temperature of 40°C. The PCR
products were separated by PAGE and a 160-bp fragment was purified and
ligated directly into pCRII (Invitrogen, San Diego, CA) before being
transformed into Escherichia coli DH5
. Plasmid inserts
from nine resulting colonies were sequenced by using M13 and T7
primers. Six were found to contain the same sequence, which has
homology to the conserved region of all response regulators. The160-bp
fragment was then used to screen a pURB1 genomic library (Barbet
et al., 1992
) and three overlapping clones were identified.
Sequencing of the largest clone, pURB1-mak1, was performed by using
custom-synthesized oligonucleotide primers, after constructing
unidirectional deletions by using exonuclease III and S1 nuclease
(Henikoff, 1984
).
Sequence Alignments
GAF domain alignments were identified by using PSI-BLAST
(Altschul et al., 1997
) and Mak3p as the query sequence.
Reiterative searching identified Mak2p with an e-value of 2e-06 after
round 1. Round 4 picked up the C.a. HK1 with an e-value of 1e-37. Round 5 picked up E. coli FhlA with an e-value of 5e-05. Round 7 picked up the ethylene receptor (Etr1) with an e-value of 2e-11. The PSI-BLAST converged before the PHYE sequences were picked up with e-values below the threshold. The program THREADER (Jones et
al., 1992
) was run on the putative PAS/PAC domains Mak1a, Mak1b,
Mak2, and Mak3. The top hits with high p were either the FixL or the ERG potassium channel PAS/PAC domains. The serine/threonine kinase sequences could also be picked up using PSI-BLAST with low e-values (<0.05) and columns of sequence identity can be seen in the alignment.
Deletion of mak1, mak2, mak3, and prr1 Sequences
To delete mak1 sequences, the
HindIII site in pBluescript II (Stratagene, La Jolla, CA)
was first destroyed by digesting with HindIII, filling the
5' overhangs with Klenow polymerase and religating to form pBSSK*.
Next, pURB1-mak1 was digested with BamHI and
PstI, and the resulting 4.0-kb fragment carrying 60% of the
mak1 ORF was ligated into pBSSK* that had been linearized
with BamHI and PstI, thus forming pBSSK*-mak1.
pBSSK*-mak1 was digested with HindIII to remove ~2.0 kb of
the mak1 ORF, including sequences critical for histidine
kinase function, which were replaced with a 1.6-kb HindIII
fragment bearing the ura4 marker from pREP42 (Basi et
al., 1993
). The resulting construct, pBSSK-mak1::ura4, was digested with BamHI and PstI and transformed
into a leu1-32/leu1-32 ura4-D18/ura4-D18 ade6-210/ade6-216
his7-366/his7-366 h
/h+ diploid strain (JM1429) (Table
1). Transformants were selected on
minimal medium lacking uracil and stable heterozygous diploids were
sporulated. Haploid colonies segregated 2:2 with respect to uracil
prototrophy, indicating that mak1 is a nonessential gene.
Disruptants were confirmed by Southern blot. A similar strategy was
used to disrupt mak1 sequences with the LEU2
marker.
|
To delete mak2 sequences, a 8.7-kb PvuII fragment
carrying 98% of the mak2 ORF was first excised from cosmid
clone c27E2 (Ressourcenzentrum, Berlin, Germany) and ligated into the
large PvuII fragment of pBSSK to create pBSSK-mak2.
pBSSK-mak2 was digested with HindIII to remove 4.6 kb (67%)
of the mak2 ORF, including the histidine kinase domain,
which was replaced with a 2.2-kb HindIII fragment bearing
the LEU2 marker from pREP41 (Basi et al., 1993
)
to create pBSSK-mak2::LEU2. The resulting construct,
pBSSK-mak2::LEU2, was digested with PvuII and the
resulting 6.8-kb fragment was transformed into the diploid strain
JM1429. Haploid mak2 disruptants were isolated as described
above for mak1. A similar strategy was used to disrupt
mak2 sequences with ura4.
To delete mak3 sequences, the
kanamycin-resistance gene was amplified from pFA6a-kanMX6 (Bahler
et al., 1998
) by PCR with the 5' oligonucleotide
GTTCTTCCTTATGAAAATTGAAGTTCAATA-ACTTATAACATGGGAGTAAATGATAATTAACAATTGTTGCC-CGGATCCCCGGGTTAATTAA, which is homologous both to sequences immediately upstream of the
mak3 ORF and to the 5' region of the kanMX6 cassette
(italics), and the 3' oligonucleotide
TGCCAAAATGTAACGAGCTCTTCTATGGTTTAGCATAGACATTC-ACGAGATTTTCCAAGAAAACAAAACAGAATTCGAGCTCGTT-TAAAC, which is homologous both to sequences downstream of the mak3
termination codon and to the 3' region of the kanMX6 cassette
(italics). The resulting fragment was transformed into CH429 cells and
G418-resistant colonies were isolated as described (Bahler et
al., 1998
). mak3::kanR haploid deletion
strains were confirmed by PCR and Southern blot.
To delete prr1 sequences, part of the prr1 gene was amplified by PCR from cosmid SPAC8D9 (Ressourcenzentrum) by using the 5' oligonucleotide Prr1.1, GTGTTGGATGTAAGAATTCCTTGAAAA-TTTGTTTGCTGG and the 3' oligonucleotide Prr1.2, AAAGTAGGTAACTGCAGAATTCATCGATATATTTGAAGTTATAGC (EcoRI sites in italics). The resulting 2.2-kb fragment was digested with EcoRI and ligated into pBR322 digested with the same enzyme to form pBR-prr1. pBR-prr1 was then digested with NsiI and XbaI and a PstI/XbaI fragment containing his7 was isolated from pBSSK-his7(R) (Millar, unpublished data) and cloned into these sites to generate pBR:prr1::his7. This cloning removes codons 67 to 209 of the prr1 ORF. pBR:prr1::his7 was digested with EcoRI and transformed into CH429 cells. Stable histidine prototrophs were selected and disruption of prr1 confirmed by PCR.
| |
RESULTS |
|---|
|
|
|---|
Phosphorylation of Mcs4p Controls Sty1p Kinase Only in Response to Peroxide
Previous genetic data indicate that the Mcs4p cell cycle regulator
acts upstream of two functionally redundant MAPKKKs, Wak1p/Wis4p and
Win1p, to control the activity of the Sty1p MAP kinase (Shiozaki et al., 1997
; Shieh et al., 1998
; Samejima
et al., 1998
). To examine whether Mcs4p interacts with
either of these MAPKKKs, a GST-Mcs4p fusion protein was expressed in
cells lacking endogenous Mcs4p but expressing Wak1p MAP fused to a
9-myc epitope tag. Proteins associating with GST-Mcs4p were identified
after affinity precipitation from cell extracts. Wak1p associated with
GST-Mcs4p but not glutathione S-transferase (GST) itself,
even in unstressed cells (Figure 1A). Binding of Mcs4p to Wak1p was not altered when cells were challenged with various environmental stresses (our unpublished data). This result indicates that Mcs4p associates with Wak1p and is thus an
integral component of the Sty1p MAPK complex. In this respect, Mcs4p
acts in a similar manner to the Ssk1p response regulator in S. cerevisiae, which binds directly to the N termini of the Ssk2p and
Ssk22p MAPKKKs.
|
In S. cerevisiae, inactivation of the Sln1p histidine kinase
in response to changes in external osmolarity results in
dephosphorylation of Ssk1p on a conserved aspartate residue (D554) in
the response-regulator domain (Maeda et al., 1994
). The
equivalent residue in Mcs4p is aspartate D412. In a previous article,
we reported that deleting mcs4 prevented activation of Sty1p
in response to multiple environmental insults (Shieh et al.,
1997
). Because the total absence of a protein could disrupt the
integrity of multiprotein complexes, we reexamined the role of Mcs4p
with respect to signal transmission via phosphorylation of D412 by
constructing a strain in which mcs4+ is
replaced by a mutant allele bearing a nonphosphorylatable asparagine at
residue 412. These mcs4(D412N) cells were viable but divided
at a smaller size (11.4 ± 0.4 µm) relative to wild-type cells
(14.3 ± 0.2 µm), although growth rate was unaffected (Figure 2B; our unpublished data). This
phenotype is similar to that of cells lacking the Pyp1p MAP kinase
phosphatase, suggesting that it is due to partial activation of Sty1p
(Millar et al., 1992
). Consistent with this we observed that
mcs4(D412N) sty1::ura4 cells divided at 22.9 ± 1.8 µm, a size similar to that of sty1::ura4 cells (23.1 ± 2.0 µm).
|
Wild-type or mcs4(D412N) strains bearing a six-histidine and hemagglutinin-tagged sty1 allele were subjected to various stresses, including 1 mM sodium arsenite, 3 µg/ml 4-nitroquinoline oxide, 1 mM hydrogen peroxide, 8 mM paraquat, 0.5 M NaCl, or subjected to a mild heat shock at 42°C. Phosphorylation of Sty1p was monitored by Western blot with an antibody that recognizes only the phosphorylated and, by inference, activated form of Sty1p (see MATERIALS AND METHODS). With the sole exception of hydrogen peroxide, which failed to activate Sty1p in a mcs4(D412N) background, phosphorylation of Sty1p was observed after all other stresses in both the wild-type and mcs4(D412N) cells (Figure 1B). To confirm this result, wild-type or mcs4(D412N) cells were subjected to increasing doses of either NaCl or hydrogen peroxide and the phosphorylation of Sty1p was monitored after 10 min of incubation. With NaCl, no difference was observed between wild-type and mcs4(D412N) cells in the activation of Sty1p, indicating that phosphorylation of Mcs4p D412 is not required for activation of Sty1p by hypertonic stress (Figure 1C). In contrast, activation of Sty1p by hydrogen peroxide was almost completely abolished in mcs4(D412N) cells irrespective of the dose (Figure 1C), suggesting that phosphorylation of Mcs4p D412 is required only for the activation of Sty1p MAP kinase to peroxide stress. This contrasts sharply with the results obtained with mcs4-deletion cells, suggesting either that Mcs4p is required for the structural integrity of the Sty1p MAP kinase complex or that modifications other than D412 phosphorylation of Mcs4p are required for signal transmission in response to other environmental stimuli.
Identification of a Family of Histidine Kinases in Fission Yeast
We next sought the putative peroxide receptor(s) that might
control Mcs4p phosphorylation, postulating that they might be structurally related to Sln1p, which contains both histidine-kinase and
response-regulator domains. Thus, degenerate primers were designed to
regions corresponding to the amino acid sequences L(I/V/L)VEDN and
(L/F)MD(I/L/V)QMP and used in low-temperature PCR amplification of
S. pombe genomic DNA. Six of nine individual PCR clones
contained the same nucleotide sequence, which translated to a
polypeptide with homology to response regulators. One of these was used
to isolate a full-length clone from a genomic library. By this means,
an uninterrupted 4.8-kb ORF was identified that gives rise to a
predicted protein of 1615 amino acids. The protein was found to
contain, in addition to a response-regulator domain, a region most
closely related to members of the histidine-kinase family (Figure 2A).
We termed this gene mak1, for Mcs4-associated kinase. By
screening the S. pombe genome sequence for similar sequences, we identified two additional histidine-kinase-like ORFs.
These intronless genes translate to predicted proteins of 2310 and 2344 amino acids, which we designated Mak2p and Mak3p, respectively (Figure
2A). Comparison of these proteins revealed a high degree of homology to
each other throughout, including both histidine-kinase and
response-regulator domains in the C termini. The Mak1p, Mak2p, and
Mak3p histidine kinases contain several additional domains in their N
termini that are absent in Sln1p. Adjacent to the histidine-kinase
domain are two (in the case of Mak1p) or one (in the case of Mak2p and
Mak3p) copy of a PAS/PAC domain (Crews and Fan, 1999
), which is found
throughout the evolutionary spectrum in proteins associated with light
reception and regulation (plant phytochromes), oxygen or redox
(E. coli Aer, ArcB, and FixL), oxygen-regulated
transcription (human HIF1
), and regulation of circadian rhythms
(such as mouse PER and CLOCK and Drosophila SIM) (Figures 2A
and 3A). Adjacent to this region in Mak2p
and Mak3p, but not Mak1p, is a GAF domain, which has also been
identified in phytochromes (such as Arabidopsis PhyE), redox-regulated transcription factors (E. coli FhlA), and
plant ethylene receptors (e.g., Arabidopsis Etr1) (Aravind
and Ponting, 1997
) (Figures 2A and 3B). Finally, at the extreme N
termini of Mak2p and Mak3p, we identified a domain that has
considerable homology to a family of atypical serine/threonine kinases
from prokaryotes, in particular Mycobacterium tuberculosis
PknB (Figures 2A and 3C). Although this domain is absent in Mak1p and
Sln1p, a similar domain is found in the Candida albicans HK1
histidine kinase, which has a similar overall domain architecture to
S. pombe Mak2p and Mak3p (Figures 2A and 3C).
|
To investigate the cellular functions of mak1, mak2, and mak3, internal sequences were replaced with auxotrophic markers. Disruption of mak1 with ura4 gave rise to viable haploids that divided at a marginally (~10%) smaller size than wild-type (our unpublished data). mak2::LEU2 and mak3::kanR haploid strains were also viable but had no discernible growth or cell-size defect. We also made doubly and triply deleted strains. The triple-deletion cells were viable and divided at 11.2 ± 0.5 µm (as opposed to 14.3 ± 0.2 µm for wild-type cells) and were phenotypically indistinguishable from mcs4(D412N) cells (Figure 2B). All double deletion strains divided at an intermediate size (our unpublished data). To test whether the Mak histidine kinases may function through Mcs4p, we constructed a mak1::ura4 mak2::LEU2 mak3::kanR mcs4::his7 quadruple mutant. These cells divided at 19.3 ± 1.2 µm, a size similar to that of the mcs4::his7 single mutant (19.1 ± 1.4 µm) (Figure 2B). This result suggests that the Mak1p, Mak2p, and Mak3p histidine kinases act upstream of Mcs4p.
Mak2p and Mak3p Regulate Sty1p Activity in Response to Peroxide
To determine whether any of the three histidine kinases is
involved in signaling to Sty1p, wild-type cells or cells
individually disrupted for mak1, mak2, or
mak3 were incubated in the presence of 1 mM hydrogen
peroxide and phosphorylation of Sty1p was monitored after various
lengths of time. Whereas a rapid increase in Sty1p phosphorylation was
observed in both wild-type and
mak1 cells, the
response to peroxide was almost completely absent in
mak2 or
mak3 cells
(Figure 4A). The Sty1p MAP kinase is
cytoplasmic in unstressed cells and translocates to the nucleus, where
it associates with and phosphorylates the Atf1p transcription factor, only in response to stress (Shiozaki and Russell, 1996
; Wilkinson et al., 1996
; Gaits et al., 1998
).
Phosphorylation of Atf1p can be monitored by a mobility shift on
SDS-PAGE (Shiozaki and Russell, 1996
). Cells expressing a six-histidine
and hemagglutinin-tagged atf1 allele (KS1479) or derivatives
independently deleted for mak1 (TS2029), mak2
(TS2030), or mak3 (TS2031) were incubated in the presence of
1 mM hydrogen peroxide for 5 min and phosphorylation of Atf1p was
monitored by SDS-PAGE. Although a rapid hyperphosphorylation of Atf1p
was observed in both wild-type and
mak1 cells,
no change in Atf1p mobility was observed in
mak2 or
mak3 cells
(Figure 4B). These results imply that Sty1p is not fully
phosphorylated, activated, or translocated to the nucleus in response
to peroxide stress in the absence of Mak2p or Mak3p. Given the
similarity to the Sln1p-Ypd1p-Ssk1p pathway in S. cerevisiae, we infer that Mak2p and Mak3p are responsible for the
phosphorylation of Mcs4p (presumably via Mpr1p) and consequently the
activity of the Sty1p MAP kinase.
|
Mak1p, Mak2p, and Mak3p Control the Transcriptional Response to Peroxide
In S. pombe, a number of genes, including those
encoding the tyrosine-specific MAP kinase phosphatase (pyp2)
and glutathione peroxidase (gpx1), are induced in response
to peroxide in a Sty1p- and Atf1p-dependent manner (Millar et
al., 1995
; Degols et al., 1996
; Wilkinson et
al., 1996
; Toone et al., 1998
; Yamada et
al., 1999
). Induction of other genes such as those for thioredoxin reductase (trr1) and catalase (ctt1) are also
dependent on Sty1p but require one of two distinct transcription
factors, Pap1p and Prr1p (Toone et al., 1998
; Ohmiya
et al., 1999
). To determine whether peroxide-induced gene
expression is affected by loss of one or more of the Mak histidine
kinases, wild-type cells or those deleted for mak1,
mak2, or mak3 were incubated in the presence of 1 mM hydrogen peroxide and the levels of various transcripts were
assessed by Northern blot analysis. Induction of both pyp2 and gpx1 was severely reduced in
mak2 and
mak3 cells
but not in
mak1 cells (Figure
5). Conversely, induction of
ctt1 was significantly reduced in
mak1 cells but unaffected in
mak2 and
mak3 cells (Figure 5). These results indicate that Mak2p and Mak3p are required for Atf1p-dependent, but not Pap1p/Prr1p-dependent, gene expression in
response to peroxide stress. This is presumably because Sty1p is not
activated and therefore unable to phosphorylate and activate Atf1p. On
the other hand, Mak1p appears to be required for effective transcription through a Pap1p- or Prr1p-dependent pathway. Deletion of
mak1, mak2, or mak3 had no effect on
the activation of Sty1p or induction of gene expression in response to
all other stresses tested (our unpublished data). We conclude
that at least two distinct phospho-relay systems control the
SAPK-dependent transcriptional response to peroxide stress in S. pombe.
|
Two Phospho-relay Systems Are Required for Protection against Free Radical Attack
Previous studies have shown that the Atf1p and Pap1p
transcription factors control distinct but complementary roles in the protection of S. pombe cells from free-radical attack. Cells
lacking both Atf1p and Pap1p are more sensitive to peroxide attack than cells lacking either protein alone (Nguyen et al., 2000
). In
S. cerevisiae, Yap1p (the Pap1p homolog) plays a
functionally overlapping role with the response-regulator protein Skn7p
in the transcriptional response to peroxide stress (Morgan et
al., 1997
). Because Prr1p, a homolog of S. cerevisiae
Skn7p, is also required for peroxide-induced catalase expression in
S. pombe, Prr1p and Pap1p may share a similar relationship
(Ohmiya et al., 1999
). To determine the role of various two-component signaling molecules in the protection of S. pombe from peroxide attack, wild-type cells or cells lacking Atf1p
or Prr1p were tested for their ability to survive exposure to an acute
dose of hydrogen peroxide either in the presence or absence of the
Mak2p and Mak3p histidine kinases. Whereas cells lacking Atf1p alone
showed little sensitivity to peroxide (our unpublished data),
cells lacking Prr1p were more sensitive than wild-type but not as
sensitive as cells lacking both Atf1p and Prr1p (Figure 6). These results suggest that Atf1p and
Prr1p control distinct aspects of the response to peroxide in S. pombe. Because Mak2p and Mak3p appear to control Atf1p-dependent
gene expression, we next tested the sensitivity to peroxide of cells
lacking Mak2p or Mak3p. We found that cells lacking both Mak2p and
Mak3p were no more sensitive to peroxide than wild-type when Prr1p was
present but displayed increased sensitivity when Prr1p was absent
(Figure 6). These results suggest that at least two distinct
phospho-relay pathways contribute to the protection of S. pombe cells from peroxide attack. The role of Mak1p in this
process will be dealt with in detail in a subsequent study.
|
| |
DISCUSSION |
|---|
|
|
|---|
As reported previously, we and others have identified Mcs4p as an
upstream regulator of the S. pombe Sty1p MAPK pathway
(Shiozaki et al., 1997
; Shieh et al.,
1997
). Here we show that Mcs4p associates with Wak1p, one of two
MAPKKKs that control phosphorylation of Sty1p. Thus, Mcs4p acts in a
manner similar to that of the S cerevisiae Ssk1p
response-regulator protein, which binds the Ssk2p and Ssk22p MAPKKKs to
regulate the Hog1p MAP kinase (Posas and Saito, 1998
). The activity of
Ssk1p is controlled by phosphorylation on aspartate 554, an event that
is initiated by a transmembrane histidine kinase, Sln1p.
Phosphotransfer between Sln1p and Ssk1p requires phosphorylation of an
intermediate protein, Ypd1p, on histidine 64. In this article, we
report that phosphorylation of the equivalent residue in Mcs4p (D412)
is required for activation of the Sty1p MAP kinase, but only in
response to hydrogen peroxide and not to a battery of other
environmental insults, including osmotic stress. Surprisingly, paraquat, which induces superoxide radicals and, as a consequence, the
production of hydrogen peroxide, still activates Sty1p in mcs4(D412N) cells. We conclude that either the superoxide
radical is sensed by a distinct mechanism or, at the concentration
used, paraquat activates stress signals other than the overproduction of peroxide. Similarly, heavy metal toxicity, also regarded as an
oxidative stress, appears to require a distinct pathway to activate
Sty1p that does not involve phosphorylation of Mcs4p. Together, these
results suggest that Mcs4p acts in a two-component system that
specifically senses peroxide stress. Indeed, Nguyen et al. (2000)
have
recently shown that an S. pombe homolog of S. cerevisiae Ypd1p, Mpr1p, is also required for activation of Sty1p
by peroxide and that this is mediated through a conserved histidine
residue. In this article, we present evidence that deletion of either
the Mak2p or Mak3p histidine kinase, but not Mak1p, prevents
phosphorylation of Sty1p in response to hydrogen peroxide. As a
consequence, Sty1p is not activated as judged by the absence of Atf1p
phosphorylation and failure of Atf1-dependent gene expression. These
results strongly suggest that Sty1p is controlled by a phospho-relay system that is similar to the Sln1p-Ypd1p-Ssk1p pathway in S. cerevisiae, but which is initiated by two histidine kinases, Mak2p and Mak3p (see model in Figure 7).
|
An important difference between the S. pombe and S. cerevisiae histidine kinases is that Mak2p and Mak3p specifically
sense oxidative stress, whereas Sln1p senses changes in external
osmolarity. The domain architecture of the Mak2p and Mak3p proteins
provides some clue as to why this may be. In particular, both proteins contain a single repeat of a PAS/PAC domain, which has been identified in a variety of prokaryotic sensors of oxygen or redox, including other
members of the histidine-kinase superfamily such as E. coli Aer and ArcB and Rhizobium meliloti FixL, but not Sln1p
(Crews and Fan, 1999
). Importantly, the PAS/PAC domain of FixL binds heme as a prosthetic group. Changes in the availability of oxygen to
the heme moiety induce a conformational change in the PAS/PAC domain
that causes an alteration in the activity of the adjoining histidine-kinase domain (Gong et al., 1998
; Pellequer
et al., 1999
). It is possible that a similar mechanism may
regulate the activity of Mak2p and Mak3p. The PAS/PAC domain may also
explain why both of these histidine kinases are required for signal
transmission to Sty1p, because this domain has been shown to mediate
protein-protein interaction in other species (Huang et al.,
1993
, 1995
). Although Mak2p and Mak3p appear to be exclusively
cytoplasmic in S. pombe, we have not been able to
demonstrate an interaction between them (Quinn, Buck, and Millar,
unpublished data). Thus, we cannot yet rule out the possibility that
Mak2p and Mak3p initiate independent signals that are both required for
activation of Wak1p.
How is the peroxide signal actually transduced to the Wak1p
MAPKKK? It is possible that the peroxide signal activates the histidine-kinase domains of Mak2p and/or Mak3p. In this manner, the
response-regulator domains of Mak2p, Mak3p, or both would become
phosphorylated and the phosphate group would, in turn, be transferred
to Mpr1p. This conclusion is supported by the observation that peroxide
induces Mpr1p to associate with Mcs4p and mutation of histidine 221 in
Mpr1p abolishes this association (Nguyen et al., 2000
).
Conversely, it is also formally possible that the peroxide signal
inhibits the activity of Mak2p and/or Mak3p, leading to
dephosphorylation of Mpr1p and Mcs4p, and that the dephosphorylated form of Mcs4p activates Wak1p. Notably, mcs4(D412N) cells
show a higher basal level of Sty1p phosphorylation than
mcs4+ cells, suggesting that the
dephosphorylated form of Mcs4p is active. Analysis of the in vivo
phosphorylation status of Mak2p, Mak3p, Mpr1p, and Mcs4p will be
necessary to distinguish between these possibilities.
In contrast to Mak2p and Mak3p, Mak1p does not control Sty1p activity
or Atf1p-dependent gene expression. Instead, we find that Mak1p is
partially required for the induction of catalase in response to
peroxide stress. It is intriguing in this respect that Mak1p also
contains two PAS/PAC repeats, suggesting that Mak1p may also function
as a peroxide sensor. Induction of catalase requires both the Pap1p
transcription factor and Prr1p, a response-regulator protein that is
homologous to the S. cerevisiae Skn7p transcription factor
(Ohmiya et al., 1999
). Skn7p shares an overlapping function with the Yap1p transcription factor in the response to oxidative stress
in S. cerevisiae (Brown et al., 1993
; Morgan
et al., 1995
; Krems et al., 1996
; Morgan et
al., 1997
). It is possible that Mak1p regulates the activity of
Prr1p via phosphorylation of an independent pool of Mpr1p, but the
details of such a pathway are unclear because deletion of
mpr1 causes superinduction of catalase expression (Nguyen
et al., 2000
). Nevertheless, these results suggest that the
transcriptional response to free radical attack is regulated by at
least two distinct phospho-relay pathways in fission yeast.
In addition to the PAS/PAC motif, Mak2p and Mak3p contain a GAF
domain, which has been identified in a diverse array of
phototransducing proteins, including cGMP-specific and -stimulated
phosphodiesterases, Anabena adenylate cyclase, and the
E. coli FhlA transcriptional regulator (Aravind and Ponting,
1997
). One function of the GAF domain that has been well characterized
is that of cGMP binding (Charbonneau et al., 1990
).
Intriguingly, the chromophore attachment site in plant and
cyanobacterial phytochromes occurs on a conserved cysteine residue
within their single GAF domain (Figure 3B; Yeh and Lagarias, 1998
).
Although the overall domain architecture of Mak2p and Mak3p is similar
to that of the phytochrome family, their GAF domains lack this residue.
Thus, the function of this domain in Mak2 and Mak3 is at present
unknown. Intriguingly, Mak2p and Mak3p are most closely related to a
histidine kinase in the human pathogen C. albicans, C.a. HK1
(Calera et al., 1998
). In addition to histidine-kinase,
response-regulator and GAF domains, all three proteins possess an
N-terminal domain that is strikingly similar to a series of atypical
serine/threonine kinase in prokaryotes, in particular M. tuberculosis PknB. To our knowledge, these are the only known
proteins to have two separate kinase domains of apparently distinct
specificity. Our initial analysis suggests that these N-terminal
domains in Mak2p and Mak3p are not required for signal transmission to
Sty1p (Quinn, Buck, and Millar, unpublished data). Nevertheless, it is
tempting to speculate that Mak2p, Mak3p, and C.a. HK1 are derived from
a fusion of distinct ORFs in an ancestral prokaryotic operon that
functioned in a common signaling pathway to sense and respond to free
radical attack. Although it is not clear whether C.a. HK1, which lacks
a PAS/PAC motif, acts as a peroxide sensor, homozygous null diploids
for HK1 are nonvirulent in a murine model (Calera et al.,
1998
, 1999
). Furthermore, a homolog of Ssk1p and Mcs4p is also required
for virulence in this system, suggesting that C.a. HK1 may function in
a phospho-relay system similar to that described here (Calera and
Calderone, 1999
; Calera et al., 2000
).
The absence of structural homologs of Mak2p and Mak3p in S. cerevisiae could explain why the Hog1p MAP kinase is activated only in response to osmotic stress and not to hydrogen peroxide. Indeed, S. cerevisiae has only one histidine kinase (Sln1p), whereas at least three have been identified in C. albicans and S. pombe. In addition, the C. albicans and S. pombe histidine kinases are not identical to each other. Although an osmosensing Sln1p homolog exists in C. albicans (C.a. Sln1), it is unlikely that Sty1p is controlled by a Sln1p-like molecule in S. pombe, because activation of Sty1p in response to osmotic stress does not require phosphorylation of Mcs4p. Conversely, no homologs of Mak1p or C.a. Nik1 have been identified in C. albicans and S. pombe, respectively. It seems possible, therefore, that all fungi are derived from a common eukaryotic ancestor that possessed multiple two-component regulatory systems that have been selectively lost by evolutionary pressure.
To date, no structural homologs of the phospho-relay proteins have been identified in mammals. Thus, control of SAPK pathways by two-component systems is likely to be unique to lower eukaryotes. Importantly, we have shown that the phospho-relay system is not required for activation of the S. pombe Sty1p MAPK in response to environmental stresses that activate the mammalian SAPKs, including heat shock, the protein-synthesis inhibitor anisomycin, agents that cause oxidative damage such heavy metals (e.g., arsenic or cadmium), superoxide anion generators (e.g., paraquat), or UV light mimetics (e.g., 4-nitroquinoline oxide). We tentatively propose that each environmental stress is sensed by a specific cellular receptor(s) that triggers activation of Sty1p, possibly by regulating the activity of the Wak1p/Wis4p and/or Win1p MAPKKKs (Figure 7). We will need to identify other upstream activators of the Sty1p pathway to determine whether these are structurally or functionally conserved in mammals.
| |
ACKNOWLEDGMENTS |
|---|
We thank members of the Division of Yeast Genetics for helpful advice, discussions, and critical reading of the manuscript. T.S.P. was supported by a short-term postdoctoral fellowship from the Human Frontiers for Science Program (HFSP). H.M. was supported by a postdoctoral fellowship from La Dirección General de Investigación Científica y Téchnica from the Spanish Government. This research was supported by a Medical Research Council project grant to J.B.A.M. and by a Biotechnology and Biological Sciences Research Council project grant (13/C08381) to B.M.
| |
FOOTNOTES |
|---|
* These authors contributed equally to this work.
Permanent address: Department of Molecular
Microbiology, Research Institute for Microbial Diseases, Osaka
University, 3-1 Yamadaoka Suita, Osaka 565, Japan.
¶ Corresponding authors. E-mail addresses: jmillar{at}nimr.mrc.ac.uk and B.A.Morgan{at}newcastle.ac.uk.
| |
REFERENCES |
|---|
|
|
|---|
-glucan assembly, encodes a product with domains homologous to prokaryotic two-component regulators and to heat shock transcription factors.
J. Bacteriol.
175, 6908-6915This article has been cited by other articles:
![]() |
Y.-S. Bahn Master and Commander in Fungal Pathogens: the Two-Component System and the HOG Signaling Pathway Eukaryot. Cell, December 1, 2008; 7(12): 2017 - 2036. [Full Text] [PDF] |
||||
![]() |
P. J. Kennedy, A. A. Vashisht, K.-L. Hoe, D.-U. Kim, H.-O. Park, J. Hayles, and P. Russell A Genome-Wide Screen of Genes Involved in Cadmium Tolerance in Schizosaccharomyces pombe Toxicol. Sci., November 1, 2008; 106(1): 124 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gao, M. K. Davidson, and W. P. Wahls Distinct regions of ATF/CREB proteins Atf1 and Pcr1 control recombination hotspot ade6-M26 and the osmotic stress response Nucleic Acids Res., May 1, 2008; 36(9): 2838 - 2851. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sanso, M. Gogol, J. Ayte, C. Seidel, and E. Hidalgo Transcription Factors Pcr1 and Atf1 Have Distinct Roles in Stress- and Sty1-Dependent Gene Regulation Eukaryot. Cell, May 1, 2008; 7(5): 826 - 835. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chen, C. R.M. Wilkinson, S. Watt, C. J. Penkett, W. M. Toone, N. Jones, and J. Bahler Multiple Pathways Differentially Regulate Global Oxidative Stress Responses in Fission Yeast Mol. Biol. Cell, January 1, 2008; 19(1): 308 - 317. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cheetham, D. A. Smith, A. da Silva Dantas, K. S. Doris, M. J. Patterson, C. R. Bruce, and J. Quinn A Single MAPKKK Regulates the Hog1 MAPK Pathway in the Pathogenic Fungus Candida albicans Mol. Biol. Cell, November 1, 2007; 18(11): 4603 - 4614. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Chapeland-Leclerc, P. Paccallet, G. Ruprich-Robert, D. Reboutier, C. Chastin, and N. Papon Differential Involvement of Histidine Kinase Receptors in Pseudohyphal Development, Stress Adaptation, and Drug Sensitivity of the Opportunistic Yeast Candida lusitaniae Eukaryot. Cell, October 1, 2007; 6(10): 1782 - 1794. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Vargas-Perez, O. Sanchez, L. Kawasaki, D. Georgellis, and J. Aguirre Response Regulators SrrA and SskA Are Central Components of a Phosphorelay System Involved in Stress Signal Transduction and Asexual Sporulation in Aspergillus nidulans Eukaryot. Cell, September 1, 2007; 6(9): 1570 - 1583. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Jones, S. E. Greer-Phillips, and K. A. Borkovich The Response Regulator RRG-1 Functions Upstream of a Mitogen-activated Protein Kinase Pathway Impacting Asexual Development, Female Fertility, Osmotic Stress, and Fungicide Resistance in Neurospora crassa Mol. Biol. Cell, June 1, 2007; 18(6): 2123 - 2136. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Soto, A. Nunez, M. Madrid, J. Vicente, M. Gacto, and J. Cansado Transduction of centrifugation-induced gravity forces through mitogen-activated protein kinase pathways in the fission yeast Schizosaccharomyces pombe Microbiology, May 1, 2007; 153(5): 1519 - 1529. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Georgiou, N. Patsoukis, I. Papapostolou, and G. Zervoudakis Sclerotial metamorphosis in filamentous fungi is induced by oxidative stress Integr. Comp. Biol., December 1, 2006; 46(6): 691 - 712. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Hernandez-Lopez, F. Randez-Gil, and J. A. Prieto Hog1 Mitogen-Activated Protein Kinase Plays Conserved and Distinct Roles in the Osmotolerant Yeast Torulaspora delbrueckii. Eukaryot. Cell, August 1, 2006; 5(8): 1410 - 1419. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hancock, R. Desikan, J. Harrison, J. Bright, R. Hooley, and S. Neill Doing the unexpected: proteins involved in hydrogen peroxide perception J. Exp. Bot., May 1, 2006; 57(8): 1711 - 1718. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takatsume, S. Izawa, and Y. Inoue Methylglyoxal as a Signal Initiator for Activation of the Stress-activated Protein Kinase Cascade in the Fission Yeast Schizosaccharomyces pombe J. Biol. Chem., April 7, 2006; 281(14): 9086 - 9092. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Madrid, T. Soto, H. K. Khong, A. Franco, J. Vicente, P. Perez, M. Gacto, and J. Cansado Stress-induced Response, Localization, and Regulation of the Pmk1 Cell Integrity Pathway in Schizosaccharomyces pombe J. Biol. Chem., January 27, 2006; 281(4): 2033 - 2043. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Rodriguez-Gabriel and P. Russell Distinct Signaling Pathways Respond to Arsenite and Reactive Oxygen Species in Schizosaccharomyces pombe Eukaryot. Cell, August 1, 2005; 4(8): 1396 - 1402. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Bahn, K. Kojima, G. M. Cox, and J. Heitman Specialization of the HOG Pathway and Its Impact on Differentiation and Virulence of Cryptococcus neoformans Mol. Biol. Cell, May 1, 2005; 16(5): 2285 - 2300. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Desikan, J. T. Hancock, J. Bright, J. Harrison, I. Weir, R. Hooley, and S. J. Neill A Role for ETR1 in Hydrogen Peroxide Signaling in Stomatal Guard Cells Plant Physiology, March 1, 2005; 137(3): 831 - 834. [Full Text] [PDF] |
||||
![]() |
M. Madrid, T. Soto, A. Franco, V. Paredes, J. Vicente, E. Hidalgo, M. Gacto, and J. Cansado A Cooperative Role for Atf1 and Pap1 in the Detoxification of the Oxidative Stress Induced by Glucose Deprivation in Schizosaccharomyces pombe J. Biol. Chem., October 1, 2004; 279(40): 41594 - 41602. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Smith, S. Nicholls, B. A. Morgan, A. J.P. Brown, and J. Quinn A Conserved Stress-activated Protein Kinase Regulates a Core Stress Response in the Human Pathogen Candida albicans Mol. Biol. Cell, September 1, 2004; 15(9): 4179 - 4190. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kruppa, B. P. Krom, N. Chauhan, A. V. Bambach, R. L. Cihlar, and R. A. Calderone The Two-Component Signal Transduction Protein Chk1p Regulates Quorum Sensing in Candida albicans Eukaryot. Cell, August 1, 2004; 3(4): 1062 - 1065. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Xue, C. K. Nguyen, A. Romans, and G. S. May A Mitogen-Activated Protein Kinase That Senses Nitrogen Regulates Conidial Germination and Growth in Aspergillus fumigatus Eukaryot. Cell, April 1, 2004; 3(2): 557 - 560. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hirota, T. Hasemi, T. Yamada, K.-i. Mizuno, C. S. Hoffman, T. Shibata, and K. Ohta Fission yeast global repressors regulate the specificity of chromatin alteration in response to distinct environmental stresses Nucleic Acids Res., February 3, 2004; 32(2): 855 - 862. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Catlett, O. C. Yoder, and B. G. Turgeon Whole-Genome Analysis of Two-Component Signal Transduction Genes in Fungal Pathogens Eukaryot. Cell, December 1, 2003; 2(6): 1151 - 1161. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Castillo, A. P. Vivancos, N. Jones, J. Ayte, and E. Hidalgo Schizosaccharomyces pombe Cells Lacking the Ran-binding Protein Hba1 Show a Multidrug Resistance Phenotype Due to Constitutive Nuclear Accumulation of Pap1 J. Biol. Chem., October 17, 2003; 278(42): 40565 - 40572. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. S. Moye-Rowley Regulation of the Transcriptional Response to Oxidative Stress in Fungi: Similarities and Differences Eukaryot. Cell, June 1, 2003; 2(3): 381 - 389. [Full Text] [PDF] |
||||
![]() |
K. Furukawa, Y. Katsuno, T. Urao, T. Yabe, T. Yamada-Okabe, H. Yamada-Okabe, Y. Yamagata, K. Abe, and T. Nakajima Isolation and Functional Analysis of a Gene, tcsB, Encoding a Transmembrane Hybrid-Type Histidine Kinase from Aspergillus nidulans Appl. Envir. Microbiol., November 1, 2002; 68(11): 5304 - 5310. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Greenall, A. P. Hadcroft, P. Malakasi, N. Jones, B. A. Morgan, C. S. Hoffman, and S. K. Whitehall Role of Fission Yeast Tup1-like Repressors and Prr1 Transcription Factor in Response to Salt Stress Mol. Biol. Cell, September 1, 2002; 13(9): 2977 - 2989. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Smith, W. M. Toone, D. Chen, J. Bahler, N. Jones, B. A. Morgan, and J. Quinn The Srk1 Protein Kinase Is a Target for the Sty1 Stress-activated MAPK in Fission Yeast J. Biol. Chem., August 30, 2002; 277(36): 33411 - 33421. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hohmann Osmotic Stress Signaling and Osmoadaptation in Yeasts Microbiol. Mol. Biol. Rev., June 1, 2002; 66(2): 300 - 372. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sanchez-Piris, F. Posas, V. Alemany, I. Winge, E. Hidalgo, O. Bachs, and R. Aligue The Serine/Threonine Kinase Cmk2 Is Required for Oxidative Stress Response in Fission Yeast J. Biol. Chem., May 10, 2002; 277(20): 17722 - 17727. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Quinn, V. J. Findlay, K. Dawson, J. B.A. Millar, N. Jones, B. A. Morgan, and W. M. Toone Distinct Regulatory Proteins Control the Graded Transcriptional Response to Increasing H2O2 Levels in Fission Yeast Schizosaccharomyces pombe Mol. Biol. Cell, March 1, 2002; 13(3): 805 - 816. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Santos and K. Shiozaki Fungal Histidine Kinases Sci. Signal., September 4, 2001; 2001(98): re1 - re1. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||