![]() |
|
|
Vol. 12, Issue 5, 1341-1352, May 2001


and
Institute for Cancer Research and Treatment, IRCC,
University of Torino Medical School, 10060 Candiolo, Torino, Italy; and
§Department of Anatomy, Pharmacology, and Forensic
Medicine, University of Torino Medical School, 10126 Torino, Italy
| |
ABSTRACT |
|---|
|
|
|---|
Macrophage stimulating protein (MSP), also known as hepatocyte
growth factor-like, is a soluble cytokine that belongs to the family of the plasminogen-related growth factors (PRGFs). PRGFs are
/
heterodimers that bind to transmembrane tyrosine kinase receptors. MSP was originally isolated as a chemotactic factor for
peritoneal macrophages. Through binding to its receptor, encoded by the
RON gene, it stimulates dissociation of epithelia and works as an
inflammatory mediator by repressing the production of nitric oxide
(NO). Here, we identify a novel role for MSP in the central nervous
system. As a paradigm to analyze this function we chose the hypoglossal
system of adult mice. We demonstrate in vivo that either administration
of exogenous MSP or transplantation of MSP-producing cells at the
proximal stump of the resected nerve is sufficient to prevent
motoneuron atrophy upon axotomy. We also show that the MSP gene is
expressed in the tongue, the target of the hypoglossal nerve, and that
MSP induces biosynthesis of Ron receptor in the motoneuron somata.
Finally, we show that MSP suppresses NO production in the injured
hypoglossal nuclei. Together, these data suggest that MSP is a novel
neurotrophic factor for cranial motoneurons and, by regulating the
production of NO, may have a role in brain plasticity and regeneration.
| |
INTRODUCTION |
|---|
|
|
|---|
Macrophage stimulating protein (MSP; Skeel et al.,
1991
; Yoshimura et al., 1993
), also known as hepatocyte
growth factor-like (Degen et al., 1991
), belongs to
the family of plasminogen-related growth factors (PRGF; Donate et
al., 1994
), of which hepatocyte growth factor (HGF) is the
prototype. These soluble cytokines share a common structure: they are
heterodimeric polypeptides comprising two subunits joined by disulfide
bonds, respectively, characterized by the presence of four kringle
domains and a nonfunctional serine-protease-like domain (Naldini
et al., 1992
; Waltz et al., 1997
). The PRGF
receptors of MSP and HGF identified so far are Ron for MSP (Gaudino
et al., 1994
) and Met for HGF (Bottaro et al.,
1991
; Naldini et al., 1991
).
MSP/hepatocyte growth factor-like was originally isolated as a
chemotactic factor for peritoneal macrophages (Leonard and Skeel, 1978
,
1979
), although it may also act as a mitogen or morphogen in a variety
of other cell types such as osteoclasts (Kurihara et al.,
1996
, 1998
), epithelial cells (Medico et al., 1996
),
hematopoietic precursors (Broxmeyer et al., 1996
), and
carcinoma cells (Maggiora et al., 1998
; Willett et
al., 1998
). It has been shown that in exudate macrophages MSP
inhibits the production of nitric oxide (NO), an inflammatory mediator
produced in response to treatment with bacterial lipopolysaccharide or
interferon-gamma (Wang et al., 1994
; Chen et al.,
1998
).
MSP transcripts are present in the liver and, at a lower amount,
in kidney and pancreas (Bezerra et al., 1993
; Yoshimura
et al., 1993
). Transcripts of RON (also known as STK in
mouse) are detectable in many different organs during murine
development. Relatively late in development, high levels of this
receptor are found in the trigeminal ganglion and in the hypoglossal
nucleus (Gaudino et al., 1995
; Quantin et al.,
1995
). In adult mice, RON transcripts are almost ubiquitous, except in
spleen and heart (Gaudino et al., 1995
).
MSP knockout animals develop normally, are fertile, and grow to
adulthood in spite of liver abnormalities due to lipid-containing cytoplasmic vacuoles in hepatocytes (Bezerra et al., 1998
).
Two different Ron mutants, generated with different targeting
strategies, are available. They display two different phenotypes: the
first mutant develops normally to adulthood (Correl et al.,
1997
), whereas the second shows an embryonic lethal phenotype (Murakoa
et al., 1999
). Remarkably, both Ron mutant mice are highly
prone to septic shock.
Several growth factors such as fibroblast growth factors, insulin-like
growth factors (I and II), and HGF itself are essential in brain
development (Ebens et al., 1996
; Ortega et al.,
1998
; Gao et al., 1999
) and promote motoneuron survival
during adulthood (Unsicker et al., 1987
; Cuevas et
al., 1995
; Ebens et al., 1996
; Teng et al.,
1998
; Pu et al., 1999
). Many of them, delivered at the
proximal nerve stump after axotomy, are taken up and transported to the
motoneuron somata (Funakoshi et al., 1993
). It has been shown that these paracrine circuits between muscle targets and brainstem motoneuron nuclei are essential in many regenerative and
remodeling processes of the central nervous system (CNS) (DiStefano et al., 1992
; Li et al., 1994
; Blottner et
al., 1997
). Here, we identify a novel role for MSP, showing
that this molecule is a neurotrophic factor that prevents atrophy of
motoneurons upon axotomy.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents
MSP and control solution for the in vivo experiments were
prepared from baculovirus-infected Sf9 cells (Maggiora et
al., 1998
). Both supernatants underwent to two serial
precipitations with ammonium sulfate-saturated solution (40%, to
remove most of the high molecular weight proteins, and 50% to
precipitate MSP). The precipitate was solubilized and dialyzed in
phosphate-buffered saline (PBS) to a final concentration of 1 µg/ml.
Before treatment on mice, MSP activity was tested performing a Ron
phosphorylation assay on T47D cells.
MSP antibodies were obtained by immunizing rabbits with human MSP. MSP
cDNA (Gaudino et al., 1994
) was treated with the restriction nucleases EcoRI and XhoI. The resulting fragment
was cloned in the eukaryotic vector pRK7His
previously digested with EcoRI and HindIII. The
recombinant construct was transfected in BOSC cells and their
conditioned medium was collected after 3 d and after 1 wk. MSP
protein was purified onto a nickel column and eluted using imidazol.
The factor was dialyzed and rabbits were immunized (500 µg/animal).
After 4 wk and two subsequent reimmunizations, polyclonal antibodies
were obtained. These antibodies cross-react with the murine homologue,
both in blot and in immunohistochemistry, and were used for all the analyses.
Cell-mediated MSP Production
The cDNA encoding the full-length MSP (Gaudino et
al., 1994
) was treated with the restriction nuclease
EcoRI, blunt-ended and retreated with BamHI, and
then it was ligated in the eukaryotic expression vector pBat,
previously treated with SalI, and then blunted and retreated
with BamHI. Neuro2A cells were maintained in DMEM plus 10%
fetal calf serum. They were grown to 60% confluence and transfected by
calcium-phosphate coprecipitation (CellPhect Transfection kit; Amersham
Pharmacia Biotech, Uppsala, Sweden) either with MSP cDNA or with an
empty vector (10 µg of DNA/p-100 culture dish). Cells were
glycerol-shocked 12 h after transfection and collected after
further 48 h. The efficiency of transfection was tested by
checking the presence of MSP in the conditioned medium and in the cells
by Western blot techniques.
Surgery
Forty 4-mo-old FVB albino mice from our breeding colony were used for this study. Animals had free access to food and water. All experimental procedures on living animals were performed under the supervision of a veterinarian, according to guidelines for care and use of laboratory animals as published by the Italian Ministry of Health (DDL 116/92).
Mice were anesthetized with Avertin (240 mg/kg tribromoethanol, diluted 1.2% in PBS). To perform axotomy, the left hypoglossal nerve was exposed close to the posterior border of the mylohyoid muscle and cut. Upon nerve resection two routes of MSP administration were used.
First, an osmotic minipump (mean pumping rate 0.51 µl/h, Alzet 1007D; Alza, Mountain View, CA) filled with 1 µg/ml MSP was placed in the pectoral region, with the catheter (0.04 cm O.D.) positioned close to the proximal stump of the resected nerve and sutured to the masseter muscle. Conditioned medium from mock-infected Sf9 cells was used as a control.
Second, 300,000 Neuro2A cell pellets transfected with MSP were mixed to a foamy gel and placed close to the proximal stump of the axotomized hypoglossal nerve. Neuro2A cells transfected with an empty vector supplied the control.
All mice were killed with an overdose of anesthetic 48 h or 1 wk
after surgery. The ones used for immunohistochemistry and in situ
hybridization were perfused through the left ventricle with a washing
solution of 0.1 M phosphate buffer pH 7.4 (PB) followed by fixative
(4% paraformaldehyde in PB). The brainstem and the tongue were
dissected, postfixed 4 h in the same fixative, and immersed in PB
plus 30% sucrose overnight for cryoprotection. The brainstems used for
polymerase chain reactions (PCRs) and Western blots were dissected and
then immediately frozen in liquid nitrogen and transferred at
80°C.
Immunohistochemistry
After fixation, 50-µm-thick sections from mice killed 1 wk after axotomy were reacted free-floating with a polyclonal antibody against choline acetyl transferase (ChAT) (1:500 in PBS; Chemicon International, Temecula, CA). Binding of primary antibody was visualized by incubating in biotinylated goat anti-rabbit IgG antibody (1:200 in PBS; Vector Laboratories, Burlingame, CA) for 1 h at room temperature, followed by avidin-biotin-peroxidase complex (Elite ABC kit; Vector Laboratories); the peroxidase activity was detected using 3,3'-diaminobenzidine tetrahydrochloride (Sigma-Aldrich Chemie, Steinheim, Germany) as a chromogen. Sections were transferred on gelatin-coated slides, dehydrated, and mounted in Entellan (Sigma-Aldrich Chemie). In these experiments six axotomized animals were infused with MSP and seven with conditioned medium from mock-infected Sf9 cells; four mice were transplanted with Neuro2A cells expressing MSP and four with Neuro2A transfected with an empty vector. Two animals were infused, after axotomy, with saline solution. Slides were observed and photographed with a Leitz Dialux light microscope (Leitz Gmbh, Oberkochen, Germany) and the number of ChAT-positive profiles in the hypoglossal nuclei of both sides counted. Intergroup differences were statistically evaluated by the two-tailed paired Student's t test and were considered significant when p < 0.05.
After fixation, 50-µm-thick cryostat sections from the brainstem were stained with polyclonal antibodies against Ron (Santa Cruz Biotechnology, Santa Cruz, CA; 1:200 in PBS plus 2% bovine serum albumin [BSA]) or MSP (1:100 in PBS plus 2% BSA) for 12 h at room temperature; the signals were visualized using anti-rabbit monoclonal antibodies conjugated either to fluorescein isothiocyanate or to biotin (Amersham Pharmacia Biotech; 1:50 in PBS containing 2% BSA, 1 h of incubation). Fluorescent slides were mounted in Mowiol and observed using a confocal microscope (Molecular Dynamics, Sunnyvale, CA); the others were processed with Elite ABC kit (Vector Laboratories) and the chromogen 3,3'-diaminobenzidine tetrahydrochloride (Sigma-Aldrich Chemie) and then observed with a Leitz Dialux light microscope (Leitz, Oberkochen, Germany). Four mice were analyzed for Ron (2 in immunofluorescence and 2 in immunohistochemistry) and six for MSP (4 in immunofluorescence and 2 in immunohistochemistry).
NADPH-Diaphorase Histochemistry
Different groups of mice were analyzed, sacrificing animals either after 2 d (10 mice: 4 infused with MSP, 4 with conditioned medium of Sf9 mock-infected cells and 2 with saline solution) or after 1 wk (10 mice, grouped as described above). Cryostat sections (50-µm-thick) were reacted free-floating for 1 h in a solution of 1 mg/ml NADPH (Sigma-Aldrich Chemie) and 0.2 mg/ml nitroblue tetrazolium (Sigma-Aldrich Chemie, in PB containing 0.5-1% Triton X-100. Sections were thoroughly rinsed in PB and mounted on gelatin-chrome alum-coated slides. Sections were air dried overnight, dehydrated in ascending alcohols, cleared in xylene, mounted in Eukitt mounting medium, and observed with a Leitz Dialux light microscope (Leitz).
For NADPH-diaphorase (NADPH-d) staining the neuronal cell profile was used as unit of counting. Three to seven sections were counted for each animal. NADPH-d-positive motoneurons were counted separately in the nuclei contralateral and ipsilateral to axotomy. These numbers were expressed as percentage of the total number of motoneurons of the corresponding side. The percentage value of the side ipsilateral to axotomy was normalized subtracting the percentage value of the contralateral intact side. Average ±SD was calculated for each group; these data were evaluated performing two-tailed Student's t tests; a p value <0.05 was considered significant.
PCR Analysis
Cerebellum, superior colliculus, and somatosensory cortex were
dissected from untreated animals. Hypoglossal nuclei were dissected either from untreated animals or from axotomized mice. In this last
case, 48 h after axotomy the hypoglossal nuclei of both sides were
separated under dissecting microscope. The following groups of animals
were analyzed: two untreated mice, five infused with MSP, four with
conditioned medium from mock-infected Sf9 cells, and two infused with
saline solution. Extracts were prepared as previously described (di
Renzo et al., 1994
).
Nucleic acids were treated with DNase and the remaining RNAs were
retro-transcribed using an oligo dT primer (Sambrook et al.,
1989
). The obtained cDNA was split in two parts; each was the template
for two or three different PCR reactions, by using primers specific for
RON (sense: 5' TCTTTAGCTTTCTGGGGCC 3'; antisense: 5'
TATTATTTTACACTGTAGTATCTC 3'), for
-enolase (sense: 5'
AGAATGGGGCTGTGGACCTGGG 3'; antisense: 5' GCGCTGTGATTCAGACTTTAATGG 3'),
or for MSP (sense: 5' TTGCCTGCTATACCCATGACTGCTGGG 3'; antisense: 5'
ATGTTTGAGAAAGCTTGACATCTC 3'). The same PCR mix was split in the
different test tubes and one sample, supplied with all the reagents
used for the reverse transcription reaction but without a template DNA,
was considered as mock. The reactions were run onto a 4% agarose gel.
Because the bands corresponding to RON amplifications were not always visible by staining with ethidium bromide, Southern blot analyses were
performed. The gels were blotted and the filters (Hybond-N+; Amersham
Pharmacia Biotech) were hybridized with a RON probe, labeled with
digoxigenin-dUTP, and detected by chemiluminescence. Probe labeling,
hybridization, and chemiluminescent detection were done according to
Dig High Prime Labeling and Detection Starter kit II (Roche Molecular
Biochemicals, Mannheim, Germany) instructions. Ethidium bromide
and chemioluminescent signals were quantified by densitometry with the
software ImageQaNT (Molecular Dynamics). The ratio between RON
and
-enolase was calculated for each single reaction. Average ± SD was calculated for each group; data were compared by Student's
t test; a p value <0.05 was considered significant.
Northern Blot Analysis
PC12 cells were maintained in Iscove's Modified Dulbecco's Medium (Sigma-Aldrich Chemie) plus 10% fetal calf serum plus 5% horse serum donor herd and plated onto poly-L-lysine-coated dishes. They were grown to 70% confluence and then starved for 24 h in 1% horse serum. Stimulation was performed adding either MSP (150 ng/ml) or conditioned medium of mock-infected Sf9 cells. PC12 cells were lysed before stimulation (time 0) and after 3, 6, 12, 24, and 48 h. RNAs were prepared using RNAwiz (Ambion, Austin, TX) according to the manufacturer's instructions and Northern blot analysis was performed. Total RNAs (10 µg) were loaded in each lane. After running, the gel was blotted onto a nylon membrane (Hybond-N+; Amersham Pharmacia Biotech). A probe for glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) gene was obtained by PCR with cDNA from PC12 cells prepared as described in the previous paragraph (primers: sense 5' GAAGGTGAAGGTCGGAGTC 3'; antisense 5' GAAGATGGTGATGGGATTTC 3') as a template; the full human cDNA was the probe for Ron. Both DNAs were 32P-labeled using the Megaprime DNA labeling system (Amersham Pharmacia Biotech). After hybridization the membrane was washed in 0.5× SSC, 0.1% SDS at 50°C. The signals were visualized with a Storm apparatus (Molecular Dynamics) and quantified by densitometry with the software ImageQaNT (Molecular Dynamics). The ratio of Ron versus GAPDH signals was calculated for each single lane. This value was considered as zero in unstimulated cells. The others were calculated as increments of this reference value.
Western Blot Analysis
Tissues were homogenized and sonicated. The supernatants were
clarified by centrifugation for 40 min at 4°C, 13,000 rpm. MSP was
immunoprecipitated using 5 µl of polyclonal antibody cross-linked to
Sepharose-protein A resin (Amersham Pharmacia Biotech). Ron and
-enolase were analyzed in the remaining extracts (40 µg/lane). SDS-PAGE gels were blotted onto a nylon membrane (PVDF transfer membrane; Millipore, Bedford, MA). Ron was detected with polyclonal antibodies against the human receptor (Gaudino et al., 1994
)
1:200 in Tris-buffered saline (TBS) plus 5% BSA and 0.15% Tween 20);
-enolase with polyclonal antibodies against neuronal specific enolase (1:1000 in TBS plus 5% BSA and 0.15% Tween 20; Chemicon International) and MSP with the antibody described above (1:500 in TBS
plus 5% BSA and 0.15% Tween 20). Protein-A conjugated to a peroxidase
activity was used as secondary antibody. The signals were visualized
with ECL chemiluminescence system (Amersham Pharmacia Biotech).
Extracts from the same animals that underwent to PCRs were analyzed.
In Situ Hybridization
Cryostat sections (10- or 20-µm-thick) were adhered to
poly-L-lysine-coated slides. Full-length murine MSP cDNA
was labeled with Dig DNA Labeling kit (Roche Molecular Biochemicals)
according to the manufacturer's instructions. After labeling, the size
of the cDNA fragments was reduced by digestion with the restriction nuclease MspI. The in situ hybridization was carried on at
37°C, with formamide, 12 h, according to Schaeren-Wiemers and
Gerfin-Moser (1993)
; the digoxigenin signals were developed for 2 d. Prior in situ hybridization the tongue sections were stained for
actin with tetramethylrhodamine B isothiocyanate-conjugated
phalloidin (Sigma-Aldrich Chemie) as described by Maina et
al. (1998)
. Six mice were analyzed.
| |
RESULTS |
|---|
|
|
|---|
MSP and Ron in Adult Murine Brain
During murine embryonic development RON transcripts are strongly
expressed in specific regions of the CNS (Gaudino et al., 1995
; Quantin et al., 1995
); however, the role of MSP and
its receptor Ron in the CNS is as yet unknown. Thus, we probed whether the ligand and/or the receptor are still expressed in the adult CNS to
use adult mice as an experimental model to investigate the function of
MSP and Ron in the brain. We analyzed the hypoglossal nuclei, where RON
transcripts are abundant during later stages of embryonic development.
Serial sections of the brainstem from adult mice were stained with
antibodies raised against both ligand (6 mice) and receptor (4 mice).
Upon treatment with anti-Ron antibodies, the hypoglossal motoneurons
showed specific immunoreactivity (Figure
1A, low magnification; B and C, higher
magnification). This signal was absent following preabsorption of the
antibody with Ron peptides before the staining. The low intensity of
the signals with the antibodies against MSP made discerning individual
cells impossible; similar results were obtained by in situ
hybridization with MSP probes (6 mice). To improve the sensitivity of
the assay we thus evaluated the expression of the transcripts by PCR
techniques and the proteins by Western blot analyses (see MATERIALS AND
METHODS for details) in the brain extracts of two mice pooled together.
The left panels of Figure 1 show the results of the PCR amplifications
by using specific primers for MSP (Figure 1D) and RON (Figure 1F); the
right panels show MSP (Figure 1E) and Ron (Figure 1G) polypeptides in
the same extracts. Together with the hypoglossal nuclei three brain
regions functionally unrelated were analyzed: cerebellum, somatosensory cortex, and superior colliculus. The neuronal marker
-enolase was
used to compare nucleic acid and proteins contents (Figure 1, H and I,
respectively). These brain districts expressed both MSP and Ron,
transcripts and proteins. It should be noted that the molecular weight
of the bands corresponding to MSP and Ron polypeptides revealed that
both proteins are present in their active, processed form. Thus, we can
conclude that during adulthood this ligand and its receptor are
expressed in the brainstem and Ron still maintains its localization in
the hypoglossal nuclei.
|
MSP Is Expressed in Tongue
The existence of paracrine circuits involving an active transport
of many neuronal trophic factors from the target cells backwards to the
motoneuron somata has been extensively documented (DiStefano et
al., 1992
). To assess whether MSP has these properties, we tested
by in situ hybridization its expression in the tongue, where the
muscles innervated by hypoglossus are located. In this analysis six
mice were sacrificed.
Figure 2 shows cells displaying a
very strong signal (arrowheads), which are abundant in proximity to the
nerve (Figure 2A) and are mixed to unstained muscle fibers (Figure 2, B
and C). To investigate whether MSP was produced by muscle tissue, we
took advantage of the typical striped actin distribution in muscle fibers. Therefore, before hybridization, the sections were stained with
fluorescent phalloidin to visualize actin. Figure 2, D and E, show,
respectively, MSP transcripts and actin localiza-tion within the same
section. The structures that express MSP weakly reacted with phalloidin
(arrows) and they do not show the actin organization typical of the
muscular fibers.
|
These data show that indeed MSP transcripts are produced in the tongue, the target organ of the hypoglossal nerve, although this growth factor is expressed in cells different from mature myotubes, possibly of mesenchymal or glial origin.
Trophic Effect of MSP on Motoneurons of Hypoglossal Nucleus
In adult mammals, axotomy of peripheral nerves results in loss of
ChAT immunoreactivity in the motoneuron somata, a phenomenon that
reflects a decline in motoneuron functionality expressed as a reduced
production of the neurotransmitter acetylcholine (Armstrong et
al., 1991
; Li et al., 1994
). This functional decline may be prevented or reduced by the delivery of a number of growth factors (Chiu et al., 1994
; Cuevas et al., 1995
;
Tuszynski et al., 1996
; Teng et al., 1998
). To
test in vivo whether MSP has a trophic function for hypoglossal
motoneurons, we studied whether in adult animals the exogenous delivery
of this factor prevented decrease of ChAT immunoreactivity induced by
axotomy. Each hypoglossal nerve originates from one of the two
hypoglossal nuclei and its axons project to the ipsilateral side of the
tongue. The multipolar hypoglossal motoneurons show medium-to-large
size somata, which are located ventrally to the dorsal motor nucleus of
the X cranial nerve and dorsally to the Roller nucleus (Franklin and
Paxinos, 1996
). The motoneurons are grouped ventromedially and are more dispersed dorsolaterally. We transected the right hypoglossal nerve and
monitored the expression of ChAT by counting the number of
immunoreacting cells in both hypoglossal nuclei, one ipsilateral and
the other contralateral (control), to the axotomized side. MSP was
delivered either by infusion of recombinant factor produced by
Sf9-infected cells to the extremity of the proximal hypoglossal nerve
stump with an osmotic minipump (1 µg/ml, 6 animals) or by transplanting in the same location Neuro2A cells engineered to produce
MSP (4 animals). Control mice were infused with conditioned medium of
mock-infected Sf9 cells (7 animals) or transplanted with Neuro2A cells
transfected with empty vector (4 animals). Two mice were infused with
saline solution.
As described in literature (Armstrong et al.,
1991
), 7 d following hypoglossal nerve section, mice infused with
saline solution showed a strong decrease in ChAT immunoreactivity in
the nucleus ipsilateral to axotomy compared with the contralateral one.
This phenomenon took place in axotomized animals infused with
conditioned medium of mock-infected Sf9 cells as well (Figure
3, A, on left, and C). When MSP was
infused with an osmotic minipump, this decline of ChAT immunoreactivity
was abolished (Figure 3, D, on left, and F). In all the operated mice
the contralateral nuclei were unaffected (compare the right side of
Figure 3, A and D, at high magnification in B and E). Similar results
were achieved when Neuro2A cells expressing MSP were placed at the
proximal stump of the axotomized hypoglossal nerve. As described above,
in these animals the decrease in ChAT immunoreactivity was prevented,
whereas mice transplanted with mock-transfected Neuro2A cells behaved as those infused with saline solution. Notably, in all animals examined, ChAT immunoreactivity in the vagal nucleus was similar in the
two sides (white arrowheads in Figure 3, A and D), thus indicating that
the differences observed in the hypoglossal nuclei were specifically
due to MSP treatment.
|
The protective effect of MSP was quantified by counting the number of ChAT-positive cells in the hypoglossal nucleus of both contralateral and ipsilateral side in the different groups of animals. In mice treated with conditioned medium of mock-infected Sf9 cells 55% of the ChAT-positive cells were missing in the axotomized side compared with the contralateral one (p < 0.01), whereas in animals treated with MSP both sides had similar ChAT immunoreactivity profiles (Figure 3G). Similar numbers were obtained by supplying MSP through the transplant of Neuro2A cells close to the nerve stump. Here, again, axotomy determined a significant decrease (p < 0.05) in the number of ChAT-positive motoneurons, which was rescued by MSP (Figure 3G). The different efficacy of the two routes of MSP administration may be due to the stickiness of this cytokine, which tends to attach to the proteoglycans ubiquitously present in all tissues. This may happens when MSP diffuses from Neuro2A cells, but not if it is directly taken up from the osmotic minipump. These data prove that MSP has a protective effect on hypoglossal motoneurons, which, upon axotomy, retain their cholinergic phenotype.
MSP Prevents the Induction of Nitric-Oxide Synthase (NOS) in Axotomized Hypoglossal Motoneurons
Together with the loss of cholinergic phenotype, another effect of
axon injury in the adult hypoglossal system is an up-regulation of NO
synthesis through transcriptional induction of NOS (Yu, 1994
). Because
MSP represses the production of NO in murine peritoneal macrophages
(Wang et al., 1994
), we studied whether this function was
present in the hypoglossal motoneurons as well. The histochemical reaction for NADPH-d was used as a marker to reveal NOS activity (Bredt
et al., 1991
) 48 h and 1 wk following axotomy. As
described above, we analyzed both ipsilateral and contralateral
hypoglossal nuclei from mice in which the hypoglossal nerve of one side
was sectioned and infused either with conditioned medium of
mock-infected Sf9 cells or with MSP. We sacrificed eight animals at
48 h and eight at 1 wk; always four mice were treated with MSP and
four with conditioned medium. Two mice were axotomyzed and treated with
saline solution.
Mice in which one of the two nerves was resected and treated with
saline solution, showed increased NADPH-d reactivity in the axotomized
side compared with the contralateral intact one, as described in
literature (Yu, 1994
). Similarly, NADPH-d reactivity increased in the
nucleus ipsilateral to axotomy of mice treated with conditioned medium
(Figure 4A, on left, and C). When MSP was
infused at the proximal stump of the transected nerve, no NADPH-d
reactivity was detectable (Figure 4, D, on the left, and F).
Contralateral nuclei were unaffected (Figure 4, A and D, on the right,
and B and E at higher magnification). Forty-eight hours after axotomy,
MSP-treated mice showed a number of NADPH-d-positive hypoglossal
motoneurons twofold lower than the animals treated with conditioned
medium of mock-infected Sf9 cells (Figure 4G). The effect of MSP
treatment was even more evident 1 wk after axotomy, when the difference
was fivefold (Figure 4G). These differences are statistically
significant (p < 0.05 and < 0.01 after, respectively, 48 h and 1 wk). These data prove unambiguously that MSP prevents NOS up-regulation in axotomized hypoglossal motoneurons.
|
MSP Induces Transcription of RON in Hypoglossal Motoneurons
We then analyzed the expression of RON transcripts and proteins in
the nuclei of axotomized animals treated with saline solution, with conditioned medium, or with MSP, all infused as previously described. We evaluated Ron contents 48 h after nerve resection, either by semiquantitative PCR or by Western blot analysis. The neuronal marker
-enolase, which is unaffected by axotomy (Angelov et al., 1994
), was used as a standard to normalize Ron
content in each experiment. Five mice were treated with MSP, four with conditioned medium and four with saline solution. Both hypoglossal nuclei were always processed separately and each of them was the template for two series of different PCR reactions.
Interestingly, we observed that the expression of Ron receptor
decreased in the nucleus ipsilateral to axotomy compared with the
contralateral one (Figure 5A). When MSP
was applied to the proximal nerve stump, RON transcripts increased and
were more abundant in the nucleus of the resected nerve with respect to the nucleus of the intact nerve (Figure 5A). On the contrary, infusion
of conditioned medium of mock-infected Sf9 cells was ineffective in
preventing Ron mRNA's decrease. The PCR signals resulting from
amplification of
-enolase transcripts are shown for comparison
(Figure 5B). We then quantified by densitometric analysis the amount of
RON transcripts in the three groups of animals (Figure 5C). All of them
displayed significant differences (p < 0.05) between ipsilateral
and contralateral hypoglossal nuclei. It should be noted that all the
nuclei contralateral to axotomy expressed similar quantity of RON
transcripts (Figure 5C, C). This proves that the differences of RON
expression in the ipsilateral nuclei were due to the treatments and not
to random variability among the animals.
|
We then tested whether MSP was able to induce Ron transcription in
other cell types. As model we chose PC12 cells, which are known to
express this receptor (Gaudino et al., 1995
). We performed Northern blot analysis followed by densitometry to compare the amount
of Ron transcripts in cells treated either with MSP or with conditioned
medium of mock-infected Sf9 cells at 3, 6, 12, 24, and 48 h after
stimulation. The transcript of the housekeeping gene GAPDH was used to
normalize the amount of RNAs loaded in each lane. Figure 5D shows that
at 6 and 12 h there is a threefold induction of Ron mRNA in cells
treated with MSP (continuous line), which is absent when the cells are
treated with conditioned medium (dotted line). This supports the data
previously obtained in the hypoglossal system that MSP induces Ron transcription.
We then compared by Western Blot analysis the content of Ron protein in
the extracts obtained from the same animals analyzed above. Forty-eight
hours after axotomy, in addition to the band of 140 kDa corresponding
the mature form of Ron, which was present in all extracts, a signal
with the molecular weight of Ron precursor (165 kDa) appeared in
extracts prepared from hypoglossal nuclei of axotomized animals treated
with MSP (Figure 5E). This band was absent in the contralateral nuclei
of the same group of mice and in both nuclei of animals axotomized and
treated with saline solution or with conditioned medium of
mock-infected Sf9 cells. The staining of the same blot with antibodies
raised against
-enolase demonstrated that similar amount of proteins
were loaded in each lane (Figure 5F).
We thus conclude that axotomy down-regulates RON transcription, whereas administration of MSP prevents this effect. Moreover, because 48 h after axotomy the amount of processed Ron protein in axotomized mice is the same in both the contralateral and ipsilateral side, whereas the amount of RON transcripts decreases, this polypeptide seems to be more stable than its transcripts.
| |
DISCUSSION |
|---|
|
|
|---|
In this article we show that MSP behaves as a neurotrophic factor
for cranial motoneurons. We demonstrate that in adult mice the MSP
receptor (Ron) is expressed in the motoneurons of the hypoglossal
nucleus and MSP synthesis is detectable in the tongue, the target of
hypoglossal nerve. The absence of this polypeptide in mature myotubes
suggests that this factor is produced by neighboring mesenchymal cells,
in agreement with its homologue HGF, which is synthesized by forelimb
mesenchyme (Maina et al., 1998
). Moreover, we demonstrated
that exogenous administration of MSP induces novel transcription and
biosynthesis of Ron in the hypoglossal motoneuron cell body. This suits
with the existence of a paracrine relationship between this ligand,
produced in the tongue, and its receptor, located in the brainstem, and
supports a neurotrophic function of MSP. Because MSP expression can
also be observed in extracts of the hypoglossal nuclei, this factor is
likely to be produced in the CNS as well. Glial cells, which are known
to synthesize many other neurotrophic factors, such as nerve growth
factor (NGF), brain-derived neurotrophic factor (BDNF), NT-3 and NT-4/5
(Friedman et al., 1998
; Wu et al., 1998
), are
good candidates for being MSP producers. The hypoglossal motoneurons
could be a source of MSP as well. If this is the case, an autocrine
loop should be hypothesized, similarly to HGF in developing sympathetic
neuroblasts (Maina et al., 1998
). Interestingly, we show
that MSP increases Ron mRNA in PC12 cells, suggesting that, together
with the well-documented activation of Ron by phosphorylation (Wang
et al., 1994
), MSP may regulate its receptor also at the
transcriptional level.
In our analyses we detect the processed form of MSP. This growth
factor, which is known to be secreted as a single-chain precursor (Wang
et al., 1993
), is cleaved to a mature
/
polypeptide by specific convertases (Wang et al., 1996
; Nanney et
al., 1998
). Some of them are proteins of the blood coagulation
cascade, such as kallikrein, factor XIIa, and factor XIa (Wang et
al., 1994a
), but the most effective are NGF-
and epidermal
growth factor-binding protein, serine proteases that belong to the
subfamily of the glandular kallikrein (Wang et al., 1994b
).
It is thus intriguing to hypothesize a cleavage of the MSP precursor by
NGF-
and epidermal growth factor-binding protein. These could be
transported from the submandibular glands, where they are highly
expressed (Drinkwater et al., 1987
; Isackson et
al., 1987
), to the brainstem through the extensive connections
that link together masticatory, facial, and lingual neuromuscular
systems (Fay and Norgren, 1997
).
HGF, the homologue of MSP, promotes survival of motoneurons during
development, prevents apoptosis of sympathetic neuroblasts, and is
required for the development of sensory neurons of the dorsal root
ganglia (Ebens et al., 1996
; Maina et al., 1998
). Until now, indirect evidence supporting the neurotrophic role of MSP
was provided by the findings that rat tongue myoblasts sustain survival
and differentiation of dissociated hypoglossal neuroblasts in vitro
(Ternaux and Portalier, 1993
) and that MSP stimulates mitosis of
neuroendocrine PC12 cells in culture (Gaudino et al., 1995
).
Upon nerve transection, hypoglossal motoneurons cease to express
acetylcholine and become atrophic. This represents a change in protein
synthesis from neurotransmitter types of molecules, characteristic of
fully differentiated motoneurons, toward proteins that are more
essential for survival and regeneration (Armstrong et al.,
1991
). Here, we show that exogenous MSP preserves the cholinergic
phenotype of transected hypoglossal motoneurons. This validates the
hypothesis of a neurotrophic function of MSP and allows the speculation
that, similarly to BDNF or NT-4/5 (but unlike NGF or NT-3; Yan et
al., 1993
; Koliatsos et al., 1994
; Tuszynski et
al., 1996
), this growth factor supports the differentiated state
of adult hypoglossal motoneurons.
A consequence of hypoglossal nerve resection is a dramatic increase in
NO. The significance of this induction is not yet fully understood. NO
may be protective, functioning as a free radical scavenger (Wink
et al., 1993
) and facilitating local blood flow (Iadecola
et al., 1996
; Iadecola et al., 1997
). On the
other hand, NO may be noxious, promoting motoneuron loss (Ruan et
al., 1995
). We show that MSP prevents NO up-regulation after
axotomy. The ability of MSP to down-regulate NO expression is already
documented in macrophages (Wang et al., 1994
), where it acts
in a phosphatidylinositol 3-kinase-dependent manner (Chen et
al., 1998
). Thus, we can speculate that the mechanism underlying
the neuroprotective role of MSP involves the repression of NO, through
activation of the phosphatidylinositol transduction pathway.
During nerve regeneration NO is gradually down-regulated with a time
course that depends on the type of neuron analyzed (Gonzalez-Hernandez and Rustioni, 1999
). In the hypoglossal motoneurons NO reduction takes
place after the proper connections between lingual muscles and
hypoglossal axons are restored (Yu, 1997
). It is intriguing to propose
that, together with its neurotrophic function, MSP may also have a role
in regeneration, by participating to NO down-regulation being
retrogradedly transported to the motoneuron somata after tongue reinnervation.
A putative model describing MSP function in the adult nervous system is
schematized in Figure 6. MSP, produced in
the tongue, would be retrogradedly transported to the hypoglossal
motoneuron somata, being sufficient to support a basal level of Ron
transcription. The signaling cascade thus activated would be sufficient
to block NO production and to sustain motoneuron survival. Upon
axotomy, MSP supply is interrupted, determining a decrease in RON
synthesis, resulting in motoneuron atrophy and increased NO production.
Following regeneration, when MSP can reach once more the CNS, this
process would be reversed.
|
Based on the data shown in this article one would expect that MSP or
Ron deprivation determines phenotypic changes in the CNS. Surprisingly,
MSP null mice do not present any obvious neuronal alterations, either
during embryonic life or in adulthood. This could be due to the
presence of MSP homologues, such as the amphibian Livertine (Ruiz i
Altaba and Thery, 1996
), which may compensate the need of this growth
factor. Alterations in the CNS of mice in which the function of Ron has
been inactivated have not been described as well. In this animals the
existence of other neurotrophic molecules, such as BDNF or NT-4/5,
which are known to turn on the same downstream effectors activated by
MSP/Ron (Danilkovitch and Leonard, 1999
; Yuen and Mobley, 1999
), seems
to be sufficient to rescue the lack of Ron. Alteration in the CNS of
these mutants would then become evident when more than one neurotrophic
factor is missing, as in axotomy.
| |
ACKNOWLEDGMENTS |
|---|
We thank L. Ailles, S. Giordano, P. Gual, P. Longati, and L. Tamagnone for helpful comments. We are grateful to E. Wright for editing the manuscripts and to L. Trusolino and P.G.H. Clarke for critical reading of the manuscript. The excellent technical assistance of L. Palmas is gratefully acknowledged. The experimental work reviewed in this article was supported by Associazione Italiana per la Ricerca sul Cancro and Harvard-Armenise Foundation (to P.M.C.).
| |
FOOTNOTES |
|---|
* The first two authors contributed equally to this study.
Corresponding author. E-mail address:
mcstella{at}hal.ircc.unito.it.
| |
REFERENCES |
|---|
|
|
|---|
and epidermal growth factor-binding protein, members of the kallikrein family.
J. Biol. Chem.
269, 13806-13810This article has been cited by other articles:
![]() |
E. S. Lee, P. Kalantari, S. Tsutsui{section}, A. Klatt, J. Holden, P. H. Correll, C. Power{section}, and A. J. Henderson RON Receptor Tyrosine Kinase, a Negative Regulator of Inflammation, Inhibits HIV-1 Transcription in Monocytes/Macrophages and Is Decreased in Brain Tissue from Patients with AIDS J. Immunol., December 1, 2004; 173(11): 6864 - 6872. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Drubach, M. Makley, and M. L. Dodd Manipulation of Central Nervous System Plasticity: A New Dimension in the Care of Neurologically Impaired Patients Mayo Clin. Proc., June 1, 2004; 79(6): 796 - 800. [Abstract] [PDF] |
||||
![]() |
A. Forgie, S. Wyatt, P. H. Correll, and A. M. Davies Macrophage stimulating protein is a target-derived neurotrophic factor for developing sensory and sympathetic neurons Development, March 1, 2003; 130(5): 995 - 1002. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||