![]() |
|
|
Vol. 12, Issue 5, 1529-1539, May 2001

and
*Department of Biology, University of York, York YO10 5YW, United
Kingdom; and
Instituto Cajal, Consejo Superior de
Investigaciones Científicas, Madrid 28002, Spain.
| |
ABSTRACT |
|---|
|
|
|---|
A suppressor mutation, D53, of the
held-up2 allele of the Drosophila
melanogaster Troponin I (wupA) gene is
described. D53, a missense mutation,
S185F, of the tropomyosin-2,
Tm2, gene fully suppresses all the phenotypic effects of
held-up2, including the destructive
hypercontraction of the indirect flight muscles (IFMs), a lack of
jumping, the progressive myopathy of the walking muscles, and
reductions in larval crawling and feeding behavior. The suppressor
restores normal function of the IFMs, but flight ability decreases with
age and correlates with an unusual, progressive structural collapse of
the myofibrillar lattice starting at the center. The S185F substitution
in Tm2 is close to a troponin T binding site on
tropomyosin. Models to explain suppression by D53,
derived from current knowledge of the vertebrate troponin-tropomyosin complex structure and functions, are discussed. The effects of S185F
are compared with those of two mutations in residues 175 and 180 of
human
-tropomyosin 1 which cause familial
hypertrophic cardiomyopathy (HCM).
| |
INTRODUCTION |
|---|
|
|
|---|
Muscle contraction is usually activated by a neurally stimulated
intracellular release of Ca2+. In vertebrate
striated muscle, released Ca2+ binds to the thin
filament troponin-tropomyosin (Tn-Tm) complex, which consists of
tropomyosin (Tm) and the troponins T, I and C (TnT, TnI, and TnC).
Current models (see Farah and Reinach, 1995; Geeves and Lehrer, 1998
;
Squire and Morris, 1998
) agree that Ca2+ binding
to TnC changes the conformation of the Tn complex, releasing the
inhibitory binding of TnI to F-actin and allowing Tm to move across the
actin surface (Vibert et al., 1997
). This movement cooperatively increases myosin accessibility to F-actin, activating the
cross-bridge cycle.
Muscle protein interactions are generally well characterized, but the
pathway from Ca2+ binding to contraction cannot
yet be described in molecular detail. The amino acid sequences of
vertebrate thin filament proteins (actin, Tm and Tn) are known and
their general location in the Tn complex has been determined by low
resolution structural studies (White et al., 1987
; Al Khayat
et al., 1995
; Cabral-Lilly et al., 1997
) and
biochemical analyses. The atomic structure of part of the complex was
recently determined (Vassylyev et al., 1998
) and functional information derives from considerable biochemical research (see Farah and Reinach, 1995; Geeves and Lehrer, 1998
).
Thin filament protein mutants with phenotypic effects are important in
identifying residues with significant in vivo roles. Such mutants are
known in humans through familial hypertrophic cardiomyopathies (HCM)
(Redwood et al., 1999
), in the nematode Caenorhabditis
elegans (Kagawa et al., 1997
; McArdle et
al., 1998
), and Drosophila melanogaster, where
mutations affecting the indirect flight muscles (IFM) have been
recovered (see Bernstein et al., 1993
). The D. melanogaster IFMs are striated muscles and contain a
Ca2+-regulated thin filament system but
activation also requires applied strain (Peckham et al.,
1990
), as also found in vertebrate cardiac muscle.
We aim to study the function of the Drosophila Tm-Tn complex
by isolating mutations that suppress the phenotypes of selected TnI
mutants. held-up2
(hdp2) a missense mutation of the TnI gene,
produces a fully penetrant raised wing phenotype. Six dominant
suppressors of hdp2, including
D53, were recovered (Prado et al., 1995
). Here we show that D53 is a missense mutation, S185F, of
the Tm2 tropomyosin gene and characterize the functional and
structural effects of the suppression. We discuss these results with
respect to known interactions within the vertebrate Tn-Tm complex. We
observed that S185F occurs within a region of the Drosophila
Tm which is homologous to that containing two human cardiac
-tropomyosin mutations which cause HCM and compare the
effects of D53 with these mutations.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Stocks and Fly Strains
Flies were maintained at 25°C on a yeast-sugar-agar medium.
Unless otherwise stated, strains were obtained from the European Stock
Center (Umeå) or the MidAmerica Drosophila Stock Center (Bowling
Green). All chromosome and gene symbols unless specifically described
are as in Flybase on http://flybase.bio.indiana.edu/. For the two Tm
genes, the symbols Tm1 (was TmII - Bautch
et al., 1982
) and Tm2 (was TmI) are
used as proposed in Karlik et al. (1984)
. The hdp
and up alleles are in genes which encode respectively TnI,
wupA (wings-up A) (Beall and Fyrberg,
1991
; Barbas et al., 1991
) and TnT, up
(upheld) (Fyrberg et al., 1990
). The
wupA gene is the sole TnI-encoding gene in
Drosophila (Barbas et al., 1991
). The
hdp2 mutation is in constitutive exon 5 (Beall and Fyrberg, 1991
; Prado et al., 1995
) where it
causes a substitution of alanine116 by valine, A116V (using the
numbering system of Prado et al., 1995
for
Drosophila TnI residues which includes the IFM-specific exon
3 which introduces a 61-residue N-terminal extension).
Microscopy Procedures
For polarised light photomicroscopy thoraces were prepared and
mounted as described in Nongthomba and Ramachandra (1999)
. Fly
half-thoraces were prepared for transmission electron microscopy (TEM)
as described in Kronert et al. (1995)
.
PCR and Sequencing
A 3334 bp fragment including the complete Act88F coding sequence was PCR amplified with Taq DNA polymerase from genomic DNA of hdp2 and hdp2; D53 flies using the 5'TGTAGGTGGAGCTAACCGTGTGC (sense) and 5'GCTGCCTTTGAAGAGCTTTCGG (antisense) primers. The amplified product was gel-purified (Geneclean, BIO101), ligated into the pGEM-T vector system (Promega), and transformed into TG1 reco cells. DNA from three separate clones was extracted, purified, sequenced with internal oligonucleotide primers using an ABI Prism Dye Cycle Sequencing Kit containing AmpliTaq DNA polymerase (Perkin Elmer-Cetus), and analyzed using an in-house automated sequencer.
RT-PCR was used to amplify the Tm1 gene exons that are
spliced to form the `mTm' (muscle tropomyosin) mRNA. This mRNA is
derived by splicing together exons 1-3, 5, 7, 8, 10, 11, 13 and 17 (Karlik and Fyrberg, 1986
; Hanke and Storti, 1988
). Total RNA was
isolated from newly emerged hdp2 and
hdp2; D53 flies and reverse transcribed
using random nucleotide hexamers and Moloney murine leukemia virus
reverse transcriptase (Life Technologies). The cDNA was used in PCR
reactions with Pfu DNA polymerase (Stratagene) using
5'GTTCAAGTCGCGGATAACTCCGAATAAAAGTT (sense) and 5'CAGTGCGCCTACGATTATGC
(antisense) primers to amplify specifically the coding region. The PCR
products were gel purified, ligated into pGEM-T, and transformed into
TG1 reco cells. Three clones from two separate
RT-PCR reactions were sequenced as above.
DNA extracted from Oregon-R, hdp2, and D53 flies was used for PCR amplifications with Pfu DNA polymerase (either native or cloned) of overlapping Tm2 genomic fragments containing exons 2, 3 and the coding sequence of exon 4. The primers used were 5'AGGATTCAGTTATTCAGCATAC, 5'TCCTCAATCTGTTGCACCTT, 5'TTGGTATCGGCATCCTCAGC, 5'GGAGGAGGAGCTGAAGGTGG, 5'GGGAGTTGCCGACAACCTAGT, 5'GGGTGGTCAAGGGCATTGTGTG, and 5'CAAACTGAACGAGGAGGTGC. Amplified products from a minimum of two PCR reactions for each fragment were purified and sequenced as described above.
Adult and Larval Muscle Performance Tests
Flight testing was done as previously described (Drummond
et al., 1991
). Individual flies were scored for flight
upwards (U), horizontal (H), downwards (D), or not at all (N). The mean
flight score, [U + H]/Total flies, was arcsine transformed to give a Normal distribution. Five samples, > 50 flies, were scored. Wing beat
records were obtained and analyzed as described in Schmitz et
al. (2000)
using 6 flies per genotype, each sampled 3 times.
Adult walking ability was measured in a vertical 100-ml glass measuring cylinder, internal diameter 30 mm, with a line marked 80 mm above the base. For each test 8-30 flies were introduced into the cylinder. Flies were knocked to the cylinder bottom and the time taken for 50% of the flies to walk past the marked line was scored.
Late third instar larval crawling was measured on 1.5% (wt/vol) agar-sucrose medium in plates marked with a 0.5-cm grid, as total gridlines crossed in 5 min. Larval feeding movements were quantified by counting nonlocomotory, pharyngeal movements in a 2-min period on agar plates thinly coated with yeast. Larvae which did not feed continuously were discarded.
| |
RESULTS |
|---|
|
|
|---|
Suppressor D53 Is a Tropomyosin 2 Mutation
In hdp2 flies the IFMs hypercontract
(Figure 1C) so that myofibrillar material
remains (arrows) only near the muscle attachment sites. This effect is
completely suppressed in hdp2;
D53/+ (Figure 1D) and hdp2;
D53/53 flies (not shown), which are indistinguishable from
wild-type (Figure 1A). Even in pupae at 78 h APF (after puparium
formation), ~ 20 h before adult emergence, the
hdp2 muscles (Figure 1B) begin to
hypercontract. IFMs cannot be imaged by birefringence before 78 h,
but using a lacZ gene promoter-reporter construct and
-galactosidase staining we have shown that developing hdp2 IFMs have a normal structure at
75 h APF (Nongthomba and Sparrow, in preparation). D53
suppression mapped to a region on chromosome 3 (Prado et
al., 1995
) that contains the IFM-specific actin gene, Act88F, and two tropomyosin genes, Tm1 and
Tm2. Due to the very tight linkage of these genes
D53 was located by sequencing the relevant coding regions of
all three genes. The Act88F sequence was identical to the
GenBank sequence (M18830) except for seven silent codon changes.
|
The Tm1 gene produces four alternatively spliced products
(Hanke and Storti, 1988
). Only one, the mTm mRNA, has an expression pattern coincident with the muscles in which
hdp2 phenotypes are suppressed by
D53 (see below). The Tm1 coding sequences from
hdp2 and hdp2;
D53 flies, obtained by RT-PCR, and the wild-type mTm isoform sequence (Swissprot ID:TPM1_DROME) generated by splicing
appropriate exons from EMBL sequences L00355-L00363 (Hanke and Storti, 1986
, 1988
) were identical.
Larval muscles express a Tm2 mRNA, containing exons 1-4;
IFM and leg muscles express a Tm2 mRNA consisting of exons
1-3 and 5 (Basi et al., 1986
; Karlik and Fyrberg, 1986
). As
D53 suppresses hdp2 effects in
IFMs, legs, and larval muscles (see below), the common coding exons (2 and 3) were sequenced by PCR of genomic DNA from hdp2 and hdp2;
D53 flies. In hdp2 flies
Tm2 exons 2 and 3 were identical to the wild-type sequence (EMBL AC: K03277; Swissprot TPM2_DROME; Basi and Storti,
1986
). However, exon 2 in hdp2;
D53 flies contained a TCC to TTC mutation in codon 185, which will replace serine by phenylalanine (S185F); exon 3 was
wild-type.
Suppression of IFM Defects
Flies hemi- or homozygous for hdp2
hold their wings vertically, but when D53 was present in one
(+/D53) or two (D53/D53) gene doses, their wings
were in the resting position. Young (2-3 days) hdp2; +/D53 or
hdp2; D53/D53 flies flew, but
less well than wild-type (Table 1A). By
6-7 days old the flight ability of hdp2;
D53/+ flies, but not hdp2;
D53/D53, had been dramatically reduced. These data show that D53 suppression of the hdp2
flightless phenotype is dominant and almost complete. The age effect
suggests that incomplete suppression in
hdp2; D53/+ heterozygotes causes
a progressive deterioration in muscle function. Does this correlate
with structural changes to the myofibrils?
|
Electron micrographs of IFMs from 2-3 d-old
hdp2 flies showed (Figure
2B) an almost complete absence of
wild-type myofibrillar structure (Figure 2A). The fibers contained
disorganized thick and thin filaments with only small islands of
myofibrillar lattice (asterisk) remaining. IFMs of 2-3 d-old
hdp2; D53/+ flies (Figure 2C) showed
an almost complete restoration of wild-type myofibrillar structure.
However, some myofibrils showed small areas of disorganized filament
lattice at their centers which in longitudinal sections (Figure 2F)
were visible as Z-disk dislocations. By 6-7 days, all the myofibrils
of hdp2; D53/+ flies (Figure
2D) contain extensive disorganized centers, an effect never seen
in hdp2; D53 (Figure 2E) or
D53 homozygotes (not shown). These structural changes
correlate with the reduced flight ability of
hdp2; D53/+ flies with
increasing age (Table 1). Since neither occur in D53
homozygotes, complete D53 suppression is a recessive
character.
|
Suppression in Adult, Non-IFM Muscles
Since the hdp2 mutation occurs in a
constitutive exon of the sole Drosophila TnI gene (Beall and
Fyrberg, 1991
), its dysfunction in non-IFM muscles should affect
behavior. hdp2 flies cannot jump (Deak
et al., 1982
) but hdp2;
D53/+ and hdp2;
D53/D53 flies jumped readily. Since jumping is powered by
the tergal depressor of trochanter (TDT) muscles, D53 must
be expressed there. The walking speed of
hdp2 flies was reduced even in young flies
(Figure 3A) compared with wild-type, as
reported previously (Deak, 1977
) and was further reduced as flies aged
(Figure 3A). Older flies appeared crippled, continually fell over, or
showed a propensity to fall off vertical surfaces. One or two gene
doses of D53 restored walking ability of
hdp2 flies to almost wild-type levels,
indicating that D53 is expressed and suppresses the
hdp2 phenotype in the muscle groups
required for walking. Neither hdp2;
D53/D53 nor hdp2;
D53/+ flies showed a reduced walking ability with age
(Figure 3A). Leg muscles from 12-d wild-type flies (Figure 3B) had a
normal fibrillar structure, but in hdp2
flies of similar age (Figure 3C), although a few muscles showed a
normal muscle structure (arrow) most muscles (asterisk and arrowhead) lacked myofilaments and exhibited large intracellular vacuoles (asterisk) and electron dense staining of cells and nuclei (arrowhead). One muscle (arrowhead) has detached from one of its apodemes. These
effects correlate with the behavioral studies. Aged
hdp2; D53/+ flies showed (Figure
3D) an intermediate phenotype in which some muscles were clearly
damaged (arrowhead) but most appeared normal (arrow). Although the
behavioral studies suggested a complete dominant suppression of
hdp2 by D53, these structural
data indicate that dominant suppression is incomplete.
|
Suppression of Larval Muscle Defects
As wupA must be expressed in larval muscles (see
above), hdp2 should affect larval
behaviors. Crawling of hdp2 larvae was very
different from wild-type (Table 2). Many
appeared paralyzed in their posterior segments; frequently the
posterior was raised, reminiscent of the `hook' phenotype of kinesin
or kinesin-related mutants (Hurd and Saxton, 1996
). As
hdp2 larvae crawl, they `roll'.
Locomotory and feeding behaviors of hdp2;
D53 larvae were not significantly different from those of
wild-type confirming a) that the Tm2 gene is expressed in
larval muscles and, b) that D53 suppresses the effects of
hdp2 (Table 2) in these muscles.
|
Muscle Effects due to D53 Mutation Per Se
Often genetic suppressors have their own mutant phenotype. IFMs from D53 homozygotes have a wild-type structure (Figure 2E). To look for more subtle effects the flight ability of D53/+ and D53/D53 flies was measured (Table 1). Both genotypes showed a small, significant reduction in flight ability that was age-independent. Oregon-R flies gave a wing beat frequency of 240.6 ± 23.4 Hz (n = 6 flies) while D53 homozygotes produced 214.7 ± 18.6 Hz, a modest but significant reduction (Student's t test p = 0.041). The walking speed of D53 and wild-type flies was very similar and did not change with age (data not shown). Thus, D53 has a mild IFM phenotype, which is not detected in leg muscles.
Specificity of the D53 Suppression
Suppression could result from altered stoichiometry or from
specific amino acid alterations affecting protein interactions. Gene
dosage studies should reproduce the former type of suppression, whereas
the latter should be allele-specific.
Df(3R)ea5022rxl lacks both the
Tm1 and Tm2 genes and
Tm2C10 lacks a functional Tm2
copy (Kreuz et al., 1996
). Males that had
hdp2/Y;
Df(3R)ea5022rxl/+ or
hdp2/Y; Tm2C10/+
genotypes showed partial suppression of IFM hypercontraction but did
not fly; hdp2/Y;
Df(3R)ea5022rxl/+ flies had the wings-up
phenotype (Table 3). We define partial IFM suppression as thoraces in which muscle fibers often span the
complete thorax, but where some do not show continuous birefringence (cf. Figure 4B) from one attachment site
to the other. The hdp2/Y;
Df(3R)ea5022rxl/+ and
Tm2C10/+ results suggest that the reduction
in Tm1 gene copy number did not contribute to suppression.
This was confirmed by a lack of hdp2
dominant suppression (data not shown) by recessive lethal P-element insertion Tm1 alleles (gift of Dr. C. O'Kane). Other
recessive lethal Tm2 mutations partially suppressed IFM
hypercontraction, but all the flies were flightless (Table 3).
|
|
Flies hemi- or homozygous for the hdp3 and
hdp5 mutations of wupA also show
the wings-up phenotype but in these cases the IFMs fail to develop.
These IFM-specific mutations affect alternative transcript splicing of
IFM mRNA and produce no TnI protein in the IFMs (Barbas et
al., 1993
). D53 did not suppress the muscle phenotype
of either mutation suggesting that suppression requires the presence of
functional TnI protein. The myosin heavy chain "rod" domain
mutation Mhc13, which causes a recessive
hypercontraction of IFMs (Kronert et al., 1995
), is also not
suppressed by D53. Thus D53 is not a general suppressor of IFM hypercontraction. Its lack of effect on
hdp3 and hdp5
and its more effective suppression of hdp2
than the Tm2 null mutations suggest that it is an
allele-specific suppressor.
up101 is a missense mutation of the
troponin T gene (Fyrberg et al., 1990
). It produces a
recessive wings-up phenotype (~ 90% penetrant) and IFM
hypercontraction (100% penetrant) indistinguishable from that of
hdp2 (compare Figures 4A and 1C).
Homozygous D53 completely suppressed both phenotypes but
up101/Y; D53/+ flies showed
a range of partially (Figure 4B) or completely suppressed IFM
phenotypes. The wing position phenotype was also partially suppressed
by D53/+; 39% of the flies had wings in the normal position
compared with 10% of control up101/Y
flies. No up101; D53/+ or
up101; D53/D53 flies could fly.
Adult up101 flies walked more slowly
than wild-type (Student's t, P
0.001), a difference that
increased with age (Figure 4C). This effect was smaller than in
hdp2 flies and became extreme only in much
older flies (cf. Figure 3A). D53 suppression of
up101 was apparently complete in
walking muscles because up101/Y;
D53/+ flies of all ages walked at wild-type velocities
(Figure 4C).
Thus, the suppressing effects of D53 are clearly not gene-specific, but they are weaker in the IFMs with up101 compared with hdp2 (compare Figures 1D and 4B); in walking behavior D53 acts equally well in suppressing both mutations.
| |
DISCUSSION |
|---|
|
|
|---|
The D53 suppressor is a missense mutation, S185F, of
the Tm2 gene. It suppresses all the effects of
hdp2 on muscle function, consistent with
D53 being a mutation in constitutively expressed exon 2, and
Tm2 expression occurring in the IFMs, TDT, leg
muscles and supercontractile larval muscles (Basi et al., 1984
; Basi and Storti, 1986
; Karlik and Fyrberg, 1986
).
The dominant suppression of hdp2
flightlessness in D53/+ heterozygotes, but not
D53 homozygotes, deteriorates with age. Clearly a mixture of
mutant and wild-type Tm2 proteins suppresses in young flies but
incompletely so as progressive degeneration occurs, unusually, from the
myofibril centers outwards. A similar disruption pattern occurs in the
Drosophila Act88FG245D mutant allele (Sakai
et al., 1990
) and the intragenic D3 suppressor of
hdp2 (Prado et al., 1995
). These
observations suggest that the myofibrillar center and periphery either
have different protein constitutions or experience different
physiological conditions. Myofibrillogenesis begins at the center
(Reedy and Beall, 1993
) and different isoforms could be assembled in
the myofibril center compared with the periphery but there is no
evidence for this. Calcium diffusion into and out from the myofibril
upon activation and relaxation will produce temporal differences of
Ca2+ concentration across the myofibril. If
hdp2 and D53 affect the response
to Ca2+ a trans-myofibrillar calcium gradient
could generate damaging forces.
Tm2 null mutant heterozygotes produce myofibrils with a
normal central lattice but considerable peripheral disruption (Kreuz et al., 1996
). Why do they partially suppress
hdp2? Fiber destruction in the
hdp2 hypercontraction likely involves
actomyosin generated forces. Kreuz et al. (1996)
showed that
Tm2C10/+ fibers produced significantly less
work than wild-type. This would explain the partial suppression by
extreme Tm2 alleles and why flight is not restored. A
similar argument may explain the effects of the myosin heavy chain gene
suppressors of hdp2 (Kronert et
al., 1995
) though other explanations including direct interactions
between the myosin head and the Tn-Tm complex cannot be excluded.
Structural Implications
The vertebrate inhibitory, actin-binding TnI and the
calcium-binding TnC form a globular domain (Herzberg and James, 1985
) which sits on TnT, an elongated molecule (see Figure 6A). TnT is the
major structural link between TnI + TnC and Tm binding (see Farah and
Reinach, 1995) and extends along the carboxy-terminal third of the Tm
coiled-coil to overlap with the N-terminus of the adjacent Tm dimer.
Two regions of Tm bind TnT one of which, the
Ca2+-sensitive binding region, includes residues
170-190.
Residue 185, phenylalanine in D53, is indicated in the
alignment (Figure 5) of Tm sequences. The
Drosophila Tm2 IFM isoform (TPM0_DROME) has considerable
sequence homology with other Tm sequences in this region. TPM0_DROME
and TPM1_DROME (the standard muscle Tm encoded by the Tm1
gene) show many residue differences. Vertebrate Tm sequences are more
similar to each other than to invertebrate sequences and residue type
conservation occurs at many positions (Figure 5). In part, this
reflects the
-helical coiled-coil heptad repeat
requirement for hydrophobic residues at most `a' and `d' positions.
Residue 185 is predicted to be a `c' residue, implying that the
phenylalanine side chain of D53 will point away from the
dimer axis and not affect coiled-coil stability. More probably it
affects interactions between Tm and TnT or F-actin.
|
Our interpretations assume that current models for the vertebrate
complex are relevant. This seems likely as Drosophila thin filament proteins show substantial sequence homology to their vertebrate counterparts although TnI (Barbas et al., 1991
;
Beall and Fyrberg, 1991
), TnT (Fyrberg et al., 1990
), and
two IFM-specific Tm isoforms (Karlik et al., 1984
; Hanke and
Storti, 1988
) have N- or C-terminal polypeptide additions.
Drosophila and Lethocerus (waterbug) IFMs have a
very similar physiology (Peckham et al., 1990
) but in
Lethocerus IFMs TnI is not detectable and is replaced by a
unique 80 kDa molecule called TnH (Wendt et al., 1997
). EM studies of Lethocerus Tn-Tm complexes (Wendt et
al., 1997
) suggest that the globular portion of the Tn complex
lies not along the Tm as in vertebrates (Figure
6A) but at the Tm dimer overlap region (Figure 6B). While sequence homology strongly implies structural homology of the Drosophila Tn-Tm complex to that of
vertebrates, common physiology argues for a structural similarity to
Lethocerus. However, the orientation of the
Lethocerus Tn complex with respect to the Tm N- and
C-termini could not be determined from electron micrographs (Wendt
et al., 1997
). When their figure (Figure 6B) is inverted
(Figure 6C) it shows that the Tm, TnT and F-actin in both insects and
vertebrates could maintain the same relative position though the
remainder of the troponin complex is located differently.
|
Functional Implications
Current models (Geeves and Lehrer, 1998
; Squire and Morris, 1998
)
suggest that in the absence of Ca2+, TnI binds
actin maintaining the `blocked' filament state (Geeves and Lehrer,
1998
) with Tm occluding much of the myosin binding site on actin.
Ca2+ binding to TnC changes TnC/TnI conformation,
releasing the TnI inhibitory domain from actin, producing the
`closed' state, and Tm with its attached Tn complex, can now move
across the F-actin surface. This exposes the complete myosin binding
surface on actin (`open' state), activating the actomyosin
cross-bridge cycle.
TnI sequence alignments (not shown) show that Drosophila TnI
residue A116, (A116V in hdp2) coincides
with conserved residue A25 of vertebrate skeletal muscle isoforms. A25
contributes to a contact with the `E'
-helix of TnC
(Vassylyev et al., 1998
). The
hdp2 A116V substitution increases residue
size which must affect TnC-TnI binding by changing TnI
-helix and TnC `E'
-helix interactions. These could result in hdp2 either lowering
the threshold for calcium activation or affecting the ability of the
Tn-Tm complex to return to the relaxed state. We cannot yet distinguish
which explanation is correct for hdp2 but
the latter one was previously proposed for a hypercontracting TnT
mutant in Caenorhabditis elegans (McArdle et al.,
1998
) and would readily explain hypercontraction of
hdp2 IFMs. The less extreme effects on
nonflight muscles argue strongly that hdp2
can produce near-normal thin filament regulation.
The S185F substitution introduces a more bulky, hydrophobic residue.
Its heptad `c' position means that the phenylalanine ring will point
outwards from the Tm axis. It could suppress
hdp2 either by altering Tn-Tm complex
movement across the F-actin surface or by changing the Tn complex
orientation on Tm through the Ca2+ sensitive
TnT-Tm binding site. The former suggestion is supported by observations
(Bing et al., 1998
) that the Act88F gene
E93K mutation reduces Tm movement across the F-actin surface
in vitro and suppresses hdp2 IFM
hypercontraction in vivo (Nongthomba and Sparrow, unpublished). In the
latter suggestion S185F would reverse the conformational effects of
hdp2 on the TnI/TnC interaction by altering
structural relationships between Tm and the Tn complex. Reversal of the
TnI/TnC conformational effects of hdp2
could require very specific changes such as found with the intragenic D3 suppressor, a TnI mutation (L188F) which suppresses
hdp2 (Prado et al., 1995
)
perhaps by changes in actin binding (L188 is close to an actin -binding
domain). However, alterations in Tm mobility could affect any Tn mutant
which causes slight regulatory changes. The partial suppression of
up101 by D53 might thus
seem to favor this latter explanation, except for the observation that
up101, as a TnT mutation,
is also located in the Ca2+-sensitive TnT-Tm
interaction site.
Clinical Implications
Human hypertrophic cardiomyopathies (HCM) include two dominant
mutations, D175N and E180G, in highly conserved residues (Figure 5) of
the TPM1 gene (Thierfelder et al., 1994
). As with
D53, these mutations map within the tropomyosin region which
interacts with TnT in a Ca2+-sensitive manner. In
vitro motility experiments using reconstituted cardiac thin filaments
showed that these HCM mutations affect the Ca2+
sensitivity of the fraction of filaments moving compared with wild-type, although in the absence of structural information on the
Ca2+-sensitive Tm binding site for TnT, it is not
clear how these mutations could cause this (Bing et al.,
2000
). There is evidence that HCM TnT mutations, I79N and R92Q, located
within the same TnT-Tm interaction (residues 70-180) may affect
Ca2+ sensitivity in tension versus force
measurements (see Tobacman et al., 1999
for discussion).
Further biochemical studies of all these human and
Drosophila Tm and TnT mutants are required to ascertain the
role of this Ca2+-sensitive contact between Tm
and TnT in thin filament regulation.
Typically HCM symptoms do not manifest before adolescence, but
penetrance and expressivity of HCM mutations are highly variable (Coonar and McKenna, 1997
). This suggests that HCM mutations have relatively mild effects, but the functional deficits can induce cardiac
changes, such as hypertrophy, leading to premature death. The variable
expression of HCM mutations must be partly due to genetic background.
Modifier genes may reduce or enhance HCM severity by affecting either
the contractile machinery or the response to cardiac dysfunction.
D53 is similar to HCM mutations in that reduced IFM function
is detectable only in older organisms. The D53 suppression
of the hdp2 and
up101 progressive myopathies suggests
that Drosophila muscles may provide a useful genetic model
with which to study HCM genes and their genetic modifiers.
| |
ACKNOWLEDGMENTS |
|---|
We acknowledge contributions from Daniel Johnson, Steph Lawlor, Sarah Withers, Nick Brown, Claire Bryan, Philip Ash, Paul Rowan, Ky Hutchinson, Chris Robinson, and Colin Civil in undergraduate projects. We thank the BBSRC, the EU (TMR Network grant ERB-CHRXCT920249), the British Council/Acciones Integradas Program from the Autonomous Community of Madrid (CAM 08.5/0043/1998), and the Spanish Ministry of Culture (PM96-06) for their support.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
jcs1{at}york.ac.uk.
| |
REFERENCES |
|---|
|
|
|---|
-tropomyosin (Asp175Asn and Glu180Gly) on the regulatory properties of human cardiac troponin determined by in vitro motility assay.
J. Mol. Cell. Cardiol.
32, 1489-1498[Medline].This article has been cited by other articles:
![]() |
M. J. Allikian, G. Bhabha, P. Dospoy, A. Heydemann, P. Ryder, J. U. Earley, M. J. Wolf, H. A. Rockman, and E. M. McNally Reduced life span with heart and muscle dysfunction in Drosophila sarcoglycan mutants Hum. Mol. Genet., December 1, 2007; 16(23): 2933 - 2943. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Nongthomba, M. Ansari, D. Thimmaiya, M. Stark, and J. Sparrow Aberrant Splicing of an Alternative Exon in the Drosophila Troponin-T Gene Affects Flight Muscle Development Genetics, September 1, 2007; 177(1): 295 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Clark, J. M. Bland, and M. C. Beckerle The Drosophila muscle LIM protein, Mlp84B, cooperates with D-titin to maintain muscle structural integrity J. Cell Sci., June 15, 2007; 120(12): 2066 - 2077. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, M. S. Miller, D. M. Swank, W. A. Kronert, D. W. Maughan, and S. I. Bernstein Paramyosin phosphorylation site disruption affects indirect flight muscle stiffness and power generation in Drosophila melanogaster PNAS, July 26, 2005; 102(30): 10522 - 10527. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Hooper and J. B. Thuma Invertebrate Muscles: Muscle Specific Genes and Proteins Physiol Rev, July 1, 2005; 85(3): 1001 - 1060. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Soustelle, C. Jacques, B. Altenhein, G. M. Technau, T. Volk, and A. Giangrande Terminal tendon cell differentiation requires the glide/gcm complex Development, September 15, 2004; 131(18): 4521 - 4532. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Nongthomba, S. Clark, M. Cummins, M. Ansari, M. Stark, and J. C. Sparrow Troponin I is required for myofibrillogenesis and sarcomere formation in Drosophila flight muscle J. Cell Sci., May 1, 2004; 117(9): 1795 - 1805. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Maytum, F. Bathe, M. Konrad, and M. A. Geeves Tropomyosin Exon 6b Is Troponin-specific and Required for Correct Acto-myosin Regulation J. Biol. Chem., April 30, 2004; 279(18): 18203 - 18209. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Montana and J. T. Littleton Characterization of a hypercontraction-induced myopathy in Drosophila caused by mutations in Mhc J. Cell Biol., March 29, 2004; 164(7): 1045 - 1054. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Nongthomba, M. Cummins, S. Clark, J. O. Vigoreaux, and J. C. Sparrow Suppression of Muscle Hypercontraction by Mutations in the Myosin Heavy Chain Gene of Drosophila melanogaster Genetics, May 1, 2003; 164(1): 209 - 222. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||