![]() |
|
|
Vol. 12, Issue 6, 1623-1631, June 2001

*Friedrich Miescher Institut, 4059 Basel, Switzerland; and
Department of Internal Medicine, Washington University
School of Medicine, St. Louis, Missouri 63110
| |
ABSTRACT |
|---|
|
|
|---|
A crucial step in lysosomal biogenesis is catalyzed by "uncovering" enzyme (UCE), which removes a covering N-acetylglucosamine from the mannose 6-phosphate (Man-6-P) recognition marker on lysosomal hydrolases. This study shows that UCE resides in the trans-Golgi network (TGN) and cycles between the TGN and plasma membrane. The cytosolic domain of UCE contains two potential endocytosis motifs: 488YHPL and C-terminal 511NPFKD. YHPL is shown to be the more potent of the two in retrieval of UCE from the plasma membrane. A green-fluorescent protein-UCE transmembrane-cytosolic domain fusion protein colocalizes with TGN 46, as does endogenous UCE in HeLa cells, showing that the transmembrane and cytosolic domains determine intracellular location. These data imply that the Man-6-P recognition marker is formed in the TGN, the compartment where Man-6-P receptors bind cargo and are packaged into clathrin-coated vesicles.
| |
INTRODUCTION |
|---|
|
|
|---|
It is well established that in higher organisms newly synthesized
acid hydrolases are targeted to lysosomes via the mannose 6-phosphate
(Man-6-P) recognition system. The generation of the Man-6-P signal on
the hydrolases involves a two-step reaction. In the first step,
GlcNAc-P is added to C-6-hydroxyl groups of selected mannose residues
by the enzyme UDP-N-acetylglucosamine:lysosomal enzyme
N-acetylglucosamine-1-phosphotransferase
(phosphotransferase). Then "uncovering" enzyme (UCE), the
colloquial name for the enzyme N-acetylglucosamine-1-phosphodiester
-N-acetylglucosaminidase, removes the covering GlcNAc
residue (Hasilik et al. 1980
; Tabas and Kornfeld, 1980
;
Varki and Kornfeld, 1980
; Varki et al., 1983
). The Man-6-P
moiety exposed by UCE action is responsible for the specific,
high-affinity binding of the acid hydrolases to one of the two Man-6-P
receptors (MPRs) in the trans-Golgi network (TGN), which
transport the hydrolases to endosomes and subsequently to lysosomes
(Kornfeld, 1987
; Hille-Rehfeld, 1995
). Thus, these two enzymes play a
crucial role in lysosomal biogenesis. Phosphotransferase first acts on
acid hydrolases in the endoplasmic reticulum (ER)-Golgi intermediate
compartment and continues to transfer GlcNAc-P residues in the early
(cis) Golgi (Lazzarino and Gabel, 1987
; Dittmer and von
Figura, 1999
). However, the site of action of UCE in the Golgi is
unknown, despite the fact that the enzyme has been studied for almost
20 years (Varki and Kornfeld, 1981
; Waheed et al., 1981
;
Varki et al., 1983
; Kornfeld et al. 1998
). Most
recently pure bovine UCE was shown to be a tetramer composed of 68-kDa monomers that contain sialylated oligosaccharides, suggesting that UCE
travels to the TGN where sialyltransferase is located during its
intracellular itinerary (Kornfeld et al., 1998
). Because a
number of early Golgi constituents slowly migrate to later Golgi elements from which they are retrieved, the finding of sialylated oligosaccharides alone does not reveal the normal location of UCE.
Recently a human cDNA-encoding UCE was isolated (Kornfeld et
al., 1999
). This established that UCE is a type I
membrane-spanning glycoprotein of 515 amino acids with a single
27-residue transmembrane domain and a 41-residue cytoplasmic tail that
contains both a tyrosine-based internalization motif
488YHPL and an NPFXD sequence that can bind to
Eps15 and has been found to promote endocytosis in yeast (Tan et
al., 1996
). The presence of 488YHPL raised
the possibility that UCE, like TGN 38 and TGN 46 (Reaves et
al., 1993
; Wong and Hong, 1993
; Ponnambalam et al.,
1994
, 1996
; Kain et al., 1998
), may travel to the plasma
membrane and be returned to the TGN via coated vesicles. In this study
we provide direct evidence that UCE does, indeed, reside in the TGN and
constitutively recycles to the plasma membrane. This indicates that,
even though phosphotransferase acts in the ER-Golgi intermediate
compartment and cis-Golgi compartments, the Man-6-P
recognition signal is probably generated by UCE in the final
compartment of the Golgi where the MPRs reside.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of Cytosolic Tail Mutants of Human UCE
Mutations were inserted into the human UCE expression vector as
previously described (Kornfeld et al., 1999
) with the use of
the Quik Change Site-directed Mutagenesis kit (Stratagene, La Jolla,
CA) and a pair of sense- and antisense-priming nucleotides encompassing
the desired changes. For the Y488A mutant the sense strand primer
5'-CATGGGGACTATGCAGCCCACCCGCTGC AGG-3' was used. For the H510 stop
mutant the sense strand primer 5'-CAGCCAGGGGGC GCCTAGGACCCCTTCAAGGAC-3'
was used. To prepare the green fluorescent protein (GFP)-UCE
transmembrane domain-cytosolic tail constructs, polymerase chain
reaction (PCR) of the wild type and mutant UCE described above was
carried out with the use of a sense strand primer including an in frame
BglII restriction site at the 5'-end (GGGCGGGAGAGATCTCCTTTTTCACC) and an antisense strand primer
including an MluI site at the 3'-end (5' to
3'-GGGAAACAAGCTTACGCGTCGTGCCACC). The PCR products of
~280 bp each (encoding E441through the stop condon at 510 or 516)
were gel purified and sequenced in both directions with the use of the
PCR primers. After restriction digestion with BglII and
MluI, the fragments were each inserted downstream of the
preprolactin signal sequence-GFP prepared as follows. The signal
sequence of preprolactin was fused to the N terminus of the mGFP
(Siemering et al., 1996
) with the use of the standard PCR
protocols with the overlap extension technique (Ho et al.,
1989
). An appropriate partial complementary pair of oligonucleotides
was used as internal primers with a downstream primer that created an
EcoRI restriction site at the 5'-end of the preprolactin
sequence and an upstream primer that created an in frame
BglII site at the 3'-end of the mGFP. The final PCR products
were subcloned into pSFFVneo as described by Rohrer et al.
(1995)
. All coding sequences created by PCR were verified by sequencing.
Selection of Stably Transfected L-Cells Expressing Mutant Human UCE
The human wild-type and mutant UCE constructs in the expression
vector pcDNA3.1(
) were transfected into mouse L-cells, maintained in
MEM-10% heat-inactivated fetal bovine serum, with the use of
Lipofectamine plus reagent (Life Technologies, Rockville, MD) as
previously described for COS cells (Kornfeld et al., 1999
). The transfecting DNA was removed on day 2, the cultures were allowed to
grow until day 4 in nonselective medium and then transferred to medium
containing 500 µg/ml G418, and resistant clones were selected as
previously described (Rohrer et al., 1995
). Clones were
screened for expression by UCE activity assays and Western blotting as
previously described (Kornfeld et al., 1999
). Expressing clones were maintained in selective medium (500 µg/ml G418).
Measurement of Cell Surface UCE Activity on L-Cell Lines
L-cells and L-cells expressing wild-type, mutant Y488A, or
mutant H510 Stop UCE were seeded into the wells of a 24-well tissue culture plate in triplicate and grown at 37°C in 5%
CO2 in a moist incubator in either 1 ml of
MEM-10% heat-inactivated fetal bovine serum (L-cells) or the same
medium plus 500 µg/ml G418 (all others). A set of empty wells
contained only medium and served as blanks. When the cells reached
~60% confluency the media were aspirated and the cells were washed
two times with 0.5 ml of TBS, pH 7 (10 mM Tris-HCl-150 mM NaCl). The A
set of wells then received 120 µl of UCE substrate (0.5 mM
[3H]GlcNAc-P-Man
Me) in TBS, pH 7, to
measure cell surface enzyme activity; the B set received 120 µl of
substrate in 1% Triton X-100-TBS, pH 7, to measure total cellular
enzyme activity; the C set received only 120 µl of TBS, pH 7, for
subsequent assay for UCE activity that was secreted. After incubation
at 37°C in the tissue culture incubator for 60 min, the 120 µl were
removed from each C well into a tube containing UCE substrate and
incubated for 60 min at 37°C. The 120 µl were removed from each A
and B well into 3 ml of 2 mM Tris, pH 8, to stop the reaction. The
separation of released [3H]GlcNAc from
3H-substrate was carried out as previously
described (Mullis and Ketcham, 1992
). Meanwhile, the cell layers
remaining in wells A and C were each extracted in 150 µl of 0.1 N
NaOH for 1 h at 4°C and used to measure the protein
concentration by the Micro BCA assay (Pierce, Rockford, IL)
standardized with bovine serum albumin. The secretion of UCE activity
by the cells in the C wells during 60 min was assumed to have occurred
linearly and thus represents twice the average amount that would have
been present during the in situ assay in the A wells. Accordingly the
secreted activity is calculated as 1/2C, and the activity on the
cell surface is calculated as A
1/2C. When the effect of
methyl
-cyclodextrin on the cell surface expression of UCE was
measured, cells were incubated for 2 h at 37°C in
MEM
containing 10 mM methyl
-cyclodextrin, which was then aspirated
before the cell layers were assayed for UCE in 10 mM methyl
-cyclodextrin in the presence or absence of Triton X-100 as
described above.
Antibodies and Immunofluorescence Microscopy
Mouse monoclonal antibody (mAb) UC-1 to bovine UCE was prepared
as previously described (Kornfeld et al., 1998
). Rabbit
antibody to human UCE was raised by injecting rabbits with an
affinity-purified 6His-tagged fusion protein containing the
carboxyl-terminal region of human UCE (amino acids 172-515) expressed
in Escherichia coli BL21 cells from the pQE-32 QIA express
vector as described by the manufacturer (Qiagen, Chatsworth, CA) The
antisera were affinity purified with the use of a column of Ultralink
(Pierce) to which the UCE antigen had been coupled. Rabbit anti-TGN 38 antiserum raised to a synthetic peptide corresponding to the C-terminal 21 amino acids of rat TGN 38 was kindly provided by Dr. George Banting
(University of Bristol, UK). Sheep anti-human TGN 46 was from Serotec
(Oxford, UK) and mAb GT2/36/118 specific for the human
galactosyltransferase (Berger et al., 1986
) was kindly
provided by Dr. Erich G. Berger (University of Zurich, Switzerland).
Indirect immunofluorescence microscopy of MDBK cells was carried out on
cells grown on glass coverslips in
MEM-10% fetal bovine serum,
washed, fixed in 3.7% formaldehyde, permeabilized in 0.2% saponin,
and treated with primary and secondary antibodies as described by Drake
et al. (2000)
. The primary mouse mAb UC-1 was an ammonium
sulfate fraction from tissue culture supernatant (containing ~400
µg/ml mouse IgG) and was used at a dilution of 1:10; the rabbit
anti-TGN 38 was diluted 1:500. The secondary antibodies were
goat-anti-mouse Alexa 488 and goat anti-rabbit Alexa 594 conjugates
(Molecular Probes, Eugene, OR) diluted 1:250.
Confocal immunofluorescence microscopy on GFP-UCE-transfected HeLa
cells was carried out as described by Schweizer et al. (1988)
except that the cells were grown on glass coverslips that were
treated with nitric acid. Cells in Figure 6 were incubated for 30 min
either in growth media supplied with a 1:1000 dilution of a
concentrated brefeldin A (BFA) (Sigma, St. Louis, MO) solution (5 mg/ml
in methanol) or in mock-treated growth medium. Formaldehyde-fixed and
saponin-permeabilized cells were incubated with a 1:10 dilution of mAb
GT2/36/118 against galactosyltransferase or a 1:200 dilution of sheep
anti-human TGN 46 antibodies. The secondary antibodies were goat
anti-mouse Alexa 568 and donkey anti-sheep Alexa 594 conjugates
(Molecular Probes) diluted 1:1000. The coverslips were mounted on glass
slides in Antifade (Molecular Probes) for viewing with an inverted
Leica (Deerfield, IL) microscope equipped with the TCS confocal system
and an Ar/Kr laser. Serial sections in the z-axis through
the entire cells were taken, and the resulting stacks of images were
analyzed with the use of the Imaris program (Bitplane AG, Zurich,
Switzerland) and deconvoluted with the use of Huygens program (Mat & Met: Scientific Volume Imaging, Hilversum, The Netherlands,).
| |
RESULTS |
|---|
|
|
|---|
UCE Colocalizes with TGN 38 in MDBK Cells
Indirect immunofluorescence microscopy was used to double label
Madin-Darby bovine kidney (MDBK) cells with the mouse monoclonal anti-bovine UCE antibody UC-1 and a rabbit polyclonal antibody to TGN
38, a well characterized TGN marker. Figure
1 shows that the endogenous UCE (a,
green) and TGN 38 (b, red) in MDBK cells colocalize in a juxtanuclear
region consistent with UCE residing primarily in the TGN. Given this
finding one would expect the glycoprotein enzyme to become sialylated
by the sialyltransferases that reside in the Golgi and the TGN.
|
Human UCE Expressed in Mouse L-Cells Is Sialylated
The cDNAs encoding human UCE and two mutants of the cytosolic tail
that disrupt the tyrosine-based (Y488A) and NPF (H510stop) endocytosis
motifs were stably expressed in mouse L-cells. The levels of enzyme
activity expressed in the solubilized membrane extracts of these cells
varied from 22- to 55-fold higher than the endogenous activity in the
parental L-cells and 12- to 29-fold higher than the endogenous activity
in human Hep G2 cells. When the membrane extracts of stably transfected
cells were desialylated by treatment with neuraminidase, subjected to
SDS-PAGE under reducing conditions, blotted, and probed with rabbit
anti-human UCE antibody, the results shown in Figure
2 were obtained. Without treatment, the
wild type (lane 1) and Y488A mutant (lane 3) have monomer UCE bands at
~80 kDa, similarly to endogenous human UCE in Hep G2 cells (not
shown). These bands shift to ~75 kDa after neuraminidase treatment
(lanes 2 and 4). In contrast, the H510 stop mutant has monomer bands at
76 kDa before (lane 5) and at 70 kDa after neuraminidase treatment
(lane 6), reflecting its slightly smaller size because of the removal
of its carboxyl-terminal peptide HNPFKD. These results show that the
wild-type and mutant UCEs must have been exposed to sialyltransferase
in the trans-Golgi-TGN of the L-cells. Furthermore, the
discrete shifts observed (rather than smears) indicate that essentially
every monomer of the enzyme has become sialylated and probably to the
same extent. It is not possible to determine what extent of sialylation
has occurred because removal of sialic acid from a glycoprotein not
only alters its size but also its charge and can produce anomalous
mobility changes on SDS-PAGE.
|
It thus appears that wild-type and mutant UCE, like other type I
transmembrane glycoproteins, are core glycosylated as they enter the
ER, traverse the Golgi apparatus where their oligosaccharides are
processed to complex-type structures, and finally undergo addition of
sialic acid in the TGN. Where else does UCE traffic? The presence of
the internalization motif 488YHPL suggests that
UCE may travel to the plasma membrane and be returned to the TGN via
clathrin-coated vesicles, as is the case for TGN 38 (Reaves et
al., 1993
; Wong and Hong, 1993
; Ponnambalam et al.,
1994
) and TGN 46 (Ponnambalam et al., 1996
; Kain et
al., 1998
). The L-cells expressing wild-type and Y488A mutant UCE
were examined by indirect immunofluorescence microscopy with the use of
the rabbit anti-human UCE antibody. Wild-type UCE was visualized in the
Golgi region of permeabilized L-cells, whereas Y488A UCE was seen on
the cell surface of nonpermeabilized L-cells (data not shown). To
quantitate the amount of UCE on the cell surface of intact cells,
compared with total intracellular UCE, advantage was taken of the
sensitivity of the enzymatic assay for UCE activity. Parental L-cells
and L-cells expressing wild-type, Y488A, and H510 stop human UCE were
grown in triplicate in the wells of a 24-well tissue culture plate.
After the cell layers were washed, the A wells were used to measure
cell surface enzyme activity on intact cells, the B wells were used to
measure total cellular enzyme activity in the presence of Triton X-100,
and the C wells were incubated without substrate and the supernatant
was then assayed for secreted enzyme activity. Table
1 shows the average results of these
enzyme assays from two separate experiments. After subtraction of the
contribution from the parental L-cells, it can be seen that <1% of
the total wild-type UCE is present on the plasma membrane, whereas 63%
of the Y488A mutant UCE is present on the plasma membrane at steady
state. The H510 stop mutant is intermediate with 7.1% of the enzyme
activity at the cell surface. These results suggest that UCE normally
traffics to the plasma membrane and is efficiently internalized via the 488YHPL motif in its cytosolic tail. The NPF
endocytosis motif, absent in the H510 stop mutant, may play a minor
role in endocytosis at the cell surface. We next examined whether
inhibition of endocytosis at the plasma membrane would cause the
wild-type UCE to accumulate at the cell surface. Methyl
-cyclodextrin, which extracts cholesterol from cell membranes
(Kilsdonk et al. (1995)
has been shown by Rodal et
al. (1999)
and Subtil et al. (1999)
to inhibit
clathrin-coated vesicle-mediated endocytosis of transferrin receptor.
When the mouse L-cells expressing wild-type human UCE were preincubated with methyl
-cyclodextrin before assaying the distribution of UCE
activity, the results shown in Figure 3
were obtained. Although the total UCE activity in cells was unchanged
by methyl
-cyclodextrin treatment, the proportion of UCE activity at
the cell surface rose to 40% of the total activity compared with 3%
in untreated cells. This result indicates that inhibition of
endocytosis at the plasma membrane has trapped UCE that has trafficked
from the TGN to the plasma membrane. To answer the question whether the tyrosine-based internalization motif is used in normal cells to return
plasma membrane UCE to the TGN, we turned again to MDBK cells.
|
|
Cycling of UCE from Plasma Membrane to the TGN
To demonstrate that native UCE cycles between the TGN and the
plasma membrane, mAb directed against the luminal domain of bovine UCE
was incubated with MDBK cells for 2 h at 37°C. The cells were
washed and then processed for immunofluorescence with the use of
secondary anti-mouse antibody conjugated to Alexa Fluor 488 (green), as
well as double-labeled with a primary rabbit antibody to TGN 38 detected with a secondary anti-rabbit antibody conjugated to Alexa 594 (red). As shown in Figure 4, the two
fluorescent probes colocalize, indicating that UCE at the plasma
membrane has carried the anti-UCE antibody (a, green) to the TGN where endogenous TGN 38 (b, red) resides. Cells incubated for 2 h at 4°C with anti-UCE showed no uptake of antibody. Measurement of MDBK
UCE activity, both total and cell surface, as described in Table 1
showed that 1.4% of the total UCE was present at the plasma membrane
at steady state. This experiment shows that the normal traffic of UCE
includes its movement from the TGN to the plasma membrane, followed by
its internalization and return to the TGN.
|
Intracellular Location of GFP-UCE Fusion Proteins
To determine whether the large luminal domain of UCE was involved in the trafficking of UCE and to obtain finer immunofluorescence images, wild-type and mutant constructs of UCE containing GFP in place of the luminal domain were prepared and expressed in HeLa cells.
The structures of the various GFP-UCE TM-cytosolic tail
constructs are shown in Figure 7. The construct containing the
wild-type UCE TM-cytosolic tail was transfected into HeLa cells and a
stably expressing clone (no. 9) was isolated. As shown in Figure
5, the GFP-UCE wild type in clone 9 cells
as well as endogenous UCE in untransfected HeLa cells showed
colocalization of UCE with endogenous TGN 46 in the
trans-Golgi network. The colocalization of UCE and the
GFP-UCE chimera indicates that the intracellular location of UCE is
dictated by its transmembrane and cytosolic tail domains. To establish
in which part of the Golgi apparatus the GFP-UCE resides, the
experiment shown in Figure 6 was
performed with stably transfected HeLa cells with the use of double
labeling with an antibody to galactosyltransferase, a marker for the
trans-Golgi cisternae. Figure 6a shows that the GFP-UCE and
endogenous galactosyltransferase both appear in the Golgi region but,
except for slight regions of overlap, do not colocalize. When BFA is
added to the HeLa cells for 30 min (Figure 6b) the
galactosyltransferase signal is dispersed into the reticular network of
the ER as expected for a protein in the Golgi cisternae
(Lippincott-Schwartz et al., 1991
; Wood et al.,
1991
). In contrast the GFP-UCE disperses into a different, nonoverlapping network, characteristic of TGN fusion with the endosomal
system. These results indicate that GFP-UCE resides in the TGN.
|
|
To determine whether the internalization motifs in the cytosolic tail
of the GFP-UCE altered its steady-state subcellular localization, the
experiment shown in Figure 7 was carried
out on HeLa cells transiently transfected with the wild-type and mutant constructs as depicted. GFP-UCE wild type is located in the TGN as
before, the GFP-UCE Y488A is primarily located at the plasma membrane,
and GFP-UCE H510stop is primarily in a TGN-like location. This
indicates that the 488YHPL motif is required for
endocytosis of GFP-UCE from the plasma membrane and return to the TGN,
whereas deletion of the NPF motif has only a modest effect on this
pathway. The intracellular distribution of the GFP-UCE TM-cytosolic
tail construct faithfully duplicates the behavior of the intact UCE,
further emphasizing the importance of the cytosolic YHPL motif in
mediating return of UCE from the plasma membrane to the TGN.
Interestingly, the mutant GFP-UCE Y486 stop in which the cytosolic tail
was truncated before the 488YHPL endocytosis
motif, was localized to the TGN. One might have expected this mutant to
behave like the Y488A mutant, i.e., lacking a retrieval motif, to
localize to the plasma membrane.
|
| |
DISCUSSION |
|---|
|
|
|---|
The findings presented in this study establish that the majority
of UCE resides in the TGN at steady state. UCE colocalizes with TGN 38 in MDBK cells and TGN 46 in HeLa cells, whereas GFP-UCE does not
colocalize with galactosyltransferase (a trans-Golgi marker)
in HeLa cells. In addition, GFP-UCE redistributes into a distinct
network after BFA treatment, differently from the redistribution of
galactosyltransferase into the ER. These findings resolve a long-standing controversy over whether UCE is localized in the Golgi to
the cis/middle or trans/TGN region based on
various density gradient fractionation methods (Pohlmann et
al., 1982
; Deutscher et al., 1983
; Goldberg and
Kornfeld, 1983
).
Although the majority of UCE is localized in the TGN, we found that a
small but measurable amount (0.8-1.6%) of the enzyme is present at
the cell surface at steady state. This cell surface enzyme recycles
back to the TGN as shown by the ability of MDBK cells to internalize
anti-UCE antibody from the cell surface and deliver it to the TGN. The
YHPL motif in the cytosolic tail of UCE is critical for internalization
since 63% of the enzyme activity of the Y488A mutant was found on the
plasma membrane. Similarly the majority of the GFP-UCE construct with
the Y488A mutation was localized to the cell surface. When L-cells
expressing wild-type human UCE were treated with methyl
-cyclodextrin to inhibit endocytosis, 40% of the UCE accumulated at
the cell surface, confirming that the enzyme cycles from the TGN to the
plasma membrane. The UCE in which the NPFKD motif was deleted from the
C terminus (H510stop) showed some increased presence at the cell
surface (7%), suggesting a slower rate of return to the TGN. The lack
of any obvious distortion of the distribution of the GFP-UCE construct
with the same mutation in HeLa cells suggests that the role of the
NPFKD motif in endocytosis may be secondary.
The presence of the majority of UCE in the TGN suggests that the enzyme
acts on its lysosomal hydrolase substrates in the TGN rather than in
earlier parts of the Golgi. Kinetic studies of the biosynthesis of
phosphorylated oligosaccharides in cells pulse labeled with
2-[3H]mannose and chased for various times showed that
oligosaccharides bearing phosphodiesters (GlcNAc-P-Man) were made early
and subsequently replaced by those bearing phosphomonoesters (Man 6-P),
that is "uncovered" species (Goldberg and Kornfeld, 1981
). However
this approach did not reveal the compartment where uncovering of the
diesters occurred. More recently two studies were published that
support the idea that phosphomonoester formation occurs in a
compartment beyond the BFA block (i.e., in the TGN). Radons et
al. (1990)
studied the oligosaccharides on the lysosomal enzyme
cathepsin D and Sampath et al. (1992)
studied the total cellular phosphorylated oligosaccharides in cells treated with BFA.
Both groups found that in vivo the presence of BFA caused a diminished
rate of oligosaccharide phosphorylation but an almost complete
inhibition of phosphodiester uncovering. This result is compatible with
the presence of phosphotransferase activity in the ER-Golgi
intermediate compartment and the cis-Golgi (Lazzarino and
Gabel, 1987
; Dittmer and von Figura, 1999
) and the presence of UCE in
the TGN.
It may be advantageous to delay uncovering until the substrates arrive
at the TGN to ensure that random phosphatase action in the secretory
pathway cannot remove the phosphate groups exposed by UCE and render
the lysosomal hydrolases unable to bind the MPRs. Furthermore,
hydrolases in the TGN that fail to bind to a MPR because their
phosphorylated oligosaccharides are not converted to monoesters could
be included in Golgi exocytic vesicles along with UCE and travel to the
plasma membrane. During this transit UCE could complete the uncovering
of their phosphorylated oligosaccharides, and once released at the
plasma membrane these lysosomal hydrolases could be recaptured by MPRs
at the cell surface and carried to lysosomes. In fact it is known that
5-10% of hydrolases produced by fibroblasts traffic to lysosomes via
secretion-recapture, although the basis for this alternative routing
has not been established (Vladutiu and Rattazzi, 1979
). This scenario
also provides a rationale for the recycling pathway of UCE between the
TGN and plasma membrane. Chapman and Munro (1994)
have speculated that
the endoprotease furin, which also cycles between the TGN and the
plasma membrane, could continue to degrade its substrates in exocytic
vesicles leaving the Golgi.
Both furin and TGN 38/TGN 46, like UCE, undergo endocytosis from the
plasma membrane that is dependant on the presence of a tyrosine-based
motif in their cytosolic domains (Reaves et al., 1993
; Wong
and Hong, 1993
; Ponnambalam et al., 1994
, 1996
; Kain et al., 1998
; Molloy et al., 1999
). In the cases
of TGN 38 and TGN 46 this motif is YQRL; in furin it is YKGL. These
signals, like the YHPL of UCE, fit the YXX
motif (where
is a
bulky hydrophobic residue) present in many receptors that are
internalized in clathrin-coated vesicles at the plasma membrane because
their YXX
sequence is able to bind to the µ subunit of the plasma
membrane adaptor complex AP2 (Ohno et al., 1995
). The
cytosolic domains of internalized membrane proteins contain other
sorting signals in addition to a tyrosine-based signal that play roles
in their subsequent intracellular trafficking pathway. Mallet and
Maxfield (1999)
have provided evidence that chimeric forms of furin and
TGN 38 are transported from the plasma membrane to the TGN by distinct
endosomal pathways. It may be that UCE and TGN 46 also traffic through
different endosomal pathways in HeLa cells on their return to the TGN
from the plasma membrane, because the two signals in the peripheral
vesicles in double-labeled cells (e.g., as in Figure 5) when carefully
compared do not show any colocalization, in contrast to their
colocalization in the TGN (data not shown). In all probability,
the numerous sorting signals in the cytosolic domain of furin,
including, in addition to YKGL, its acidic cluster motif, which
undergoes phosphorylation and dephosphorylation (Molloy et
al., 1999
), define its unique trafficking pathway. The fact that
UCE contains a second known endocytosis motif in the NPFKD sequence
(Tan et al., 1996
) at its C terminus suggests that motif may
also direct some sorting step in the pathway of UCE cycling between the
TGN and the plasma membrane. The present results suggest that NPFKD
plays a modest role in the rate of internalization at the plasma
membrane. Further studies will be necessary to determine whether, for
example, Eps 15, which can bind NPF motifs through its N-terminal EH
domains (Salcini et al., 1997
) and bind the
subunit of
AP2 through its C terminus (Benmerah et al., 1996
), may
facilitate the interaction of the cytosolic domain of UCE with AP2 and
the plasma membrane endocytosis machinery. The unexpected observation
that the GFP-UCE Y486 stop mutant was retained in the TGN indicates
that UCE, like TGN 38 (Ponnambalam et al., 1994
), has a TGN
retention signal in its transmembrane domain as well as a
tyrosine-based retrieval signal in its cytosolic tail. It further
suggests that what the Y486 stop mutant may lack is a TGN exit signal
that allows UCE to move to the plasma membrane. Work is currently
underway to explore this possibility. Interestingly, another class of
Golgi proteins, namely, glycosyltransferases that are type II
membrane-spanning proteins, contain Golgi retention signals in their
transmembrane domains (Colley, 1997
) but do not cycle to the plasma
membrane. Thus, UCE is unique among the known oligosaccharide-modifying enzymes in possessing a complex intracellular trafficking pattern that
appears to be related to its function in the biogenesis of lysosomes.
| |
ACKNOWLEDGMENTS |
|---|
We thank Wang Sik Lee for his help with the methyl
-cyclodextrin experiments and we thank Stuart Kornfeld and Anja
Schweizer for suggestions and comments. This work was funded in part by National Institutes of Health grant CA08759 and a Professor Dr. Max
Cloeffa fellowship to J.R.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
rkornfel{at}im.wustl.edu.
| |
ABBREVIATIONS |
|---|
Abbreviations used: BFA, brefeldin A; ER, endoplasmic reticulum; GFP, green fluorescent protein; Man 6-P, mannose 6-phosphate; mAb, monoclonal antibody; MPRs, mannose 6-phosphate receptors; PCR, polymerase chain reaction; phosphotransferase, UDP-N-acetylglucosamine:lysosomal enzyme N-acetylglucosamine-1-phosphotransferase; TGN, trans-Golgi network; UCE, "uncovering" enzyme.
| |
REFERENCES |
|---|
|
|
|---|
-adaptin interacts with the COOH-terminal domain of the Eps 15 protein.
J. Biol. Chem.
271, 12111-12116
-glucuronidase oligosaccharides in mouse P388D cells.
J. Biol. Chem.
256, 13060-13067
-N-acetylglucosamine(1) phospho(6) mannose diester groups.
Proc. Natl. Acad. Sci. USA
77, 7074-7078
-N-acetylglucosamine-1-phosphodiester
-N-acetylglucosaminidase.
J. Biol. Chem.
273, 23203-23210
-N-acetylglucosamine-1-phosphodiester
-N-acetylglucosaminidase.
J. Biol. Chem.
274, 32778-32785
-N-acetylglucosamine-1-phosphodiester
-N-acetylglucosaminidase (uncovering enzyme).
Anal. Biochem.
205, 200-207[Medline].
-cyclodextrin perturbs formation of clathrin-coated endocytic vesicles.
Mol. Biol. Cell
10, 961-974
-glucuronidase contain high mannose oligosaccharides with blocked phosphate residues.
J. Biol. Chem.
255, 6633-6639
-N-acetylglucosaminyl phosphodiesterase capable of removing "blocking":
-N-acetylglucosamine residues from phosphorylated high mannose oligosaccharides of lysosomal enzymes.
J. Biol. Chem.
255, 8398-8401
-N-acetylglucosaminyl phosphodiesterase.
J. Biol. Chem.
256, 9937-9943
-N-acetyl-D-glucosaminidase (formerly called
-N-acetylglucosaminylphosphodiesterase) and lysosomal
-N-acetylglucosaminidase.
Arch. Biochem. Biophys.
222, 145-149[Medline].
-hexosaminidase in normal and I-cell disease cultured fibroblasts.
J. Clin. Invest.
63, 595-601.
-N-acetylglucosaminyl phosphodiesterase.
J. Biol. Chem.
256, 5717-5721This article has been cited by other articles:
![]() |
N. M Dahms, L. J Olson, and J.-J. P Kim Strategies for carbohydrate recognition by the mannose 6-phosphate receptors Glycobiology, September 1, 2008; 18(9): 664 - 678. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Perez-Victoria, G. A. Mardones, and J. S. Bonifacino Requirement of the Human GARP Complex for Mannose 6-phosphate-receptor-dependent Sorting of Cathepsin D to Lysosomes Mol. Biol. Cell, June 1, 2008; 19(6): 2350 - 2362. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P Jongen, G. J Gerwig, B. R Leeflang, K. Koles, M. L. Mannesse, P. H. van Berkel, F. R Pieper, M. A Kroos, A. J. Reuser, Q. Zhou, et al. N-glycans of recombinant human acid {alpha}-glucosidase expressed in the milk of transgenic rabbits Glycobiology, June 1, 2007; 17(6): 600 - 619. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. C. Probst, P. Ton, B. Svoboda, A. Gannon, W. Schuhmann, J. Wieser, R. Pohlmann, and L. Mach The 46-kDa mannose 6-phosphate receptor does not depend on endosomal acidification for delivery of hydrolases to lysosomes J. Cell Sci., December 1, 2006; 119(23): 4935 - 4943. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Schaub, B. Berger, E. G. Berger, and J. Rohrer Transition of Galactosyltransferase 1 from Trans-Golgi Cisterna to the Trans-Golgi Network Is Signal Mediated Mol. Biol. Cell, December 1, 2006; 17(12): 5153 - 5162. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Nair, B. E. Schaub, K. Huang, X. Chen, R. F. Murphy, J. M. Griffith, H. J. Geuze, and J. Rohrer Characterization of the TGN exit signal of the human mannose 6-phosphate uncovering enzyme J. Cell Sci., July 1, 2005; 118(13): 2949 - 2956. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Nair, B. E. Schaub, and J. Rohrer Characterization of the Endosomal Sorting Signal of the Cation-dependent Mannose 6-Phosphate Receptor J. Biol. Chem., June 27, 2003; 278(27): 24753 - 24758. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Morlon-Guyot, M. Helmy, S. Lombard-Frasca, D. Pignol, G. Pieroni, and B. Beaumelle Identification of the Ricin Lipase Site and Implication in Cytotoxicity J. Biol. Chem., May 2, 2003; 278(19): 17006 - 17011. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Golabek, E. Kida, M. Walus, P. Wujek, P. Mehta, and K. E. Wisniewski Biosynthesis, Glycosylation, and Enzymatic Processing in Vivo of Human Tripeptidyl-peptidase I J. Biol. Chem., February 21, 2003; 278(9): 7135 - 7145. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.-L. Eskelinen, A. L. Illert, Y. Tanaka, G. Schwarzmann, J. Blanz, K. von Figura, and P. Saftig Role of LAMP-2 in Lysosome Biogenesis and Autophagy Mol. Biol. Cell, September 1, 2002; 13(9): 3355 - 3368. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Do, W.-S. Lee, P. Ghosh, T. Hollowell, W. Canfield, and S. Kornfeld Human Mannose 6-Phosphate-uncovering Enzyme Is Synthesized as a Proenzyme That Is Activated by the Endoprotease Furin J. Biol. Chem., August 9, 2002; 277(33): 29737 - 29744. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-S. Lee, J. Rohrer, R. Kornfeld, and S. Kornfeld Multiple Signals Regulate Trafficking of the Mannose 6-Phosphate-uncovering Enzyme J. Biol. Chem., January 25, 2002; 277(5): 3544 - 3551. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||