|
|
|
|
Vol. 12, Issue 6, 1671-1685, June 2001


and
*School of Biological Sciences, University of Kentucky, Lexington,
Kentucky 40506-0225; and
Department of Biological
Sciences, McGill University, Montreal, Quebec H3A 1B1, Canada
| |
ABSTRACT |
|---|
|
|
|---|
Heterochromatin protein 1 (HP1) is a conserved component of the highly compact chromatin of higher eukaryotic centromeres and telomeres. Cytogenetic experiments in Drosophila have shown that HP1 localization into this chromatin is perturbed in mutants for the origin recognition complex (ORC) 2 subunit. ORC has a multisubunit DNA-binding activity that binds origins of DNA replication where it is required for origin firing. The DNA-binding activity of ORC is also used in the recruitment of the Sir1 protein to silence nucleation sites flanking silent copies of the mating-type genes in Saccharomyces cerevisiae. A fraction of HP1 in the maternally loaded cytoplasm of the early Drosophila embryo is associated with a multiprotein complex containing Drosophila melanogaster ORC subunits. This complex appears to be poised to function in heterochromatin assembly later in embryonic development. Here we report the identification of a novel component of this complex, the HP1/ORC-associated protein. This protein contains similarity to DNA sequence-specific HMG proteins and is shown to bind specific satellite sequences and the telomere-associated sequence in vitro. The protein is shown to have heterochromatic localization in both diploid interphase and mitotic chromosomes and polytene chromosomes. Moreover, the gene encoding HP1/ORC-associated protein was found to display reciprocal dose-dependent variegation modifier phenotypes, similar to those for mutants in HP1 and the ORC 2 subunit.
| |
INTRODUCTION |
|---|
|
|
|---|
The eukaryotic nucleus undergoes dramatic morphological changes as
it progresses through the cell cycle. The condensation of the chromatin
upon entry into mitosis and its subsequent decondensation at the end of
mitosis is one of the more stunning events. Certain regions of the
chromosomes, termed heterochromatin, fail to undergo these condensation
cycles but retain a compact appearance throughout the cell cycle
(Heitz, 1928
). Heterochromatin also has different functional properties
from more typical chromosomal regions (euchromatin). It often causes
silencing of euchromatic genes that are juxtaposed to it by chromosomal
rearrangement, is typically replicated later in S phase than
euchromatin, and usually occupies a distinct subnuclear domain along
the nuclear periphery (for review, see Brown, 1966
). The centromeres
and telomeres of higher eukaryotic chromosomes typically have a
heterochromatic organization, and this structure is known to be
important for proper chromosome mechanics during mitosis and meiosis
(Allshire et al., 1995
; Kellum et al., 1995
; Dernburg et al., 1996
; Karpen et al. 1996
; Fanti
et al., 1998
; for review, see Dobie et al.,
1999
).
The compact appearance of heterochromatin is likely to involve a unique
nucleoprotein composition. It is known to be enriched with repetitive
noncoding DNA, such as the AT-rich satellite sequences (Peacock
et al., 1976
, 1977
; Peacock and Lohe, 1980
), and to contain specific proteins. In the genetically tractable organisms of
Saccharomyces cerevisiae, Schizosaccharomyces
pombe, and Drosophila (Sinclair et al.,
1983
; Wustmann et al., 1989
; Laurenson and Rine, 1992
; Allshire et al., 1995
), genetic assays have been used to
identify heterochromatin-associated proteins. Mutations in genes that
are required to form Drosophila heterochromatin suppress the
variegated expression of a euchromatic gene caused by its placement
next to heterochromatin by a chromosomal rearrangement. The product of
the suppressor of variegation 2-5 gene, heterochromatin
protein 1 (HP1; James and Elgin, 1986
; Eissenberg et al.,
1990
), is a heterochromatic protein that is conserved from fission
yeast to humans (Saunders et al., 1993
; Allshire et
al., 1995
; Pak et al., 1997
).
Because direct DNA-binding activity had not been attributed to HP1, its
localization into heterochromatin has long been thought to involve the
DNA-binding activities of other proteins. Mutations in the origin
recognition complex (ORC) 2 subunit of the Drosophila melanogaster ORC (DmORC) were recently shown to
perturb HP1 localization (Pak et al., 1997
; Huang et
al., 1998
). This highly conserved protein complex was purified
from S. cerevisiae as in vitro binding activity for
sequences that permit autonomous replication of plasmids in vivo (Bell
and Stillman, 1992
). It is also known to be required for replication of
chromosomal DNA (Bell et al., 1993
; Rowles et
al., 1996
; Landis et al., 1997
) and to be associated
with specific replicator sequences in S. cerevisiae and
metazoans (Aparicio et al., 1997
; Austin et al.,
1999
; Royzman et al., 1999
). The DNA-binding activity of ORC
serves a second function in S. cerevisiae in the recruitment
of the Sir1 protein to ORC-binding sequences within a pair of silencing
nucleation sites flanking silent copies of the mating-type genes (Bell
et al., 1993
; Chien et al., 1993
; Fox et
al., 1995
; Triolo and Sternglanz, 1996
). The Sir1 protein then
acts in conjunction with the DNA-binding proteins repressor-activator protein 1 (Rap1) and ARS-binding factor 1 (Abf1), which also bind sequences in the silencing nucleator, to recruit other members of the
Sir protein complex to the site through heterotypic and homotypic
protein-protein interactions (Pillus and Rine, 1989
; Kurtz and Shore,
1991
; Hecht et al., 1995
; Moazed et al., 1997
). The observation that Drosophila ORC subunits are associated
with HP1 in interphase heterochromatin and cause a perturbation in the
localization of HP1 into heterochromatin when mutated suggests a
similar role for ORC in Drosophila heterochromatin assembly (Pak et al., 1997
; Huang et al., 1998
).
It is not understood how the heterochromatin assembly function of ORC
might be specified in heterochromatin, whereas its more general role in
DNA replication is carried out throughout the genome. Studies in
S. cerevisiae with a synthetic silencer that contains a
consensus ARS sequence combined with Rap1 and Abf1 binding sites
from nonsilenced chromosomal regions showed the silencing activity of
an ARS sequence to be DNA context dependent (McNally and Rine, 1991
). A
similar set of protein-binding sequences and associated factors might
also cooperate with ORC in Drosophila heterochromatin
assembly. Here we report the identification of a 55-kDa protein that
copurifies with an ORC-containing complex of HP1 from the cytoplasm of
the early Drosophila embryo that appears to be poised for
function in heterochromatin assembly later in embryonic development
(Huang et al., 1998
). The protein contains an HMG box and is
proposed to serve a role in Drosophila heterochromatin
assembly that is similar to those of the Rap1 and Abf1 proteins in
budding yeast.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Peptide Sequence Identification of HP1/ORC-associated Protein
The 55-kDa HP1/ORC-associated protein (HOAP) was
coimmunoaffinity purified from a cytoplasmic extract of early
Drosophila embryos as previously described (Huang et
al., 1998
). The Coomassie brilliant blue-stained band for a
55-kDa copurifying protein (p55) was excised from an SDS-polyacrylamide
gel and subjected to in situ proteolytic cleavage and peptide sequence
determination by Edman degradation at Harvard Microchemistry
(Cambridge, MA). The National Center for Biotechnology Information
database was searched with sequences from 2 different peptides of the
protein (QMSAFLRKYLAD and TRITEEDLARPYTED), and both sequences were
found to match the sequence in the hypothetical protein-coding sequence
for the Drosophila anonymous fast-evolving 1G5 (anon
fe 1G5) gene (Schmid and Tautz, 1997
).
Antibody Preparation
Antibodies were increased against a fusion protein expressed
from an anon fe 1G5 cDNA PCR amplified from an ovarian cDNA
library (Stroumbakis et al., 1994
) with the use of
oligonucleotide primers designed from the 5' (ATGTCGGGGACGCAAATGTCTG)
and 3' (CAATCGGGTGATGTTCTGCTTC) ends of the gene. The anon fe
1G5 cDNA was ligated into the XbaI and XhoI
sites of the pET20b vector to produce the complete hypothetical anon fe 1G5 gene product with the pelB leader (19 amino
acids) fused to its amino terminus and a 6-histidine tag fused to its carboxyl terminus. The tagged fusion protein was expressed in bacteria,
purified by Ni-nitrile triacetic acid-agarose chromatography and
PAGE, and used in rabbit immunoinjections (4 biweekly subcutaneous injections of 1 ml). The antiserum was affinity purified over an
Affigel-10 column (Bio-Rad, Hercules, CA) containing the
expressed anon fe 1G5 gene fusion protein.
The anti-DmORC 2 antibody was increased against a synthetic peptide of the DmORC 2 protein (KRSVDGSEQLTIPIDGALLQQFLEEQ) (Berkeley Drosophila Genome Project [BDGP] accession number AAC46955) covalently linked to keyhole lymphet hemocyanin and was affinity purified over a column containing the synthetic peptide (Research Genetics, Huntsville, AL).
The anti-HP1 antibody used in all experiments was increased against an
amino-terminal peptide of HP1 (CIDNPESSAKVSDAEEE) in rabbits and
immunoaffinity purified over a 6-histidine HP1 affinity chromatography
column as previously described (Huang et al., 1998
).
Immunoprecipitation Experiments
An antibody directed against the HP1 peptide (Huang et
al., 1998
) was used to immunoprecipitate the large ORC-containing
HP1 complex from sized fractions of an embryonic cytoplasm extract as
described by Huang et al. (1998)
. The antibody prepared
against the anon fe 1G5 gene product was used in the
reciprocal experiment of immunoprecipitating HOAP complexes from the
unfractionated cytoplasmic complex. Antibodies that recognize HP1,
HOAP, and Drosophila ORC subunits 2 and 6 (gifts from M. Botchan, University of California at Berkeley, Berkeley, CA)
were used in immunoblot analyses of the fractions from the
immunoprecipitation as described by Huang et al. (1998)
.
Chromatin Immunoprecipitations
Cross-linked chromatin was prepared from salt-extracted cycle 14 interphase nuclei (embryos collected 2.3-3.3 h after oviposition) with
the use of a modification of the methods of Kuo and Allis (1999)
and
Orlando et al. (1997)
. Nuclei were first extracted with 50 mM HEPES, pH 7.6, containing 0.5 M KCl and 0.1% Triton-X 100 to remove
the salt-sensitive fractions of HP1 that are not ORC associated (Huang
et al., 1998
). The salt-resistant chromatin pellet was
resuspended in 50 mM HEPES, pH 7.6, and 60 mM KCl (5 mg DNA/ml), and
formaldehyde, pH 7.0, was added to a final concentration of 0.9% for
10 min at room temperature. The cross-linking reaction was terminated
by pelleting the chromatin and resuspending it once in ice-cold wash
buffer (0.5 M EGTA and 10 mM Tris-HCl, pH 8.0) plus 10 mM EDTA and
0.25% Triton X-100, once in wash buffer plus 0.2 M NaCl and 1.0 mM
EDTA, and once in wash buffer plus 1.0 mM EDTA and 1.0% Triton X-100.
The chromatin pellet was then resuspended in 1% Triton X-100, 1.0 mM
EDTA, 0.5 M EGTA, and 10 mM HEPES, 7.5, and sonicated (four 10-s bursts
on output setting 5) to an average length of 500 bp DNA. Glycerol was
added to a final concentration of 5%, and the samples were stored at
70°C. Where indicated, samples were digested with micrococcal
nuclease I (Mnase I; 0.02 U/OD260 unit) for 0-10
min at room temperature after dialysis into Tris-EDTA and the addition
of MgCl2 to 5 mM.
Cross-linked chromatin samples (200 µl) were diluted 10-fold in
radioimmunoprecipitation assay (RIPA) buffer (1% Triton X-100, 0.1%
Na deoxycholate, 0.1% SDS, 140 mM NaCl, and 1 mM PMSF) and preincubated with protein A-agarose for 1 h before they were
incubated in parallel with
-HP1,
-HOAP, and nonimmune
immunoglobulin G (IgG) immunoresins for 3 h at 4°C (antibodies
were covalently linked to resin with dimethylpimelimidate; Harlow and
Lane, 1988
). The immunoresins were washed 2 times with 10 ml RIPA
buffer and 1 time with LiCl-RIPA (0.25 M LiCl, 0.5% Triton-X, 0.5%
Na-deoxycholate, 1 mM Na-EDTA, and 10 mM Tris-HCl) and then boiled for
5 min in SDS loading buffer (0.25 M Tris, pH 6.8, 10% glycerol, 2%
SDS, 2.5%
-mercaptoethanol, and 0.2 mM bromphenol blue) to reverse chromatin cross-links and release solubilized proteins. Antibodies that
recognize HP1, HOAP, and DmORC 2 (described above), DmORC 6 (a gift
from M. Botchan; Pak et al., 1997
), and DmLamin (a gift from
H. Saumweber and J. Sedat (Howard Hughes Medical Institute, San
Francisco, CA); Saumweber et al., 1980
; Frasch
et al., 1988
) were used to immunoblot
solubilized proteins.
Immunostaining
For embryo immunostaining, Drosophila embryos were
fixed in formaldehyde and immunostained as previously described (Kellum and Alberts, 1995
). Larval brain squashes were prepared by dissecting larval brains from third instar larvae, incubating them in a hypotonic solution (0.5% sodium citrate) for 10 min, and then fixing them in a
drop of 5 methanol:5 acetic acid:0.5 distilled water for 2 min before
they were squashed under a siliconized coverslip over a microscope
slide (Pimpinelli et al., 2000
). Polytene chromosome squashes were prepared from salivary glands dissected from third instar
larvae by the method of Alfageme et al. (1980)
with the use
of Cohen's nuclear medium and fixatives of 2% formaldehyde in PBS for
20 s followed by 50% acetic acid. The coverslips were removed,
and the slides were immersed in cold PBS before they were immunostained
with affinity-purified antibodies that recognize HP1 (1:500 dilution),
HOAP (1:200), or ORC2 (1:100) antibodies (described in Antibody
Preparation). In double-immunostaining experiments, the HP1 antibody
was directly labeled with N-hydroxysuccinimide-rhodamine (Pierce, Rockford, IL; pamphlet 46102); HOAP and ORC 2 antibodies were
indirectly labeled with a fluorescein-labeled antibody that recognizes
rabbit IgG (1:1000; Jackson ImmunoResearch, West Chester, PA). Slides
were incubated with antibodies for 1 h at room temperature and
washed (3 times for 15 min each) between primary and secondary antibody
incubations and after the secondary antibody incubation. Immunostained
specimens were mounted in PBS containing 85% glycerol, 10 mM
p-phenylenediamine, and 0.01 mg/ml DAPI. Images were
acquired with a Leica (Nussloch, Germany) TCSNT confocal
microscope (final magnification, 252×).
Electrophoretic Mobility Shift Assays
The pelB/6-histidine-tagged recombinant HOAP protein was expressed from the pET20b vector in Escherichia coli strain BL21 (DE3) and purified by Ni-NT-agarose chromatography. The column was washed with 250 mM imidizole to remove contaminating proteins and proteolytically cleaved HOAP protein before eluting the full-length fusion protein with 500 mM imidizole. The eluted protein was dialyzed into PBS and concentrated to 200 µg/ml.
Binding reactions (10 µl) were carried out with 0.5 ng (~30 fmol,
3000 cpm) end-labeled probe and 1.2 µg 6-histidine-tagged HOAP
protein (~35 fmol) for 20 min at 30°C in a buffer of 12 mM HEPES,
pH 7.9, 4 mM Tris Cl, pH 7.9, 60 mM KCl, 1 mM EDTA, 1 mM DTT, 0.2 mg/ml
BSA, 2% Tween 20, 12% glycerol, and 250 ng poly[dG-C][d(G-C)] carrier DNA. The reactions were then electrophoresed through a 4%
polyacrylamide gel containing Tris acetate-EDTA buffer (35 mA
for 1.5 h). The labeled probes were prepared from single-stranded oligonucleotides containing 4 tandem repeats of satellite sequences AATAT, AATAG, AATAC, AAGAC, AAGAG, and AACAA and 3 tandem repeats of
satellite sequences AATAAAC, AATAGAC, AAGAGAG, and AATAACATAG. Four
hundred fifty-seven base pairs of the subtelomeric minisatellite telomere-associated sequence (TAS) from chromosome arm 2L (Walter et al., 1995
) were used to examine binding of HOAP to the
TAS sequence. The Drosophila virilis satellite sequence
probes were prepared from single-stranded oligonucleotides containing 4 tandem repeats of satellite sequences ACAAACT, ATAAACT, and ACAAATT. All probes were end labeled to equivalent specific activities (6500 ± 10% cpm/ng) with the use of the filling-in activity of Klenow I. Competition experiments were performed with 50, 100, 200, and
400× excesses of cold competitor to labeled probe. A 63-bp fragment of
the scs chromatin boundary element (Kellum and Schedl, 1991
) was used
as a nonspecific competitor DNA fragment.
Phenotypic Analyses of the anon fe 1G5 Gene
The cytological map position of the anon fe 1G5 gene
was determined by in situ hybridization to polytene chromosome squashes (fee for service by the Department of Biological Sciences [E. Woloshyn]), University of Alberta, Edmonton, Alberta, Canada). The
Df(3R)F89-4 deficiency stock (a gift from E. Knust and the Bloomington Stock Center at Indiana University, Bloomington, IN; Tepass and Knust, 1990
) was used to determine the effect of reducing the dose of the anon fe 1G5 gene on position effect
variegation. An hs-anon fe 1G5 transgene was used
to determine the effect of increasing the dose of the anon fe
1G5 gene on position effect variegation. The
hs-anon fe 1G5 transgenic animals were obtained by P element-mediated germ line transformation of a
P{w+-CaSpeR-hs-anon fe
1G5} vector (fee for service by the Department of Biology [D.
Hickey], University of Ottawa, Ottawa, Ontario, Canada).
Two different reporter genes were used to monitor the effect of the
anon fe 1G5 gene on position effect variegation. The
whitem4 allele, in which the
white gene is juxtaposed to pericentric heterochromatin of
the X chromosome, was used to monitor the effect of the
Df(3R)F89-4 deficiency. To this end,
wm4 females were crossed to
w118/Y;
Df(3R)F89-4/TM3Sb males, and the eye color
phenotypes of the Df(3R)F89-4/+ progeny were compared with
those of their TM3Sb/+ siblings. The eye color phenotypes of
the TM3Sb/+ sibling animals were also compared with those of
the wm4 animals lacking the
TM3Sb chromosome, and the TM3Sb chromosome was
found not to affect the variegated phenotype. The effect of the
Df(3R)F89-4 deficiency and 2 additional copies of the gene from the P{w+}[hsHOAP]
transgene on expression of the In(3L)BL1 hs-lacZ reporter (Lu et al., 1996
) was also determined. Adults of the
genotypes 1) In(3L)BL1/TM3Ser, 2)
In(3L)BL1/Df(3R)f89-4, 3)
P{w+}[hsHOAP];
In(3L)BL1/TM3Ser, and 4)
P{w+}[hsHOAP]/CyO;
In(3L)BL1/TM3Ser were first subjected to heat
shock at 37°C for 30 min to induce expression of the
P{w+}[hsHOAP] transgene.
Embryos were then collected for 3 h at room temperature, heat
shocked at 37°C for 30 min to induce expression of the
In(3L)BL1 hs-lacZ reporter, and allowed to recover for 1 h at room temperature before they were stained for
-galactosidase activity as described by Lu et al. (1996)
.
Collection and staining of embryos from all genotypes were performed
side by side.
-Galactosidase enzymatic activity in each genotype was
quantitated with the use of protein extracts prepared from adults (100 males and 100 females) of each genotype and chlorophenol
red-
-D-galactopyranoside as substrate, as
described by Simon and Lis (1987)
.
| |
RESULTS |
|---|
|
|
|---|
The 55-kDa Copurifying Protein Contains a Peptide Sequence from the anon fe 1G5 Gene Product
The Coomassie brilliant blue-stained band for the 55-kDa protein
(p55) that copurifies with the ORC-containing cytoplasmic complex of
HP1 was excised from an SDS-polyacrylamide gel and subjected to in situ
proteolytic cleavage and Edman degradation peptide sequence
determination by Harvard Microchemistry. The amino acid sequences of 2 different peptides from the protein were determined and used to search
the National Center for Biotechnical Information protein database.
Matches (100%) to both peptide sequences were found within the
hypothetical protein-coding sequence of the anon fe 1G5 gene
from D. melanogaster. This gene and its homologues from
related Drosophila species (Drosophila simulans
[86% identity and 91% similarity] and Drosophila yakuba
[66% identity and 78% similarity]) were identified in a screen for
fast-evolving genes in Drosophila species (Schmid and
Tautz, 1997
). A WU-BLASTP+BEAUTY search with the complete
hypothetical coding sequence showed the amino terminus to contain
similarity to the HMG domain of sex-determining region Y (SRY) proteins
(24% identity and 40% similarity). This region of similarity also has
67% identity and 78% similarity to the consensus sequence shared
between sequence-specific HMG proteins (Grosschedl et al.,
1994
; Figure 1A). The anon fe
1G5 coding sequence is most similar to the sequence-specific group of HMG proteins to which SRY belongs. Like this group of proteins, the
anon fe 1G5 coding sequence contains a single HMG domain, an
asparagine at amino acid position 7, and a conserved substitution for
histidine at position 78 (Grosschedl et al., 1994
; Figure 1A). A novel repeat sequence was also found at the carboxyl terminus of
the anon fe 1G5 gene-coding sequence from D. melanogaster and its homologues in other Drosophila
species (Figure 1B).
|
The anon fe 1G5 Gene Encodes HOAP
Analyses of expressed sequence tag (EST) cDNA clones obtained by
Schmid and Tautz (1997)
and Schmid et al. (1999)
and the BDGP (GadFly, CG6219) predict a product of 337 amino acids encoded from
the anon fe 1G5 gene. Two different versions of cDNA EST clones that differ with respect to the length of their 5' untranslated leader sequences and the predicted translational start site are represented within the collection of BDGP EST clones. The longer cDNA
contains an additional 300 nucleotides originating 736 nucleotides upstream of the shorter cDNA 5' end, mostly consisting of an
untranslated leader sequence that is predicted to encode a protein that
is 8 amino acids longer than the one encoded by the shorter cDNA.
The shorter cDNA (1119 bp) encoding a 337-amino acid protein was
obtained by PCR amplification and cloned in frame to the pelB leader
sequence at the 5' end and a 6-histidine tag at the 3' end of the
pET20b expression vector. The bacterially expressed anon fe
1G5 fusion protein displayed a molecular weight of 55-60 kDa by
SDS-PAGE (Figure 2A, lane 2). Two
lower-molecular-weight polypeptides were also observed in each affinity
purification of the anon fe 1G5 fusion protein. The 55- to
60-kDa polypeptide was excised from a polyacrylamide gel, and
antibodies increased against it were found to recognize the 55-kDa
polypeptide as well as the 2 lower-molecular-weight polypeptides
(Figure 2A, lane 1). This suggested that the lower-molecular-weight
polypeptides are proteolytic cleavage products of the 55- to 60-kDa
protein. Furthermore, expression of the fusion protein in a bacterial
strain that is deficient for both lon(1) and ompT proteases (BL21
[DE3]) reduced the quantities of the lower-molecular-weight forms.
The antiserum also recognized a 55-kDa protein and 2 lower-molecular-weight proteins in the Drosophila embryo
cytoplasmic extract (Figure 2A, lane 2). A higher-molecular-weight
polypeptide in the Drosophila embryo extract was also weakly
recognized by this antibody (Figure 2A, lane 2) but not by subsequent
batches of antibodies produced in other animals (Figure 2A, lane 3).
|
The affinity-purified antiserum was then used to immunoblot
gel filtration fractions of the cytoplasmic extract (Figure 2B). The
fractionation of the endogenous anon fe 1G5 gene product was found to overlap with those of the ORC 2 subunits and the
ORC-containing complexes of HP1. The large HP1 complexes were then
immunoaffinity purified from the gel filtration fractions containing
the HP1/ORC complexes as described by Huang et al. (1998)
,
and antibodies increased against the anon fe 1G5 gene
product were used to determine the presence of this gene product in the
HP1 complexes. These analyses showed both HP1 and the endogenous
anon fe 1G5 gene product to be quantitatively depleted from
the input fraction (Figure 2C, lanes 1 and 2) and specifically retained
on the HP1 immunoaffinity resin (Figure 2C, lanes 4 and 5).
The antiserum was then used in the reciprocal experiment of
immunoprecipitating the endogenous anon fe 1G5 gene product
from the unfractionated cytoplasmic extract to determine by
immunoblot analyses whether HP1 and ORC subunits
coimmunoprecipitate with the anon fe 1G5 gene product
(Figure 2D). A comparison of the immunoblot signal for the
HOAP protein in the input and unretained fractions showed that the
immunoaffinity purification was carried out under near-saturating
conditions (Figure 2D, compare lanes 1 and 3). HP1 and ORC proteins
were also found to immunoprecipitate with the endogenous anon fe
1G5 gene product, although a comparison of the
immunoblot signals for each of these proteins in the input, unretained, and retained fractions (Figure 2D, lanes 1, 2, and 4, respectively) showed that only a small fraction of each protein (2-10%) was retained in the immunoprecipitation. These data are consistent with the fraction of HP1 and ORC subunits in the cytoplasmic extract that were previously determined to exist in the large HP1
complexes (Pak et al., 1997
; Huang et al., 1998
)
and the gel filtration profiles for HP1 and the ORC 2 subunit in
comparison with that of HOAP (Figure 2B). These reciprocal
immunoprecipitation data confirmed the identity of the 55-kDa
copurifying HP1/ORC-associated protein as the product of the anon
fe 1G5 gene; hence, we will refer to the protein as
HP1/ORC-associated Protein (HOAP).
HOAP Is Associated with HP1 and ORC In Salt-resistant Chromatin
The immunoprecipitation experiments described above demonstrate an
association of the anon fe 1G5 gene product (HOAP) with ORC-containing HP1 complexes in the maternally loaded cytoplasm of the
early embryo. For determining whether HOAP is a nuclear protein that is
associated with HP1 and ORC subunits in interphase chromatin, the
antiserum increased against the anon fe 1G5 gene product was
first used to immunoblot fractions of proteins that were
salt extracted from interphase nuclei (Figure
3A). The interphase nuclei for these
experiments were isolated from cycle 14 embryos, the stage at which a
rapid series of synchronous nuclear divisions in early embryogenesis
ends. During this developmental stage, the nuclei acquire a
G2 phase, and the heterochromatin first becomes a
distinct cytological entity. The prolonged interphase of this nuclear
cycle allows one to obtain a nearly homogeneous collection of embryos
with nuclei that are synchronized in interphase and contain fully
formed heterochromatin. Nuclei were isolated from embryos of this stage
and sequentially extracted with successively increasing concentrations
of salt. It was previously shown that each differentially extracted
fraction contains distinct populations of HP1 phosphoisoforms (Huang
et al., 1998
; Figure 3A). The fraction of HP1 that requires
the highest concentration of salt to be extracted (1 M KCl) is
characteristically underphosphorylated and specifically associated with
Drosophila ORC subunits (Huang et al., 1998
). To
determine whether HOAP is a nuclear protein and the strength of its
association with interphase chromatin, the HOAP antibodies were used to
immunoblot the differentially extracted nuclear fractions. These analyses showed HOAP to be a nuclear protein and to be even more
tightly associated with interphase chromatin than the most salt-resistant fraction of HP1 (Figure 3A, lane 4). A significant fraction of DmORC subunits 2 and 6 is also found in the salt-resistant chromatin (Figure 3A).
|
A chromatin immunoprecipitation assay was then used to determine
whether the anon fe 1G5 gene product is present in chromatin fragments containing HP1 and ORC (Figure 3B). The chromatin samples used for these experiments were prepared from interphase nuclei of
cycle 14 embryos that had first been extracted with 0.5 M KCl to remove
all but the most salt-resistant fraction of HP1 that is associated with
ORC subunits. The chromatin was cross-linked by treatment with
formaldehyde and then sonicated to an average length of 500 bp.
Aliquots of the chromatin fragments were then incubated in parallel
with
-HP1,
-HOAP, and nonimmune IgG immunoresins. After an
extensive wash, each immunoresin was resuspended in SDS loading buffer
and boiled for 5 min to reverse the cross-links in the retained
chromatin. The protein released from each immunoresin was then
immunoblotted with antibodies that recognize HP1, HOAP, and
DmORC subunits 2 and 6 (Figure 3B). The immunoblot analyses showed each protein to be present in the
-HP1 chromatin
immunoprecipitate (Figure 3B, lane 3) as well as the
-HOAP chromatin
immunoprecipitate (Figure 3B, lane 2). In contrast,
Drosophila lamin, which was also present in the
salt-resistant chromatin fraction, did not coimmunoprecipitate with
either HP1 or HOAP (Figure 3B, lanes 1-3, Lamin). Visual comparisons
of the immunoblot signal for each protein in the input
(Figure 3B, lane 1, 10% total) and the immunoresin-retained fraction
(Figure 3B, lane 3, 50% total) indicated that HP1, HOAP, and the 2 DmORC subunits were largely depleted from the input fraction in the
-HP1 immunoprecipitation. The DmORC subunits and HOAP were also
depleted from the input chromatin in the HOAP immunoprecipitation;
however; only a small fraction (~10%) of HP1 appeared to be
associated with HOAP in this fraction of chromatin (Figure 3B, compare
lanes 1 and 2). The exact nature of the associations among HP1, HOAP,
and DmORC subunits in this chromatin fraction is not clear, although
the ability of HOAP antibodies to immunodeplete the ORC subunits
suggests a close association among these proteins in this fraction. To
further examine the possibility that HP1, HOAP, and ORC proteins
coprecipitate in chromatin as a result of protein-protein interactions
between different chromatin fragments or the mere proximity of their
binding sites on DNA rather than their being in a complex on chromatin,
the cross-linked chromatin was treated with Mnase I before
immunoprecipitation. As shown in Figure 3B, lanes 5-8, the results of
the chromatin immunoprecipitation with HP1 antibodies were unaffected
by this treatment.
HOAP Colocalizes with Subfractions of HP1 and ORC in Heterochromatin
Immunostaining experiments were then used to determine where in
interphase chromatin the HOAP protein is located. The antibody increased against the anon fe 1G5 gene product was first
used to immunostain cycle 14 Drosophila embryos. Pericentric
heterochromatin is known to occupy a distinct domain at the nuclear
apical surface in embryos of this developmental stage (Foe and Alberts,
1983
). HP1 is enriched approximately fourfold in this domain (James
et al., 1989
; Kellum et al., 1995
). A side view
of the nuclei of an embryo of this stage shows HOAP localized in a
pattern of brightly stained spots at the apical surface where the
intensely DAPI-stained sequences are clustered (Figure
4A). The embryos were coimmunostained with
-HP1 antibodies, and the spots of HOAP immunostaining were found to lie within the larger domain of enriched HP1 staining in these
nuclei (Figure 4A, HOAP [green] and HP1 [red], merged).
|
A similar punctate pattern of HOAP immunostaining was also observed in
the diploid nuclei of wild-type larval brain squashes (Figure 4, B and
C) but absent in squashes from larvae that were homozygous for a
deficiency removing the anon fe 1G5 gene [Figure 4D,
(Def)]. A double-immunostaining experiment was carried out with
-HOAP and
-HP1 antibodies to determine whether the spots of HOAP
immunostaining overlap with the domain of HP1 enrichment in
heterochromatin of these nuclei. As had been observed in embryos, the
spots of HOAP immunostaining were clustered within the domain of
enriched HP1 overlapping the intensely DAPI-stained satellite sequences
of these nuclei [Figure 4B, (DAPI)]. HOAP was also diffusely localized throughout the mitotic chromosomes of larval brain squashes with a slight enrichment throughout pericentric heterochromatin [Figure 4D, (mitotic)].
We also wished to examine the localization of HOAP relative to that of
the DmORC 2 subunit in heterochromatin. To this end, a
double-immunolocalization experiment was undertaken with HOAP antibodies and antibodies increased against a peptide of the
DmORC 2 subunit (Figure 4C). The DmORC 2 antibody
recognizes a single polypeptide of the molecular weight expected for
the DmORC 2 subunit in the embryonic cytoplasm extract (Figure 2A, lane
3). When these antibodies were used in conjunction with antibodies that
recognize HOAP in larval brain squash immunostaining experiments, HOAP
was found to overlap or to be closely apposed to spots of enriched ORC
2 immunostaining in the heterochromatic domain of the nucleus (Figure
4C). These spots were also located near the intensely DAPI-stained
satellite sequences in heterochromatin [Figure 4C, (DAPI)], which
were shown in separate experiments to lie within the domain of enriched
HP1 in heterochromatin as described by Pak et al. (1997)
(our unpublished results).
HOAP Is Localized Predominantly at Telomeres and Diffusely throughout Regions of Pericentric Heterochromatin of Salivary Gland Polytene Chromosomes
To examine the distribution of HOAP protein at higher resolution,
polytene chromosomes from D. melanogaster salivary glands were coimmunostained with
-HOAP and
-HP1 antibodies (Figure 5). These experiments showed a prominent
HOAP localization at the telomere of each chromosome [Figure 5A,
arrows, (t)]. Staining at the end of 2L was weaker and
observed less consistently than at other chromosomes. HP1 has also been
frequently observed at the telomeres of polytene chromosomes, most
consistently at the ends of the X, 3R, and 2R chromosomes (James
et al., 1989
; Fanti et al., 1998
). More diffuse
HOAP immunostaining was also observed throughout a region of
pericentric heterochromatin that stains intensely with the
-HP1
antibody (Figure 5, B [HP1] and C [HP1 and HOAP merged]) on the
left and right arms of the third chromosome. The HOAP immunostaining in
the pericentric heterochromatin of the third chromosome was flanked by
prominent bands of staining at 80F at the bases of 3R and 3L (Figure
5D, bracket 80F). It is of interest that prominent DmORC 2 immunostaining at the chromocenter of polytene chromosomes is also
restricted to the fourth chromosome and the base of 3R (Pak et
al., 1997
). Diffuse staining was also consistently found
throughout the pericentric heterochromatin at the base of the fourth
chromosome (Figure 5D, arrowhead 4). The localization pattern for HOAP
resembles that reported for the TAS element, which is found
predominantly at the telomeres of 2R and 3R, but weaker staining is
also observed throughout the chromocenter of polytene chromosomes
(Karpen and Spradling, 1992
).
|
The HOAP Localization Pattern Is Conserved in Drosophila Species Containing Similar Satellite Sequence Compositions
The punctate pattern of localization for HOAP in the intensely
DAPI-stained regions of the nucleus suggests that it may be associated
with 1 or more repetitive DNA sequences enriched in these regions. One
approach used to investigate which satellite sequence might serve as
the binding site for a heterochromatin protein has been to compare its
distribution in Drosophila species containing similar
satellite compositions with that in species containing dissimilar
compositions (Raff et al., 1994
; Platero et al.,
1998
). The anon fe 1G5 gene was identified in a molecular evolutionary study aimed at identifying fast evolving genes that are
conserved in species that are closely related to D. melanogaster (D. simulans, Drosophila
mauritiana, and D. yakuba) but are absent from the more
distantly related D. virilis. Interestingly, the closely
related species containing an anon fe 1G5 gene homologue are
also known to have similar satellite sequence compositions (Lohe and
Roberts, 1988
), whereas the more distantly related D. virilis lacks an anon fe 1G5 gene homologue and has a
very different satellite sequence composition from that of D. melanogaster and its close relatives (Gall and Atherton, 1974
).
It has been suggested that the conservation of heterochromatin-binding
proteins is driven by the sequence bias of heterochromatin DNA repeats
in that species (Csink and Henikoff, 1998
). According to this view, the
spots of HOAP staining observed in D. melanogaster might
also be expected in its closely related species. A similar punctate
pattern of staining in these species would also support binding of HOAP
to satellite sequences that are shared between the species. To each of
these ends, HOAP immunostaining experiments were carried out on larval
brain squashes from 2 closely related species (D. simulans
and D. mauritiana) and from D. virilis (Figure 6). Spots of HOAP immunostaining were
observed in the region of intensely DAPI-stained satellite sequences in
interphase nuclei from each closely related species (Figure 6, A-C,
HOAP) but not in the nuclei from D. virilis (Figure 6D,
HOAP). Coimmunostaining of these nuclei with HP1 antibodies showed the
spots of HOAP immunostaining to be located within or closely juxtaposed
to the larger domain of HP1 immunostaining (Figure 6, A-C).
|
HOAP Protein Binds Specific D. melanogaster Satellite- and Telomere-associated Sequences In Vitro
The similarity of the anon fe 1G5 protein-coding
sequence to that of HMG proteins suggests that it possesses DNA-binding
activity. The immunostaining experiments described above indicate a
binding specificity for 1 or more repetitive DNA found in
heterochromatin. Gel mobility shift assays were used to determine
whether HOAP is capable of binding to each of 10 different satellite
DNA sequences enriched in D. melanogaster heterochromatin
(Brutlag, 1980
) and to the TAS (Karpen and Spradling, 1992
; Walter
et al., 1995
).
A bacterially expressed hexahistidine-tagged recombinant form of the
HOAP protein was used in the gel mobility shift assays. The recombinant
protein was affinity purified over a Ni-NT agarose column with the use
of an elution profile that yielded >90% full-length recombinant HOAP
protein (Figure 7A). The DNA probes for
the experiments were prepared by annealing single-stranded
oligonucleotides of each D. melanogaster satellite sequence.
The 5-bp satellite sequences (AATAT, AATAG, AATAC, AAGAC, AAGAG, and
AACAA) were repeated in tandem 4 times, whereas the 7- and 10-bp
satellite sequences (AATAAAC, AATAGAC, AAGAGAG, and AATAACATAG) were
repeated in tandem 3 times. The double-stranded oligonucleotides and
the 457-bp TAS isolated from the telomere of 2L (Walter et
al., 1995
) were then labeled to equivalent specific activities
with the use of Klenow I to fill in a single-stranded overhang.
|
In the gel mobility shift assays that were then used to monitor binding
of the recombinant HOAP protein to each labeled satellite sequence and
to a nonspecific DNA fragment, the HOAP protein displayed the strongest
binding affinity for 3 specific satellite sequences (AATAT, AATAG, and
AATAACATAG; Figure 7B), although minimal binding to the other sequences
could also be observed with prolonged autoradiographic exposures (our
unpublished results). The recombinant HOAP protein was also able to
bind the 457-bp TAS isolated from the telomere of 2L (Walter et
al., 1995
) in a gel mobility shift assay (Figure 7C). To determine
which of the satellite sequences HOAP binds with the greatest affinity,
competitive binding assays were performed with the 3 strongest binding
satellite sequences and the TAS element (Figure 7C). Each sequence was
used as a competitor to binding of HOAP to itself and to each of the
other binding sequences. In these experiments, the binding of HOAP to
each sequence was most effectively competed by a cold excess of that
same sequence (e.g., cold AATAT with labeled AATAT [AATAT; Figure 7C,
lanes 3-6], cold AATAG with labeled AATAG [AATAG; lanes 7-10],
cold AATAACATAG with labeled AATAACATAG [AATAACATAG; lanes 11-14], and cold TAS with labeled TAS [TAS, lanes 15-18]). The binding of
HOAP to the AATAT probe could also be effectively competed by an excess
of cold AATAG (AATAT; Figure 7C, lanes 7-10), because binding to the
AATAG probe could be competed with an excess of cold AATAT (AATAG;
Figure 7C, lanes, 3-6). A cold excess of the 10-bp repeat sequence
(AATAACATAG) was able to compete with HOAP binding to itself and to the
two 5-bp sequences almost as effectively as each 5-bp sequence to
itself (Figure 7C, lanes 11-14). In contrast, the two 5-bp sequences
were only able to compete for binding of HOAP to AATAACATAG at the
highest molar excess of cold competitor used (AATAACATAG; Figure 7C,
lanes 3-6 and 7-10). HOAP binding to the TAS element could
be competed by itself but not by any of the 3 satellite sequences (even
at a 400-fold molar excess). However, HOAP binding to each of the 3 satellite sequences could be competed by a 300-fold molar excess of the
TAS element, possibly indicating a preference for HOAP binding to the
TAS element. An unrelated nonspecific DNA sequence was found to be an
ineffective competitor for HOAP binding to the 3 satellite sequences or
the TAS element even at a 400-fold molar excess (Figure 7C, lanes 15-19).
The punctate heterochromatic localization of HOAP is conserved in
closely related Drosophila species with similar satellite sequence compositions
[(RRN)m(RN)n rule]. The
more distantly related D. virilis lacks an anon fe
1G5 gene and also contains satellite sequences that follow a
different rule
[(AAN)m(NA)n; Gall and Atherton, 1974
; Lohe and Roberts, 1988
]. It has been suggested that
the conservation of heterochromatin-binding proteins might be driven by
the sequence bias of satellite sequence repeats present in a given
species (Csink and Henikoff, 1998
). To test this idea with regard to
conservation of the anon fe 1G5 gene, each of the 3 different D. virilis satellite sequences (ACAAACT, ATAAACT, and ACAAATT) was tested as a binding site for the HOAP protein. HOAP
displayed minimal binding to each of the D. virilis
sequences in comparison with binding to the D. melanogaster
AATAACATAG satellite repeat labeled to equivalent specific activity
(Figure 7D).
The anon fe 1G5 Gene Displays a Reciprocal Modifier of Variegation Phenotypes
The immunoprecipitation and immunostaining experiments described
above demonstrate an association between HOAP and the salt-resistant fractions of HP1 and ORC in interphase nuclei. Mutants for the DmORC 2 subunit display a Suppressor of
variegation [Su(var)] phenotype (Pak et
al., 1997
) and also exhibit defects in HP1 localization into
heterochromatin (Huang et al., 1998
). To determine whether HOAP also functions in heterochromatin assembly, we undertook genetic
analyses of a Drosophila mutant that is deficient for the
chromosomal region containing the anon fe 1G5 gene encoding HOAP.
The cytological position of the anon fe 1G5 gene was
determined by DNA in situ hybridizations to polytene chromosomes from larval salivary glands (our unpublished results). The cytological location determined by these experiments (95D-E) was later confirmed by a DNA sequence from the BDGP (unpublished results, accession number
AC008203) and by in situ hybridizations in the independent study of
Schmid et al. (1999)
. A mutant stock in which the
chromosomal interval from 95D7-11-95F15 (Df(3R)crb-F89-4)
has been removed was obtained through the Bloomington Stock Center.
This stock was used to determine the effect of removing 1 copy of the
anon fe 1G5 gene on the position effect-variegated
phenotype of the whitem4 allele, in which
the white gene has undergone a chromosomal rearrangement juxtaposing it to centric heterochromatin. The variegated phenotype associated with the whitem4 rearrangement
(Figure 8A) was found to be suppressed by
the Df(3R)crb-F89-4 chromosome (Figure 8B).
|
The chromosomal interval removed in the Df (3R)crb-F89-4
stock is rather large; information from BDGP GadFly indicates that ~60 genes in addition to anon fe 1G5 are removed. We
therefore wished to determine whether the reduced dose of the
anon fe 1G5 gene in the Df(3R)crb-F89-4 stock was
at least partially responsible for this Su(var) phenotype.
To this end, we determined whether expression of the anon fe
1G5 gene from a transgene in the Df(3R)crb-F89-4 stock
could suppress the Su(var) phenotype of the deficiency
stock. The ability of the anon fe 1G5 transgene to suppress
the Su(var) phenotype would be supportive of the idea that
loss of the anon fe 1G5 gene in this deficiency is at least
partly responsible for the Su(var) phenotype. Because the
white gene served as the reporter for identifying anon
fe 1G5 transgenic animals for the transformation vector we were
using, it was necessary to use a different assay that is
unrelated to eye pigmentation to monitor rescue of the
Su(var) phenotype by the anon fe 1G5 transgene. We chose to use the In(3L)BL1 stock of Lu et al.
(1996)
, which carries a variegating hsp70-LacZ transgene
juxtaposed to pericentric heterochromatin by a chromosomal
rearrangement. Embryos were collected from the In(3L)BL1
stock carrying 2 wild-type copies of the anon fe 1G5 gene
and compared with those collected simultaneously from the same stock
carrying either the Df(3R)crb-F89-4 deficiency chromosome or
2 additional copies of the anon fe 1G5 gene as a transgene.
Each parental genotype was simultaneously subjected to heat shock to
induce expression of the hs-anon fe 1G5 transgene in the
transgenic stock. This treatment also induces the hs-lacZ reporter in each parental genotype, having the effect of neutralizing rather than enhancing anon fe 1G5 transgene rescue. Embryos
collected from each genotype were then heat shocked to induce
expression of the In(3L)BL1hs-lacZ reporter (as well as the
hs-anon fe 1G5 transgene) before they were fixed and stained
for
-galactosidase activity from expression of the
hs-lacZ reporter (Figure 8, C-E). Embryos from animals
carrying 2 copies of the endogenous anon fe 1G5 gene
displayed moderate levels of variegated staining (Figure 8C). In
contrast, embryos from animals carrying the Df(3R)crb-F89-4 chromosome contained high levels of
-galactosidase staining
throughout the embryo (Figure 8D). The reciprocal phenotype was
observed in embryos collected from animals with either 1 or 2 copies of the anon fe 1G5 transgene. The majority of embryos collected
from these animals lacked
-galactosidase staining altogether or
contained reduced levels of variegated staining (Figure 8E).
Quantitative measurements of
-galactosidase activities in adults of
each genotype were also obtained with the use of chlorophenol red-
-D-galactopyranoside as substrate (Simon and Lis,
1987
). The level of
-galactosidase activity in extracts from animals carrying the Df(3R)crb-F89-4 deficiency chromosome (Table
1, Df(3R)F89-4) was
approximately twofold higher than that measured in extracts from
wild-type animals (Table 1, wild-type). The Su(var)
phenotype associated with the Df(3R)crb-F89-4 was partially reversed by expression of the anon fe 1G5 transgene from a
heat shock-inducible promoter (Table 1, Df(3R)F89-4;
P{hsHOAP}). The level of
-galactosidase
activity in extracts from animals carrying 2 copies of the anon
fe 1G5 transgene in addition to the 2 endogenous copies of the
gene (Table 1,
P{hsHOAP}/P{hsHOAP})
was almost twofold lower than that measured in extracts from wild-type
animals. A more moderate reduction in activity was measured in animals carrying a single extra copy of the gene as a transgene (Table 1,
P{hsHOAP}/CyO).
|
| |
DISCUSSION |
|---|
|
|
|---|
Interphase nuclei contain multiple fractions of HP1, containing
different levels of phosphorylation and having different strengths of
chromatin association. The most tightly bound chromatin fraction is
underphosphorylated and specifically associated with
Drosophila ORC subunits (Huang et al., 1998
). A
specific fraction of the protein in the maternally loaded cytoplasm of
the early embryo is also underphosphorylated and specifically
associated with a multiprotein complex containing DmORC
subunits. This cytoplasmic fraction is thought to be poised for
assembly into the tightly bound chromatin fraction during
heterochromatin assembly later in embryonic development. Mutants for
the ORC2 subunit display a perturbation in HP1 localization into
Drosophila heterochromatin. This observation has led to the
postulation that ORC plays a role in the recruitment of HP1 into
Drosophila heterochromatin that may be analogous to its role
in recruiting the SIR1 protein to silencing nucleation sites in
S. cerevisiae (Huang et al., 1998
). Here we
report the identification of an unknown protein component (p55) of the
HP1/ORC complex of the maternally loaded cytoplasm. The peptide
sequence from this protein matches the sequence from the hypothetical
protein product of the Drosophila anon fe 1G5 gene (Schmid
and Tautz, 1997
). Antibodies increased against a recombinant protein
produced from this gene were used in reciprocal immunoprecipitation
experiments to show that the HOAP p55 protein is the product of this gene.
HOAP Contains a Region of Similarity to HMG Proteins
The amino terminus of the anon fe 1G5 gene-coding
sequence contains similarity to the HMG domain of the SRY protein and
the group of DNA sequence-specific HMG proteins to which it belongs. This similarity to HMG proteins is of interest in view of reports of
interactions of a human homologue of HP1 with the SP100-HMG protein
(Lehming et al. 1998
; Seeler et al., 1998
). This
HMG protein displays a punctate localization similar to that of HOAP in
normal cells that becomes disrupted in some cancer cells (Szostecki
et al., 1990
; Ascoli and Maul, 1991
). The HMG sequence motif
in the HOAP protein suggested that it may possess DNA-binding activity. We have, indeed, demonstrated sequence-specific binding of HOAP to 3 D. melanogaster satellite DNA sequences (AATAT, AATAG, and AATAACATAG) and to the TAS.
The protein was also found to have a punctate pattern of distribution
in the region where pericentric satellite sequences are clustered in
interphase nuclei. The spots of HOAP staining lie within the domain of
HP1 enrichment and are closely apposed to sites of enriched ORC 2 immunostaining in this domain. This enrichment of HOAP in pericentric
heterochromatin was also observed in mitotic chromosomes of diploid
cells. The distribution of HOAP in polytene chromosomes was also
heterochromatic; it was predominantly found at telomeres, but weaker
staining was also observed throughout regions of pericentric
heterochromatin. These results indicate an association of HOAP with 1 or more repeated sequences in telomeric and pericentric
heterochromatin. The TAS is 1 repetitive sequence that is found in both
regions (Karpen and Spradling, 1992
). HOAP was able to bind this
sequence in vitro; however, further studies will be required to
determine the actual in vivo binding site for the HOAP protein.
The pattern of distribution for HOAP in diploid and polytene tissues
and its dynamics during the cell cycle differ from those of any
previously characterized heterochromatin-associated protein in
Drosophila. HP1 displays prominent enrichment throughout
pericentric heterochromatin and at each telomere of salivary gland
polytene chromosomes (James et al., 1989
; Fanti et
al., 1998
). The association of HP1 with pericentric
heterochromatin, however, appears to be less stable during mitosis
(Kellum et al., 1995
; Platero et al., 1998
). Two
other heterochromatin-associated proteins (GAGA factor and Prod) have
prominent binding sites in both heterochromatin and euchromatin.
Binding to heterochromatic satellite repeat sequences (AAGAG and
AATAACATAG, respectively) is observed in mitotic chromosome spreads,
but both proteins become redistributed to sites of euchromatic gene
regulation during interphase (Raff et al., 1994
; Torok
et al., 1997
; Platero et al., 1998
). This
redistribution and differences in the representation of satellite
sequences in polytene and diploid tissues (Miklos and Cotsell, 1990
)
contribute to a euchromatic pattern of distribution for both proteins
in interphase polytene chromosomes. HOAP, by contrast, is found
predominantly at heterochromatic regions of both diploid and polytene
nuclei and appears to retain its association with pericentric
heterochromatin throughout the diploid cell cycle. Its localization
predominantly at telomeres of polytene chromosomes but in pericentric
regions of diploid chromosomes probably reflects differences in the
representation of particular heterochromatic sequences in the 2 cell
types. These distinct characteristics of HOAP distribution in
heterochromatin are likely to reflect a unique role for it in these regions.
A Role for HOAP in Heterochromatin Assembly
Genetic screens in Drosophila have been used to
identify chromosomal regions that modify the position
effect-variegated phenotype of the
whitemot4 allele when either duplicated or
deleted (Locke et al., 1988
; Wustmann et al.,
1989
). The proteins encoded by these genes are thought to play a role
in heterochromatin assembly. We have used a deficiency for the
chromosomal region containing the anon fe 1G5 gene
[Df(3R)F89-4] to determine whether the HOAP protein has a
role in heterochromatin assembly. This deficiency caused a suppression of the position effect-variegated phenotype of the
whitem4 allele as well as the
hs-lacZ reporter of the In(3L)BL1 chromosomal rearrangement (Lu et al., 1996
). Suppression of the
Su(var) phenotype with an anon fe 1G5 transgene
suggests that loss of the anon fe 1G5 gene is at least
partially responsible for the Su(var) phenotype associated
with this deficiency.
The chromatin immunoprecipitation experiments with HP1 and HOAP antibodies showed HOAP to be located in close proximity to HP1 and ORC proteins in the salt-resistant fraction of interphase chromatin. We speculate that this fraction of chromatin contains binding sequences for ORC and HOAP from which heterochromatin assembly may be nucleated by a process resembling the recruitment of the Sir complex to silencing nucleation sites in S. cerevisiae. The demonstration that HOAP binds specific satellite sequences suggests that it may play a role in Drosophila heterochromatin that is analogous to the roles of the DNA-binding Rap1 and Abf1 proteins in budding yeast silencing. Indeed, the limited degree of overlap between the HP1-containing chromatin fractions and those containing ORC or HOAP in the chromatin immunoprecipitation experiments may be indicative of a heterochromatin assembly nucleation activity for HOAP rather than as a bona fide structural component of heterochromatin.
A repeated DNA sequence of any type has been shown, in some cases, to
induce heterochromatin formation in euchromatic regions of
Drosophila chromosomes (Dorer and Henikoff, 1994
). It has
been proposed that heterochromatin assembly is induced in these
situations as a result of heterochromatin proteins recognizing unusual
folded structures at sites of paired repeats. HMG proteins constitute 1 class of protein that is likely to play a role in such a mechanism; the
sequence recognition motif of even the sequence-nonspecific class of
HMG proteins involves recognition of an altered DNA secondary structure
(Lilley, 1988
; Pohler et al., 1998
). However, HOAP was found to display preferred binding to specific satellite repeats as well as to the mini-satellite TAS. Interestingly, TASs have
been found flanking a number of variegating transgenes inserted into
both telomeres (of X, 2R, and 3R) and pericentric heterochromatin (of
2R and 2L; Karpen and Spradling, 1992
; Zhang and Spradling, 1995
;
Cryderman et al., 1998
). They have also been implicated in
the mediation of the P cytotype by a single strongly repressed autonomous P element [Lk-P(1A)] inserted next to a block
of TAS repeats in the telomere of the X chromosome (Ronsseray et
al., 1996
; Roche and Rio, 1998
). The variegated expression of
telomeric transgenes flanked by TAS elements has been found to be
unaffected by a reduced dose of the HP1 gene [Su(var)2-5]
(Cryderman et al., 1998
), although the ability of
Lk-P(1A) to repress P dysgenesis is strongly reduced
(Ronsseray et al., 1996
, 1998
).
HOAP Is Encoded by a Fast-evolving Gene
The anon fe 1G5 gene was identified in a screen for
fast-evolving Drosophila genes on the basis of their
conservation in species closely related to D. melanogaster
(D. simulans, D. yakuba, and D. mauritiana) but not in the more distantly related D. virilis (Schmid and Tautz, 1997
). It is of interest that an
anon fe 1G5 gene homologue is present in each of the closely
related species that contain satellite sequences constituting in vitro
HOAP binding sites but not in the distantly related D. virilis containing different satellite sequences that do not serve
as in vitro binding sites for the HOAP protein (Gall and Atherton,
1974
; Brutlag, 1980
; Schmid et al., 1999
). One of these
satellite sequences (AATAT) is even known to have a conserved
chromosomal location in each of the species containing an anon fe
1G5 gene (Lohe and Roberts, 1988
). HOAP immunostaining in
interphase and mitotic diploid cells of D. melanogaster is
consistent with an association of HOAP with 1 or more of these
sequences in vivo. Moreover, the punctate pattern of HOAP distribution
in the heterochromatic regions is conserved in the closely related
species. The localization pattern of HOAP on polytene chromosome also
suggests a relationship to the TAS first described by Karpen and
Spradling (1992)
. It is not currently known whether TASs are
present in other Drosophila species, but a different
subtelomeric satellite has been found in D. virilis that is
not yet known to exist in D. melanogaster (Biessmann
et al., 2000
).
The conservation of an anon fe 1G5 gene only in
species containing HOAP-binding sequences is consistent with the ideas
put forth by Csink and Henikoff (1998)
of a relationship between
conservation of heterochromatin-binding proteins and the sequence bias
of repetitive heterochromatin sequences in a given species. Csink and
Henikoff (1998)
also speculated that the enrichment of satellite
sequences at centromeres might play a passive role in centromere
formation by providing a mechanism for excluding efficient origins of
replication, and, thereby, might determine these regions as centromeres
as a consequence of their late replication. ORC 2 immunostaining experiments indicate that ORC is enriched rather than excluded from
pericentric heterochromatin in Drosophila (Pak et
al., 1997
). Moreover, ORC binding does not appear to play the
critical role in determining the firing time of an origin; rather,
other factors such as chromatin organization and Cdc45p binding are
thought to be important factors (Wintersberger, 2000
). ORC proteins may function in concert with HP1 and DNA-binding proteins such as HOAP to
establish a heterochromatin structure in pericentric regions that then
determines the late-replicating properties of those regions. According
to this model, the repetitive sequences in heterochromatin play an
active rather than a passive role in centromere formation. Although a
conserved feature of pericentric heterochromatin is its repetitive
sequence composition, there is little conservation at the level of the
primary DNA sequence. The collection of DNA-binding proteins
participating in heterochromatin formation in a given species is,
therefore, likely to be dete