![]() |
|
|
Vol. 12, Issue 8, 2257-2274, August 2001
and
*Renal-Electrolyte Division of the Department of Medicine,
Laboratory of Epithelial Biology, and Department of Cell Biology and
Physiology, University of Pittsburgh, Pittsburgh, Pennsylvania 15261;
and
Department of Internal Medicine, National Taiwan
University Hospital, Taipei, 100 Taiwan
| |
ABSTRACT |
|---|
|
|
|---|
Polarized epithelial cells maintain the asymmetric composition of their apical and basolateral membrane domains by at least two different processes. These include the regulated trafficking of macromolecules from the biosynthetic and endocytic pathway to the appropriate membrane domain and the ability of the tight junction to prevent free mixing of membrane domain-specific proteins and lipids. Cdc42, a Rho family GTPase, is known to govern cellular polarity and membrane traffic in several cell types. We examined whether this protein regulated tight junction function in Madin-Darby canine kidney cells and pathways that direct proteins to the apical and basolateral surface of these cells. We used Madin-Darby canine kidney cells that expressed dominant-active or dominant-negative mutants of Cdc42 under the control of a tetracycline-repressible system. Here we report that expression of dominant-active Cdc42V12 or dominant-negative Cdc42N17 altered tight junction function. Expression of Cdc42V12 slowed endocytic and biosynthetic traffic, and expression of Cdc42N17 slowed apical endocytosis and basolateral to apical transcytosis but stimulated biosynthetic traffic. These results indicate that Cdc42 may modulate multiple cellular pathways required for the maintenance of epithelial cell polarity.
| |
INTRODUCTION |
|---|
|
|
|---|
The normal function of epithelial cells depends on the
asymmetrical organization of cellular components such as the plasma membrane, organelles, and the cytoskeleton. The achievement of this
cellular polarity is initiated by temporal and spatial cues that induce
the formation of specialized cell adhesion complexes (reviewed by
Yeaman et al., 1999
). Cell adhesion complexes are stabilized, in turn, by assembly of cytoskeletal and signaling proteins
at sites of contact, and this subsequently leads to the repositioning
of the secretory apparatus. Associated with these global morphological
changes is the division of the plasma membrane into two distinct
domains termed the apical and basolateral plasma membranes. These are
separated by tight junctions that impede the lateral diffusion of
lipids and proteins between opposite domains. This membrane asymmetry
is reinforced and maintained by sorting and transport of proteins from
the trans-Golgi network (TGN) to the appropriate membrane
domain. Epithelial cells can maintain polarity at the membrane by
additional mechanisms (reviewed by Yeaman et al., 1999
). One
of these entails the internalization of plasma membrane proteins and
lipids via endocytosis, followed by the subsequent recycling,
degradation in lysosomes, or delivery to the opposite surface domain by
transcytosis. An alternative mechanism involves tethering proteins at
the plasma membrane. In each of these mechanisms, the cytoskeleton has
been shown to play an important role (reviewed by Yeaman et
al., 1999
).
The Rho family of GTPases modulates multiple membrane traffic events as
well as the cytoskeleton and may play important roles in the
establishment/maintenance of epithelial cell polarity (Van Aelst and
D'Souza-Schorey, 1997
; reviewed by Hall, 1998
). Members of this family
include Cdc42 (Cdc42Hs and G25K splice variants), TC-10, Rac subfamily
(1, 2, and 3 isoforms), Rho subfamily (A, B, and C isoforms), Rnd
subfamily (Rnd 1, 2, and 3 isoforms), RhoD, RhoE, and RhoG. In yeast,
Cdc42 plays an important role in the regulation of actin organization
and the polarized formation of growing buds (Adams et al.,
1990
). In mammalian cells Cdc42 has been implicated in the regulation
of a variety of functions. These include actin rearrangement,
receptor-mediated signal transduction pathways, cell cycle progression
and apoptosis (reviewed by Johnson, 1999
), and multiple membrane
trafficking events including phagocytosis, exocytosis, and endocytosis
(Cox et al., 1997
; Brown et al., 1998
; Li
et al., 1998
; Massol et al., 1998
; Gasman
et al., 1999
; Kroschewski et al., 1999
;
Garrett et al., 2000
; Hong-Geller and Cerione, 2000
; Lee
et al., 2000
; Wu et al., 2000
). Furthermore,
there is growing evidence that Cdc42 may govern pathways required for
establishment and maintenance of cellular polarity (Adams et
al., 1990
; Stowers et al., 1995
; Kroschewski et
al., 1999
).
A connection between Cdc42 signaling and the establishment/maintenance
of epithelial polarity and regulation of membrane trafficking pathways
in epithelial cells is only now being explored. Cell-cell contact is
the first step in the establishment of epithelial polarity and may be
regulated by Cdc42 (Kuroda et al., 1997
). In Madin-Darby canine kidney (MDCK) cells expression of dominant-active mutants of
Cdc42 alters tight junction morphology (Kroschewski et al., 1999
; Joberty et al., 2000
), but the effects of these
mutants on tight junction function is unknown. In MDCK cells mutated
forms of Cdc42 cause missorting of a basolateral resident membrane
protein gp58 (Kroschewski et al., 1999
) to the apical cell
surface. In contrast, the distribution of gp114, an apical membrane
protein, is not affected by the expression of a dominant-negative
mutant of Cdc42 but becomes nonpolarized in cells expressing a
dominant-active mutant of this GTPase. It has been suggested that Cdc42
may control secretory transport to the basolateral membrane of MDCK
cells, perhaps by regulating traffic from the Golgi apparatus
(Kroschewski et al., 1999
). It remains to be determined
whether Cdc42 plays a role in regulating other membrane trafficking
events in epithelial cells.
We have investigated whether Cdc42 modulates the gate and fence function of tight junctions in MDCK cells, as well as endocytic and biosynthetic pathways that direct proteins to the apical and basolateral plasma membrane domains of this cell line. We used MDCK cells that express constitutively active or dominant-negative mutants of Cdc42 under the control of the tetracycline-repressible system. There are two distinct advantages of this system. First, the expression of the exogenous protein can be regulated by varying the level of tetracycline. Second, the generation of stable cell lines with uniform expression makes quantitative biochemical experiments possible. Here we report that expression of dominant-active Cdc42V12 or dominant-negative Cdc42N17 perturbed tight junction function. In addition, Cdc42V12 expression slowed endocytic and biosynthetic traffic. The dominant-negative mutant of Cdc42 (Cdc42N17) slowed apical endocytosis and basolateral to apical transcytosis but stimulated biosynthetic traffic. Our results indicate that Cdc42 may govern multiple pathways that are important in the establishment and maintenance of cell polarity.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of Cell Lines Expressing Wild-type and Mutant Cdc42
The myc epitope-tagged Cdc42V12 and Cdc42N17 sequences were
amplified by polymerase chain reaction from the template plasmids pCMVneo-myc-Cdc42V12 and pCMVneo-myc-Cdc42N17 (courtesy of Dr. Matt
Hart and Dr. Arie Abo at Onyx Pharmaceuticals, Richmond, CA)
with the use of the forward primer
CCGAATTCACCATGGAGCAGAAGCTGATC, which matches the codon
sequence of the first six amino acids sequence of myc epitope with an
upstream EcoRI site (which is underlined), and the reverse
primer CGTCTAGAGGGTACCATGCATGATATCGC, which matches the 3'
multiple cloning sites sequence of pCMVneo-myc with a downstream
XbaI site (which is underlined). The amplified fragments
were then digested with EcoRI and XbaI and gel
purified before being inserted into the EcoRI and
XbaI sites of pUHD10-3 (courtesy of Dr. Manfred Gossen and
Dr. Hermann Bujard at University of Heidelberg, Heidelberg, Germany) to
generate pUMCdc42V12 and pUMCdc42N17. Stable MDCK cells expressing
Cdc42 mutant GTPases were generated with the use of a
tetracycline-repressible system as described previously (Jou and
Nelson, 1998
). In brief, parental T23 MDCK cells, which express a
tetracycline-regulated transactivator, were cotransfected with
pUMCdc42V12 or pUMCdc42N17 and pHMR272, which carries a hygromycin B
selection marker. The transfected cells were selected in the presence
of 200 µg/ml hygromycin B and 20 ng/ml doxycycline (DC) for 10 d
before surviving clones were picked. Screening was performed on cells
that were grown in the absence of DC, and expression of Cdc42 mutant
proteins was assessed by immunoblotting or
immunofluorescence with the use of a monoclonal antibody specific for
the myc epitope tag (9E10). The data presented are from an individual,
representative clone that uniformly expressed high levels of either
myc-Cdc42V12 or myc-Cdc42N19 when cells were cultured in the absence of
DC.
Cell Culture
The cell lines were routinely cultured in DMEM medium (Life
Technologies-BRL, Gaithersburg, MD) containing 10% (vol/vol) fetal bovine serum (FBS; Hyclone, Logan, UT), penicillin/streptomycin, and 20 ng/ml DC at 37°C in a humidified atmosphere containing 5%
CO2. Expression of Cdc42V12 or Cdc42N17 was
performed as described previously (Leung et al., 1999
).
Briefly, mutant Cdc42 protein expression was induced by plating cells
in 15-cm dishes at low density into DMEM/FBS medium lacking DC and
incubating them for 36-48 h at 37°C. At the end of this incubation
period the cells had reached ~30% confluency. Cells treated in an
identical manner, but incubated in the presence of 20 ng/ml DC, served
as controls. The cells were trypsinized and washed with culture medium
containing 5 µM calcium chloride (low calcium medium [LCM]), and
1 × 106 cells (resuspended in 0.5 ml of
LCM) were added to the apical chamber of rat-tail collagen-coated 12-mm
diameter Transwells (Corning-Costar, Cambridge, MA) in LCM containing
either 20 ng/ml DC (control) or no DC. Cells were incubated in LCM for
3-4 h (±DC), rinsed twice with phosphate-buffered saline, and then
incubated in DMEM/FBS containing either 20 ng/ml DC (control) or no DC
and normal amounts of calcium chloride (1.8 mM) for 18-48 h.
Antibodies, Proteins, and Other Markers
The following reagents were used: mouse anti-myc hybridoma 9E10
ascites (Dr. S.W. Whiteheart, University of Kentucky, Lexington, KY),
rat anti-ZO-1 hybridoma R40.76 culture supernatant (Dr. D.A. Goodenough, Harvard University, Cambridge, MA), purified rabbit anti-Cdc42 polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz,
CA), affinity-purified rabbit polyclonal anti-human immunoglobulin (Ig)
A antibody (Jackson Immunoresearch Laboratories, West Grove, PA),
affinity-purified rabbit polyclonal anti-giantin antibody (Dr. A. Lindstedt, Carnegie Mellon University, Pittsburgh, PA; Lindstedt and
Hauri, 1993
), affinity-purified rabbit anti-canine Tf antibodies
(Apodaca et al., 1994
), mouse anti-LAMP2 hybridoma AC17 (Dr.
E. Rodriquez-Boulain, Cornell University, New York, NY; Nabi et
al., 1991
), rabbit polyclonal anti-occludin antibody (Zymed
Laboratories, South San Francisco, CA), rabbit polyclonal anti-mouse
furin antibody (Alexis Biochemicals, San Diego, CA), affinity-purified
and minimal cross-reacting fluorescein and Cy5-conjugated secondary
antibodies (Jackson Immunoresearch Laboratories), and human polymeric
IgA (purchased from Dr. J.-P. Vaerman, Catholic University of Louvain,
Louvain, Belgium).
Western Blot Analysis
Western blot analysis was performed as described previously
(Maples et al., 1997
). Samples were quantified by densitometry.
Immunofluorescence Labeling and Scanning-Laser Confocal Microscopy
Cells were fixed and processed with the use of a pH shift
protocol (Apodaca et al., 1994
). Imaging was performed on a
TCS confocal microscope equipped with krypton, argon, and helium-neon lasers (Leica, Dearfield, IL). Images were acquired with the use of a
100× plan-apochromat objective (NA 1.4) and the appropriate filter
combination. Settings were as follows: photomultipliers set to 600-800
mV, 1.0-µm pinhole, zoom = 2.0-3.0, Kalman filter (n = 4).
The images (1024 × 1024 pixels) were saved in a
tag-information-file-format (TIFF), and the contrast levels of the
images were adjusted in the Photoshop program (Adobe, Mountain View,
CA) on a Power PC G-4 Macintosh (Apple, Cupertino, CA). The
contrast-corrected images were imported into Freehand (Macromedia, San
Francisco, CA) and printed from a Kodak (Rochester, NY) 8650PS dye
sublimation printer.
Measurement of Trans-Epithelial Resistance (TER), Paracellular Diffusion of [14C]Inulin, 125I-IgA, and 125I-Transferrin (Tf)
TER was quantified and [14C]inulin flux
was measured as described previously (Apodaca et al., 1995
;
Jou and Nelson, 1998
). The flux of 125I-IgA or
125I-Tf was quantified as follows. Filter-grown
cells were washed three times with minimal essential medium
(MEM)/bovine serum albumin (BSA; MEM containing 0.6% [wt/vol] BSA,
0.35 g/l NaHCO3, 20 mM HEPES, pH 7.4, penicillin/streptomycin), and 125I-IgA or
125I-Tf, diluted in 0.5 ml of MEM/BSA containing
a 100-fold excess of unlabeled IgA or Tf, was added to the apical
chamber of the Transwell. Cold-competing ligand was added to prevent
receptor-mediated internalization and apical to basolateral
transcytosis. MEM/BSA (0.5 ml) was placed in the basolateral chamber.
At the designated times, the basolateral MEM/BSA medium (0.5 ml) was
collected and replaced with fresh MEM/BSA. After the final time point,
filters were washed twice with ice-cold phosphate-buffered saline and cut out of the insert, and the amount of 125I-IgA
or 125I-Tf that remained in the apical medium,
that had diffused into the basolateral chamber, or that remained cell
associated was quantified in a gamma counter. The results are expressed
as the percentages of 125I-IgA or
125I-Tf initially added to the apical chamber
that was released basolaterally.
Electron Microscopic Analysis of Cells Expressing Cdc42 Mutants
The cells were incubated for 60 min at room temperature in fixative containing 2% (vol/vol) gluteraldehyde, 2% (wt/vol) paraformaldehyde, 1 mM CaCl2, and 0.5 mM MgCl2, in 100 mM sodium cacodylate buffer, pH 7.4. Cells were rinsed three times with 100 mM sodium cacodylate buffer, pH 7.4, and then treated with 1% (wt/vol) OsO4, 1% (wt/vol) K4Fe(CN)6, and 1 mM MgCl2 in 100 mM sodium cacodylate, pH 7.4, for 90 min at 4°C. After several rinses with H2O the samples were incubated in 1% (wt/vol) aqueous tannic acid for 5 min, rinsed with H2O, and then en bloc stained overnight with 0.5% (wt/vol) uranyl acetate in H2O. Filters were dehydrated in a graded series of ethanol, embedded in the epoxy resin LX-112 (Ladd, Burlington, VT), and sectioned with a diamond knife (Diatome, Fort Washington, PA). Sections, silver in color, were stained with 2% (wt/vol) aqueous uranyl actetate and 0.8% (wt/vol) lead citrate and then mounted on butvar-coated nickel grids and viewed at 80 kV in a JEOL (Tokyo, Japan) 100 CX electron microscope.
Labeling of the Plasma Membrane with Fluorescent Lipid or IgA
BODIPY-FL-C5 sphingomyelin (Molecular
Probes, Eugene, OR) and defatted BSA (fatty acid ultra-free; Boehringer
Mannheim, Indianapolis, IN) were used to prepare 5 µM
sphingomyelin/0.5 µM BSA complexes in P buffer (10 mM HEPES, pH 7.4, 1 mM sodium pyruvate, 10 mM glucose, 3 mM CaCl2,
and 145 mM NaCl) as previously described (Pagano and Martin, 1994
).
Lipid labeling was performed as described before (Jou et
al., 1998
). In brief, duplicate confluent monolayers of MDCK cells
grown on Transwell filters were washed twice in prechilled P buffer,
and 0.5 ml of the sphingomyelin/BSA solution was added to the apical
compartment and 1 ml of P buffer was added to the basal compartment.
The incubation was performed for 10 min on ice, and then the
sphingomyelin/BSA complexes were removed, and the filters were washed
five times in cold P buffer. One filter was immediately processed for
confocal microscopy, and the other one was left on ice in P buffer for
1 h before processing for confocal microscopy. Similar experiments
were performed with IgA. The IgA ligand (100 µg/ml), diluted in P
buffer, was bound to the apical or basolateral surfaces of the cell for
60 min at 4°C. Nonadherent ligand was removed by several washes with
chilled P buffer. One filter was immediately fixed, immunolabeled, and then processed for confocal microscopy. The other filter was incubated in P buffer for 1 h at 4°C before fixation, immunolabeling, and processing.
Endocytosis of 125I-IgA
Endocytosis of 125I-IgA was measured as
previously described (Apodaca et al., 1994
)
Analysis of 125I-IgA Postendocytotic Fate
The postendocytotic fate of a preinternalized cohort of
125I-IgA (at 5-10 µg/ml) was analyzed as
described by Maples et al. (1997)
. In preliminary
experiments we performed assays in the presence of a 100-fold excess of
cold-competing IgA. Because the amount of fluid-phase internalization
was <5% of the signal observed in polymeric Ig receptor
(pIgR)-expressing cells, this step was omitted in subsequent experiments.
Analysis of 125I-Tf Recycling
Iron-saturated Tf was iodinated to a specific activity of
5.0-9.0 × 106 cpm/µg with the use of ICl
as described by Apodaca et al. (1994)
. The cells were washed
with warm (37°C) MEM/BSA three times, and unlabeled Tf was allowed to
dissociate from the cell surface and filter for 60 min in MEM/BSA.
125I-Tf (5 µg/ml) was internalized from the
basolateral surface of the cells for 45 min at 37°C in a humid
chamber. The cells were washed three times for 5 min with ice-cold
MEM/BSA and then warmed to 37°C for 2.5 min to allow for receptor
internalization as described previously (Apodaca et al.,
1994
). The medium was aspirated, fresh medium was added, and the
postendocytic fate of 125I-Tf was assessed as
described above. 125I-Tf uptake was inhibited
>95% when the radioactive ligand was internalized in the presence of
a 100-fold excess of cold ligand.
Analysis of 125I-EGF Degradation
125I-Epidermal growth factor (EGF) was
purchased from NEN Life Science Products (Boston, MA; 150-200
µCi/ug) and used at a final concentration of 40 ng/ml. The cells were
washed with warm (37°C) MEM/BSA three times and
125I-EGF was internalized from the basolateral
surface of the cells for 10 min at 37°C. The cells were washed
rapidly three times with MEM/BSA, the apical and basolateral medium was
aspirated and replaced with fresh MEM/BSA, and the cells were then
incubated for 3 min at 37°C. The medium was aspirated, fresh medium
was added, and the postendocytic fate of 125I-EGF
was determined as described previously (Leung et al., 1999
).
Measurement of gp80 Secretion, Basolateral Delivery of the pIgR, and New Protein Synthesis
Secretion of gp80 was measured as described before (Apodaca
et al., 1993
). Basolateral delivery of newly synthesized
pIgR was quantified with the use of our previously published methods (Apodaca et al., 1993
). Data were quantified with the use of
a Molecular Imager FX phosphorimager (Bio-Rad, Hercules, CA) and associated Quantity One software. Radioactivity was quantified with the
use of the volume rectangle tool. Values (volume counts × cm2) were corrected by subtracting background
counts. Total protein synthesis was measured as follows. Cells were
starved for 15 min in DMEM medium that lacked cysteine and methionine
and contained 10% (wt/vol) dialyzed FBS, 0.35 g/l of
NaHCO3, and 20 mM HEPES, pH 7.4. The cells were
then pulse-labeled with 0.5 mCi/ml
[35S]-Express protein label mix (1175 Ci/mmol;
New England Nuclear, Boston, MA) from both the apical and basolateral
cell surfaces for 5 min at 37°C. The cells were washed with MEM/BSA
three times, the filter with attached cells was cut out of the
Transwell holder, and the cells were lysed in 0.5 ml of SDS lysis
buffer (0.5% [wt/vol] SDS, 100 mM triethanolamine, pH 8.6,and 5 mM
EDTA) containing 1 mM phenylmethylsulfonyl fluoride and a peptide
inhibitor cocktail (5 µg/ml leupeptin, 5 µg/ml antipain and 5 µg/ml pepstatin). The samples were boiled for 5 min and then vortex
shaken for 15 min at 4°C. An aliquot of the lysate was spotted on 3 MM paper (Whatman, Tewksbury, MA) and allowed to dry, and
35S-labeled proteins precipitated with 10%
(vol/vol) trichloroacetic acid. The samples were placed in vials
containing scintillation fluid, and the radioactivity was quantified in
a liquid scintillation counter (Wallach, Gaithersburg, MD).
| |
RESULTS |
|---|
|
|
|---|
Expression of Cdc42V12 and Cdc42N17 in Polarized MDCK Cells
Our goal was to test the hypothesis that Cdc42 regulates
trafficking pathways known to be important in the maintenance of cell
surface polarity. To fulfill this objective we generated stable cell
lines that expressed either a dominant-active mutant of Cdc42
(Cdc42V12) or a dominant-negative mutant of Cdc42 (Cdc42N17) in an
inducible manner. In these studies we used the parent T23 clone of MDCK
cells that stably expresses the tetracycline transactivator (Barth
et al., 1997
). These cells were transfected with cDNA
encoding either amino-terminal myc-tagged dominant-active Cdc42V12 or
dominant inactive Cdc42N17. These cells also express the rabbit pIgR.
The level of expression of mutant Cdc42 was regulated by the addition of the tetracycline analogue DC. In the presence of 20 ng/ml DC, expression of Cdc42V12 or Cdc42N17 was not detected by Western blotting
of cellular lysates (Figure 1A) even
after an extended exposure of the blot, indicating efficient inhibition
of expression in this tetracycline-repressible system.
|
When the Cdc42N17 cells were cultured on Transwells in the absence of DC for 48 h, the amount of Cdc42N17 expression was ~600% of the endogenous Cdc42 levels (Figure 1A). The myc-tagged version of this mutant has a lower mobility on SDS-PAGE than the endogenous protein (marked with an arrow in Figure 1A). The distribution of myc-tagged Cdc42N17 was assessed by immunofluorescence with the use of the myc tag-specific monoclonal antibody 9E10. Myc-Cdc42N17 was found at the apical pole of the cell (Figure 1, B and C) and along its lateral margins (Figure 1D). Much of the staining appeared cytosolic, but some of the myc-tagged Cdc42N17 was associated with vesicular structures. These vesicles were observed above the level of the nucleus (Figure 1C) and to a lesser extent at the base of the cell (Figure 1E).
The amount of myc-tagged Cdc42V12 expression 48-h postplating was
determined to be ~120% of the level of endogenous Cdc42 expression
(Figure 1A). In contrast to myc-tagged Cdc42N17, little of the
myc-tagged Cdc42V12 was found at the apical pole of the cell (Figure
1F). Instead, it was associated with small punctate vesicles at the
base of the cell (Figure 1I), along the lateral cell surfaces (Figure
1, G and H), as well as in an aggregate (marked with arrows in Figure
1H) that was found in focal planes above the nucleus. This aggregate
was either located at the center of the cell or near the lateral
surfaces. This central aggregate was observed in many, but not all,
cells. A similar aggregate is observed in cells expressing a
dominant-active mutant of Rac1 (Jou et al., 2000
). Like that
aggregate, the one observed in cells expressing Cdc42V12 was labeled by
the endosomal markers IgA, Tf, and Rab11 but not by the late endosomal
marker LAMP-1, the Golgi marker giantin, or the TGN marker furin
(Rojas, Ruiz, Leung, Jou, and Apodaca, unpublished observations).
Expression of Mutant Cdc42 Causes Actin Cytoskeleton Reorganization in MDCK Cells
It is hypothesized that Rho-GTPases may modulate protein traffic
in epithelial cells by regulating the organization of actin filaments
and the activity of actin-associated motor proteins. In fact, RhoA and
Rac1 regulate the organization of the actin cytoskeleton associated
with basal, lateral, and apical membrane domains of MDCK cells (Jou and
Nelson, 1998
). We examined whether the distribution of F-actin in MDCK
cells was altered by expression of Cdc42N17 or Cdc42V12. Control cells
(grown in the presence of DC) or those expressing either Cdc42V12 or
Cdc42N17 were cultured for 48 h on Transwell filters. The
distribution of F-actin was determined by incubating fixed and
permeabilized cells with fluorescein isothiocyanate (FITC)-labeled
phalloidin and examining the cells by scanning-laser confocal
microscopy (Figure 2). The cells were also incubated with an antibody that recognizes occludin, an integral membrane protein in tight junctions that marks the border between the
apical and basolateral plasma membrane domains (Faruse et al., 1993
). In control cells F-actin was distributed across the tops of the cells in a punctate pattern that likely reflects
FITC-phalloidin staining of the actin-rich core of the apical
microvilli (Figure 2A). F-actin was also associated with the lateral
surfaces of the cell, both at the level of the tight junctions (Figure
2B) and in sections taken at the level of the nucleus (Figure 2C). F-actin was also detected at the base of the cells where it was associated with bundles of stress fibers (Figure 2D). These results are
in agreement with prior reports of F-actin distribution in MDCK cells
(Stevenson and Begg, 1994
; Maples et al., 1997
). Finally, it
was noted that the tight junctions surrounded each cell in a continuous
band and were usually distributed in a relatively thin plane of focus
(Figure 2F).
|
Expression of Cdc42N17 did not appear to alter the distribution of F-actin structures associated with the apex or base of the cells (Figure 2, I and L). However, in cells expressing this mutant protein, F-actin was observed in cytoplasmic aggregates that formed in the apical cytoplasm (arrowheads in Figure 2J), and thickening and disorganization of the cortical F-actin cytoskeleton was observed along the lateral surfaces of the cell (Figure 2, J and K). The tight junctions in cells expressing Cdc42N17 were no longer distributed in a thin plane of focus; instead, they often extended deeper into the cell (Figures 2, N and O).
Expression of Cdc42V12 also resulted in alterations in the distribution of F-actin in MDCK cells. In some cells there was a loss of the punctate F-actin staining at the apex of the cell (Figure 2Q). The cortical F-actin appeared thickened at some points along the lateral surfaces of the cells (small arrow in Figure 2R). This thickening was also noted at regions of multiple cell-cell contact (small arrow in Figure 2S). In contrast, the actin-rich bundles of stress fibers at the base of the cells appeared unaltered by expression of Cdc42V12 (Figure 2T). In many regions of the monolayer the distribution of occludin was significantly disrupted, and this protein was now observed in all planes of focus (Figure 2, U-X). The organization of the tight junctions was especially impaired at regions where multiple cells formed sites of contact (large arrow in Figure 2W).
Tight Junction Morphology Is Altered in Cells Expressing Cdc42V12
The above results indicated that expression of Cdc42N17 or Cdc42V12 may alter tight junctions. Because large-scale diffusion of ligands or proteins between the two cell surface domains would significantly alter the interpretation of our assays of polarized biosynthetic and endocytic traffic, we further examined whether tight junction morphology and function were affected by expression of Cdc42V12 or Cdc42N17.
First, we assessed the effects of mutant Cdc42 expression on tight
junction morphology. When examining individual optical sections (Figure
2) it was not apparent whether the tight junctions formed a continuous
band around the cells expressing Cdc42N17 or Cdc42V12. To assess the
continuity of the tight junction rings in these cells, the cells were
grown for 48 h on Transwell filters, were fixed, and then stained
with anti-occludin and anti-ZO1 antibodies. A Z-series was captured
with the confocal microscope and the total image volume was summed and
then projected as a single image (Figure 3). In control cells, occludin formed a
continuous ring that encircled each cell (Figure 3A) and was localized
near the apical pole of the cell (Figure 3G). A similar distribution of
occludin was observed in cells expressing Cdc42N17 (Figure 3, B and H).
In contrast, in cells expressing Cdc42V12 the junctional rings appeared
irregular in shape and the thickness of the junctions appeared to vary
(Figure 3C). Increased amounts of occludin were observed at the regions where multiple cells formed contacts. In X-Z sections occludin was
found at the apical borders of some cells expressing Cdc42V12, but in
other cells it was found at multiple sites along the lateral borders
(Figure 3I).
|
In addition to the transmembrane protein occludin, we also examined the distribution of ZO-1, a cytoplasmic protein associated with tight junctions (Figure 3, D-F and J-L). In both control cells and those expressing Cdc42N17 or Cdc42V12, the distribution of ZO-1 was identical to that observed for occludin (in Figure 3, compare A-C with D-F and G-I with J-L). Finally, we examined the ultrastructure of the tight junctions in control cells or those expressing Cdc42N17 or Cdc42V12. Expression of Cdc42N17 had no visible affect on the morphology of tight junctions (compare control cells in Figure 3M with cells expressing Cdc42N17 in Figure 3N). Junctions with normal morphology were also observed in cells expressing Cdc42V12 (Figure 3O). However, in cells expressing Cdc42V12 we also observed junctions in which the membranes appeared to fuse well below the position where tight junctions normally form (Figure 3P; sites of membrane fusion are marked with arrows).
Mutants of Cdc42 Alter the "Gate" and "Fence" Function of Tight Junctions
Next, we assessed whether expression of Cdc42N17 or Cdc42V12
altered the development of TER, a measure of the monolayer's ability
to impede ion flow. The TER of Cdc42N17 or Cdc42V12 cells was monitored
during a 48-h period after induction of cell-cell contacts. When
Cdc42N17 or Cdc42V12 cells were cultured in the presence of DC (+DC)
the TER reached 250-275
cm2 after 18 h
and then decreased to 100
cm2 after 40 h
(Figure 4, A and B). After 18 h,
expression of Cdc42V12 or Cdc42N17 decreased TER by ~40-60% (Figure
4, A and B). However, after 40 h or longer TER values were
comparable to those of the cells grown in the presence of DC (Figure 4,
A and B). These results indicate that expression of Cdc42N17 and
Cdc42V12 may alter early steps in the formation of tight junctions.
|
Because TER is dependent on paracellular transport of ions across tight junctions as well as transcellular transport via ion channels and pumps, we confirmed that paracellular flux of solutes was altered across these monolayers. To measure any changes in tight junction permeability to small molecules we quantified the diffusion of [14C]inulin between the apical and basolateral chamber of cells cultured on Transwells for 18 or 48 h. In Cdc42N17 cells grown in the presence of DC, ~0.15% of apically added [14C]inulin was found in the basolateral compartment of the Transwell after a 60-min incubation at 37°C (Figure 4C). A fivefold increase in [14C]inulin flux was observed in Cdc42N17 cells cultured on Transwells for 18 h in the absence of DC (Figure 4C). However, 48-h postplating on Transwells, Cdc42N17 expression had no affect on diffusion of [14C]inulin between the apical and basolateral compartments of the Transwell (Figure 4C). In contrast, in cells expressing Cdc42V12 paracellular flux of inulin was increased above control levels by ~9- to 10-fold at both the 18- and 48-h time points (Figure 4D). Although the absolute magnitude of inulin flux observed in cells expressing Cdc42V12 was significantly decreased at the 48-h time point, inulin flux still remained elevated (Figure 4D), whereas TER was at control levels (Figure 4B). One possible explanation for this discrepancy is that at the 48-h time point transcellular ion flow was decreased in cells expressing Cdc42V12.
We also measured the paracellular movement of large solutes between the two poles of the cells. 125I-IgA (Mr > 325,000 for multimeric IgA) or 125I-Tf (Mr ~76,000) was added to the apical compartment of the Transwell (in the presence of a 100-fold excess of unlabeled competing ligand) and the appearance of 125I-IgA or 125I-TF in the basolateral compartment was assessed over a 60-min incubation at 37°C (Figure 4, E-H). Unlabeled ligand was added to prevent receptor-mediated endocytosis and apical to basolateral transcytosis of ligand. Under control conditions <0.35% of apically added 125I-IgA or 125I-Tf appeared in the basolateral compartment of filter-grown Cdc42V12 or Cdc42N17 cells grown in the presence of DC (Figure 4, E-H). In cells expressing Cdc42N17 the flux of these large solutes, especially IgA, was significantly increased 18-h postplating on Trans-wells (Figure 4, E and G). However, by 48-h postplating the flux of these solutes was near that of control cells (Figure 4, E and G). This observation is consistent with the return of inulin flux and TER to near control levels by this time point. In cells expressing Cdc42V12 the paracellular flux of these large solutes increased significantly above control levels at 18 h (Figure 4, F and H), but the flux of these markers was decreased when the cells were incubated for 48 h before the assay.
In addition to serving as a gate that regulates the paracellular flow
of ions and solutes, the tight junction can also form a fence that
prevents the lateral diffusion of proteins and lipids between the outer
leaflet of the apical and basolateral plasma membrane domains.
Expression of mutants of other members of the Rho family, such as RhoA
and Rac1, perturb tight junction fence function (Jou et al.,
1998
). Therefore, we examined whether fence function was disrupted in
cells expressing Cdc42N17 or Cdc42V12, by analyzing lipid diffusion in
polarized MDCK cells grown on Transwell filters for 18 or 48 h
(Figure 5). To test fence function, BODIPY-sphingomyelin was added to apical membranes for 10 min on ice,
and after extensive washing, the cells were either processed immediately for confocal microscopy or incubated for an additional 60 min on ice in the absence of labeled lipid.
|
Similar results were observed at the 18- and 48-h time points. In
Cdc42N17 cells grown in the presence of DC, BODIPY-sphingomyelin was
restricted to the apical surface after 10 min of addition (Figure 5, A
and C) or after the 60-min chase (Figure 5, B and D). Similarly, in
cells expressing Cdc42N17 (
DC), BODIPY-sphingomyelin was restricted
to the apical membrane after the 10-min pulse (Figure 5, E and G) or
after the 60-min chase (Figure 5, F and H). In Cdc42V12 cells grown in
the presence of DC, BODIPY-sphingomyelin was similarly restricted to
the apical surface (Figure 5, I-L). However, in cells expressing
Cdc42V12, BODIPY-sphingomyelin labeled only the apical membrane after
the initial 10-min pulse (Figure 5, M and O), but after 60 min both the
apical and basolateral plasma membrane were labeled by the fluorescent
lipid (Figure 5,N and P). These observations indicate that expression
of Cdc42V12 disrupted the barrier to lipid diffusion. Next, we examined
whether membrane proteins could similarly diffuse across the tight
junctions of cells expressing this mutant protein 18 or 48 h
postplating. pIgR molecules at the apical or basolateral surface were
labeled with IgA, and the appearance of IgA-labeled pIgR at the
opposite cell surface was assessed after a 60-min chase (see MATERIALS AND METHODS for details). No appearance of IgA-labeled pIgR at the
opposite cell surface was observed (Rojas, Ruiz, Leung, Jou, and
Apodaca, unpublished results). These results indicate that, although
expression of Cdc42V12 is permissive for lipid diffusion, the barrier
for membrane proteins may remain intact.
In summary, our observations indicate that expression of Cdc42N17 altered TER and paracellular flux during the early stages of MDCK polarization, but by 48 h these effects were significantly lessened. Expression of Cdc42V12 significantly decreased TER and increased solute flux at 18 h. By the 48-h time point the absolute magnitude of flux remained relatively small (<1.5%/h). We also observed that expression of Cdc42V12 disrupted tight junction fence function, and increased lipid diffusion was observed at 18 or 48 h postplating. However, diffusion of apical membrane proteins was not observed under these conditions. As such, by 48-h the alterations in tight junction function observed in Cdc42V12 and Cdc42N17 cells were unlikely to affect the assays described below.
Endocytosis Is Altered by Mutant Cdc42 Expression
In addition to tight junctions, the cell uses other mechanisms to
maintain cellular polarity. One such pathway is endocytosis (reviewed
by Yeaman et al., 1999
). We measured endocytosis of 125I-IgA, which is internalized by a
clathrin-dependent mechanism (Breitfeld et al., 1990
), from
either the apical or basolateral pole of cells expressing either
Cdc42V12 or Cdc42N17. Dominant-negative Cdc42N17 expression had little
affect on basolateral endocytosis (Figure
6A). However, the amount of apical
endocytosis was selectively decreased by ~50% relative to control
cells (Figure 6C). In cells expressing Cdc42V12, the rate and extent of
both apical and basolateral endocytosis was significantly inhibited
compared with that observed in control cells (Figure 6, B and D). The
effect was most pronounced at the 1- and 2.5-min time points, when
35-60% inhibition was observed. These results indicate that Cdc42 may
regulate clathrin-dependent endocytosis in polarized MDCK cells.
|
Postendocytic Traffic Is Impaired in Cells Expressing Mutant Cdc42
We next explored the effect of Cdc42V12 and Cdc42N17 expression on
the postendocytic trafficking pathways that occur after internalization. These pathways are also required to maintain cellular
polarity. Tf was used as a marker of the basolateral recycling pathway.
In control cells, Tf is internalized almost exclusively from the
basolateral pole of the cell and rapidly recycles back to this cell
surface via basolateral early endosomes and the common endosome
(reviewed by Apodaca, 2001
). There was little affect of Cdc42N17
expression on polarized Tf traffic (Figure 7A), although a small but reproducible
slowing of the rate of recycling was observed at the earliest time
point. The rate and extent of Tf recycling was significantly decreased
in cells expressing Cdc42V12 (Figure 7B). This decrease was coupled
with a significant increase in the amount of ligand released from the
apical pole of the cell (~3% in control vs. ~30% in cells
expressing Cdc42V12). This latter observation indicated that a
significant fraction of the Tf receptor may reside at the apical
surface of cells expressing Cdc42V12. In fact, relative to control
cells there was a sixfold increase in apical uptake of
125I-Tf in cells expressing Cdc42V12, confirming
a significant increase in apical expression of the Tf receptor in these
cells (Rojas, Ruiz, Leung, Jou, and Apodaca, unpublished observations).
There was little difference in the amount of
125I-Tf degraded (~2-3% in both cases), but
there was a small increase in the amount of ligand remaining cell
associated (~3% in control vs. ~8% in Cdc42V12 expressors). These
observations indicate that Cdc42V12 expression alters the efficient
sorting of Tf into the basolateral recycling pathway of polarized MDCK
cells.
|
As a marker of the degradative pathway we followed the postendocytic
fate of basolaterally internalized EGF. On endocytosis, EGF is
primarily delivered to late endosomes/lysosomes where it is degraded.
In MDCK cells, a fraction of the ligand (~20-25%) also recycles at
the basolateral pole of the cell or is released at the apical pole of
the cell (~5-10%; Brandli et al., 1991
). The majority of
125I-EGF internalized from the basolateral
surface of Cdc42N17 cells grown in the presence of DC was degraded
(~60%; Figure 7C), ~20% was recycled to the basolateral surface,
~10% was transcytosed, and the balance remained cell associated.
Cdc42N17 expression did not affect EGF degradation (Figure 7C).
Cdc42V12 expression slowed the degradation of
125I-EGF (Figure 7D) but had no effect on the
extent of ligand degradation. A small increase in the amount of ligand
released at the apical pole of the cell (~10% in control and ~15%
in cells expressing Cdc42V12), and a decrease in the amount of EGF that
recycled (~18% in control vs. ~13% in Cdc42V12 expressors) was
noted in these Cdc42V12-expressing cells.
IgA internalized from the apical pole of pIgR-expressing cells was used
as a marker of the apical recycling pathway. The pIgR moves by
transcytosis from basolateral early endosomes to common endosomes, to
the apical recycling endosomes, and finally to the apical pole of the
cell where it is cleaved to secretory component (reviewed by Apodaca,
2001
). However, a significant fraction of the receptor escapes cleavage
and can be internalized from the apical cell surface (Breitfeld
et al., 1989
). This apically internalized pool of IgA
primarily recycles to the apical membrane; little of the IgA is
transcytosed and released at the basolateral pole of the cell (Apodaca
et al., 1994
). Cdc42N17 expression had little effect on
apical IgA recycling (Figure 7E). In cells expressing Cdc42V12 there
was a decrease in the kinetics of apical recycling versus control cells
and an overall 20% decrease in the total amount of IgA recycled
(Figure 7F). Compared with control cells there was no difference in the
amount of ligand that was degraded (~7%), but the amount of IgA
remaining cell associated increased from 7% in control cells to
~23% in cells expressing Cdc42V12.
Finally, we measured the effect of Cdc42V12 and Cdc42N17 expression on the postendocytic fate of basolaterally internalized 125I-IgA. Expression of Cdc42N17 significantly slowed the kinetics of IgA transcytosis; however, the extent of transcytosis was unaltered (Figure 7G). Expression of this mutant protein had no effect on ligand recycling but increased the amount of degraded IgA from ~5% to ~8% and cell associated IgA from ~3% to ~9%. In cells expressing Cdc42V12 there was also a significant slowing in the kinetics of basolateral to apical transcytosis (Figure 7H), and the total amount of ligand transcytosis was inhibited by ~15%. Recycling of the ligand was unaffected by Cdc42V12 expression, but the total cell-associated or degraded ligand was increased from ~3-4% in control cells to ~8.5% in cells expressing Cdc42V12.
Golgi Morphology Is Modified in Cells Expressing Cdc42V12 or Cdc42N17
It was previously reported that Cdc42 is associated with the Golgi
of liver and kidney-derived epithelial cells (Erickson et
al., 1996
; Kroschewski et al., 1999
). We assessed
whether Cdc42V12 and Cdc42N17 were associated with the Golgi of our
transfected cell lines and also determined whether Golgi morphology was
perturbed by expression of these proteins. In control cells, giantin, a resident Golgi protein (Lindstedt and Hauri, 1993
), is distributed in a
ribbon-like structure that is found between the nucleus and apical
membrane (Figure 8, A-C). Cdc42N17
expression resulted in the dispersion of the Golgi into vesicular
elements that were distributed throughout the cytosol at the apical
pole of the cell (Figure 8, D-F). Much of the Cdc42N17 staining was
diffuse and did not colocalize with giantin-labeled Golgi. However,
some colocalization of myc-tagged Cdc42N17 and giantin was observed on
vesicular structures present in focal planes above the nucleus (see
arrows in Figure 8, D and E). In Cdc42V12-expressing cells the Golgi
also appeared somewhat fragmented and was distributed throughout the
cell (Figure 8, G-I). Although there was an occasional region of
colocalization between these two proteins, the majority of Cdc42V12
protein was associated with other intracellular compartments, including
the central aggregate, and did not colocalize with giantin-labeled Golgi. We have also examined the distribution of the TGN marker protein
furin and either myc-tagged Cdc42V12 or Cdc42N17. Although the
distribution of furin was fragmented relative to control, there were
only small amounts of furin-labeled TGN that colocalized with Cdc42V12
or Cdc42N17 (Rojas, Ruiz, Leung, Jou, and Apodaca, unpublished
observations).
|
Expression of Cdc42V12 or Cdc42N17 Alters Biosynthetic Targeting of Proteins
The disruption of Golgi morphology by Cdc42V12 and Cdc42N17
indicated that biosynthetic traffic might be altered by
expression of these mutant proteins. To test this possibility we
analyzed the effect of Cdc42V12 or Cdc42N17 expression on delivery of
newly synthesized pIgR to the basolateral surface of the cells. In
control Cdc42N17 cells ~70% of the pIgR was directly delivered to
the basal pole of the cells and ~10% was delivered directly to the apical pole of the cell (Figure 9A). The
balance remained in the cell. Expression of Cdc42N17 resulted in a
small but significant (p < 0.05 with the use of Student's
t test) increase of ~20% in basolateral delivery of the
pIgR but had no effect on apical delivery (Figure 9A). In cells
expressing Cdc42V12 basolateral delivery of the pIgR was diminished by
~30%, whereas apical delivery was stimulated by ~50% (Figure 9A).
|
Next, we examined the effects of Cdc42V12 and Cdc42N17 expression on
secretion of the gp80 complex. This endogenous protein is secreted
predominantly at the apical pole of the cell with an apical to
basolateral ratio of ~3-4:1 (Urban et al., 1987
). Expression of Cdc42N17 resulted in an increase in both the kinetics and
the amount of gp80 secreted at the apical pole of the cell (Figure 9B).
No effect was observed on basolateral secretion of gp80. In contrast,
expression of Cdc42V12 slowed apical secretion of gp80 (Figure 9C) but
had little affect on basolateral secretion of gp80. To rule out the
possibility that these observations were simply the result of
Cdc42-mediated changes in protein synthesis, we confirmed by
35S-protein labeling that the total amount of
newly synthesized proteins was unaltered by expression of Cdc42N17
(Rojas, Ruiz, Leung, Jou, and Apodaca, unpublished observations). In
cells expressing Cdc42V12 the amount of total protein synthesis was
doubled relative to control cells at this time point (Rojas, Ruiz,
Leung, Jou, and Apodaca, unpublished observations). However, this could
not explain the decreased levels of gp80 secretion.
| |
DISCUSSION |
|---|
|
|
|---|
Cdc42-dependent Regulation of Tight Junctions
Cdc42 is an important regulator of cellular polarity in multiple
cell types including the budding yeast Saccharomyces
cerevisiae and T-lymphocytes (Adams et al., 1990
;
Stowers et al., 1995
). Our data and that of Kroschewski
et al. (1999)
indicate that Cdc42 may also be important in
the maintenance of cellular polarity in polarized MDCK cells. The tight
junction is crucial for the maintenance of cell polarity and regulates
paracellular flux of ions and solutes (the so-called gate function), as
well as impedes the movement of lipids and proteins in the
extracellular leaflet of the plasma membrane (fence function; reviewed
by Cereijido et al., 1998
). It was recently reported that
RhoA and Rac1 may be important modulators of tight junction function
(Jou et al., 1998
). Our data indicate that Cdc42 may also
play a role in this process. We observed that the morphology of the
tight junctions was significantly altered by expression of Cdc42V12,
consistent with previous reports (Kroschewski et al., 1999
;
Joberty et al., 2000
). In contrast, only minimal changes
were observed in the tight junction morphology of cells expressing
Cdc42N17. Both Kroschewski et al. (1999)
and Takaishi
et al. (1997)
also observed no effect of mutant Cdc42N17
expression on tight junction morphology and suggested that tight
junction function may be unaltered. However, these
investigators used individually microinjected cells or cells cultured
on plastic, which hindered their ability to measure changes in solute
and ion flux across the monolayer.
Functionally, the gate and fence function of tight junctions was
perturbed by mutants of Cdc42. We observed that at early time points
after cell-cell contact (18 h) TER was decreased by 40-60% in cells
expressing either Cdc42V12 or Cdc42N17. We confirmed that the gate
function of tight junctions was altered by measuring the paracellular
flux of small and large solutes. Consistent with the measurements of
TER, the flux of inulin and of Tf and multimeric IgA complexes were
increased by expression of mutant Cdc42. These effects were especially
pronounced at 18 h but were less prominent at the 48-h time point.
These results indicate that expression of Cdc42N17 or Cdc42V12 may
alter early steps in the formation of tight junctions; however, with
time tight junctions (of variable functionality) are able to assemble.
Finally, we observed that the fence function of cells expressing
Cdc42V12 was perturbed, because BODIPY-sphingomyelin was able to
diffuse between the apical and basolateral domains. In contrast, we
observed that pIgR, labeled at the apical or basolateral surface with
IgA, did not diffuse under identical conditions. Our data indicate that
expression of Cdc42V12 may selectively alter the diffusion of lipids
across the tight junction. Interestingly, expression of a truncated
mutant of occludin similarly alters diffusion of a labeled lipid but not of a membrane protein (Balda et al., 1996
).
Mutants of Cdc42 may modulate tight junction morphology and function by
several different mechanisms. We observed that expression of either
Cdc42N17 or Cdc42V12 affected the cortical actin cytoskeleton. Actin is
associated with tight junctions and tight junction function can be
altered by disruption of the actin cytoskeleton (Madara, 2000
).
Alternatively, the effects we observed may reflect Cdc42-dependent alterations in the Par6/Par3/protein kinase C-
protein complex (Joberty et al., 2000
). In Caenorhabditis elegans
the Par proteins are required for asymmetric cell division and
polarized growth. Proteins homologous to Par proteins are found in
mammalian cells, interact with Cdc42 and Rac1 (Joberty et
al., 2000
; Qiu et al., 2000
), and are thought to play
some role, as yet undefined, in the formation of tight junctions at
sites of cell-cell contact (Joberty et al., 2000
). In this
regard, we observed that Cdc42V12 was localized along the lateral
membranes of the cells, and this localization correlated with the
extended distribution of tight junction proteins along the lateral surfaces.
Modulation of Endocytic Traffic by Cdc42
In addition to a potential role in modulating tight junction
function, we also observed that mutants of Cdc42 also impaired the
normal function of endocytic pathways. These pathways are known to be
crucial in the maintenance of cell polarity (reviewed by Yeaman
et al., 1999
). Expression of Cdc42V12 slowed the rate and
extent of apical and basolateral endocytosis, whereas Cdc42N17 expression selectively slowed apical endocytosis. The slowing of apical
endocytosis by both Cdc42V12 and Cdc42N17 indicates that cycling of
Cdc42 between GDP- and GTP-bound states may be necessary for normal
endocytic activity. Our results are consistent with recent observations
that Cdc42 developmentally regulates endocytosis in dendritic cells
(Garrett et al., 2000
). Moreover, they indicate that, in
addition to Rho and Rac (Jou et al., 2000
; Leung et
al., 1999
), Cdc42 may be important in the regulation of
endocytosis in polarized epithelial cells.
Expression of Cdc42V12 also altered the postendocytic traffic of
several ligands. The largest effect was on the postendocytic traffic of basolaterally internalized Tf. We observed that Tf recycling
was slowed, and there was a significant increase in the amount released
at the apical pole of the cell and the Tf-receptor was now expressed at
the apical cell surface. These observations are consistent with the
finding by Kroschewski et al. (1999)
that proteins that
normally recycle at the basolateral pole of the cell are observed at
the apical surface of cells expressing Cdc42V12. Whereas apical release
of Tf was stimulated in cells expressing Cdc42V12, transcytosis of
basolaterally internalized IgA was slowed in Cdc42V12-expressing cells.
These contrasting effects indicate that Cdc42V12 expression might
impact multiple compartments or sorting events. For example, by
impairing the function of the Rab11-positive elements of the apical
recycling endosome (which are involved in IgA transcytosis but not Tf
recycling; Wang et al., 2000
), expression of Cdc42V12 would
impair basolateral to apical transcytosis. And, by altering the
normally efficient basolateral sorting/targeting machinery in
basolateral or common endosomes, expression of Cdc42V12 would result in
apical release of Tf ligand. In addition to effects on Tf recycling and
IgA transcytosis, expression of Cdc42V12 slowed both EGF degradation
and recycling of apically internalized IgA.
In contrast, expression of Cdc42N17 had little effect on many of these
postendocytic trafficking pathways. The only demonstrable effect was
the significant slowing of basolateral to apical transcytosis. Other
dominant-negative mutants of small GTPases (e.g., rab25, RhoA, Rac1)
have little affect on postendocytic traffic (Casanova et
al., 1999
; Leung et al., 1999
; Jou et al.,
2000
), and a dominant-negative mutant of the early endosome-associated
GTPase RhoD has little affect on endosome function (Murphy et
al., 1996
). Perhaps some endocytic traffic is modulated only by
activation of these small GTPases. This would be similar to the effects
of protein kinase C and protein kinase A on postendocytic traffic. When
activated, these kinases modulate traffic, whereas inactivation of
these kinases apparently has no affect (Cardone et al.,
1994
; Hansen and Casanova, 1994
).
Cdc42 and Golgi Function
Unlike previous studies (Erickson et al., 1996
;
Kroschewski et al., 1999
), we did not observe any
significant association of the Golgi with Cdc42V12 and only limited
association of Cdc42N17 with this organelle. This was true of cells
that were plated at low density on plastic, when cells were cultured on
filters and allowed to polarize for 1-3 d, or when protein expression
was attenuated by the addition of various concentrations of DC (Rojas, Ruiz, Leung, Jou, and Apodaca, unpublished observations). However, we
did observe that in cells expressing Cdc42V12 the Golgi appeared fragmented and in cells expressing Cdc42N17 the Golgi ribbons were
dispersed throughout the cytoplasm. The underlying cause of this effect
is unknown but could reflect alterations in the cytoskeleton. As
described in Figure 2, expression of Cdc42N17 or Cdc42V12 had
significant effects on the distribution of the actin cytoskeleton.
Although Cdc42 is associated with the Golgi of many cell types, such is
not always the case. In yeast, Cdc42 is normally localized to the site
of bud formation (Adams et al., 1990
), in the kidney cortex
Cdc42 is primarily associated with the plasma membrane and cytosol
(Boivin and Béliveau, 1995
), and in adrenal chromaffin cells
Cdc42 is exclusively localized in a subplasmalemmal region in both
resting and nicotine-stimulated cells (Gasman et al., 1999
).
The difference between our observations and those previously made in
MDCK cells (Kroschewski et al., 1999
) may reflect the
different mechanisms of achieving mutant Cdc42 gene expression or the
differences in the level of protein expression.
Cdc42V12 expression diminished the amount of newly synthesized pIgR
delivered to the basolateral surface of the cells (coupled with a small
increase in direct TGN to apical delivery), consistent with previous
observations that basolateral delivery of membrane proteins is altered
in cells expressing Cdc42V12 (Kroschewski et al., 1999
). In
addition, we observed that Cdc42V12 impaired the apical secretion of
the endogenous gp80 protein. In contrast, expression of Cdc42N17
stimulated basolateral delivery of the pIgR and apical secretion of
gp80. Our results are consistent with observations made in yeast
Cdc42-1ts mutants; at the restrictive
temperature they cannot establish a single bud site; yet they grow
isotropically. This continued growth indicates that secretion is
unimpeded, even in the absence of Cdc42 expression (Adams et
al., 1990
). Our results are in contrast to observations that
basolateral delivery of vesicular-stomatitis virus G-protein is
impaired in cells expressing Cdc42N17, whereas apical delivery is
apparently unaffected (Kroschewski et al., 1999
).
As described above this could reflect differences in the methods used
to obtain mutant Cdc42 expression, the levels of Cdc42N17 expression,
or the techniques used to quantify transport defects across the whole
monolayer. Alternatively, it may reflect differences in the pathways
used to deliver proteins to the cell surface. The basolateral
vesicular-stomatitis virus G-protein used by Kroschewski et
al. (1999)
contains a tyrosine-dependent basolateral sorting determinant (Thomas and Roth, 1994
), whereas the pIgR does not (Aroeti
et al., 1993
). Perhaps there is more than one
mechanism/pathway for delivery of basolateral proteins and these are
differentially sensitive to expression of Cdc42V12. Even yeast are
thought to have more than one pathway to the cell surface (Finger and
Novick, 1998
), and these pathways may be differentially regulated by Cdc42.
The opposite effects of Cdc42V12 and Cdc42N17 expression on gp80
secretion indicate that Cdc42 may be an important regulator of
biosynthetic cargo delivery. In its GTP-bound state Cdc42 may slow
traffic, and in its inactive GDP-bound state Cdc42 may stimulate biosynthetic traffic. These effects could reflect alterations in cargo
delivery to or exit from the Golgi or targeting of newly synthesized
proteins from the Golgi to the cell surface. Alternatively, they may be
the result of Cdc42-dependent alterations in the actin cytoskeleton.
Recently, it was observed that active Cdc42 interacts with
-coat-protein complex I and may modulate early steps in biosynthetic traffic (Wu et al., 2000
). Because newly
synthesized pIgR is transported from the Golgi to an apical endosomal
compartment (likely to include elements of the apical recycling
endosome and/or elements of the common recycling endosome) before its
arrival at the basolateral cell surface (Orzech et al.,
2000
), Cdc42 may also act through modulation of endocytic pathways.
Cdc42 Effector Pathways
Several membrane trafficking steps including phagocytosis,
exocytosis, endocytosis, receptor recycling, and basal to apical transcytosis are thought to require the actin cytoskeleton (Mukherjee et al., 1997
; reviewed by Apodaca, 2001
). By altering the
actin cytoskeleton, Cdc42 could modulate these pathways. In addition, Cdc42 is known to interact with several other downstream
activator/effector proteins including Wiskoff-Aldrich syndrome protein
(WASP), phopholipase D, phosphatidylinositol
3-kinase (PI-3-K), and IQGAP (Zheng et al., 1994
;
Nobes and Hall, 1995
; Singer et al., 1995
; Aspenström et al., 1996
; Hart et al., 1996
; Symons et
al., 1996
; McCallum et al., 1998
). WASP is known to be
important in the nucleation of the actin cytoskeleton (Rohatgi et
al., 1999
). Through modifications of the lipid bilayer, both
phospholipase D and phosphoinositol-4-phosphate 5-OH kinase are
known to affect the ability of coat proteins to bind to organellar
membranes (De Camilli et al., 1996
; Liskovitch, 1996
).
Activation of PI-3-K is especially intriguing because endocytic traffic
is altered in cells treated with wortmannin, a potent inhibitor of
PI-3-K (Hansen et al., 1995
). Uncontrolled activation of
PI-3-K and its effectors may have dramatic effects on postendocytic traffic. Finally, IQGAP interacts with Cdc42, actin, and calmodulin and
is localized to the Golgi where it may play a role in Golgi localization and function (McCallum et al., 1998
). Acting
through these effectors, Cdc42 may control multiple pathways that are used to generate and maintain epithelial cell polarity.
In summary, our results indicate that Cdc42 may control multiple aspects of epithelial polarity by modulating tight junction morphology and function and endocytic and biosynthetic traffic directed to the apical and basolateral surfaces of these cells.
| |
ACKNOWLEDGMENTS |
|---|
We thank Drs. Ora Weisz and Rebecca Hughey for their insightful comments and critiques while preparing this manuscript. In addition, We thank Drs. Whiteheart, Goodenough, Lindstedt, and Rodriquez-Boulan for kindly providing antibodies. Finally, We thank Dr. W. J. Nelson for freely distributing the Cdc42 cell lines generated in his laboratory. His kindness made this analysis possible. This work was supported by a grant from the National Institutes of Health to G.A. (RO1DK51970). The Laboratory of Epithelial Biology is supported in part by an equipment grant from Dialysis Clinic Inc.
| |
Note added in proof: |
|---|
During final acceptance of this manuscript, Müsch A., Cohen, D., Kreitzer, G., and RodriguezBoulan, E. published an article in EMBO J. (20: 2171-2179; 2001), detailing cDC42-dependent regulation of apical and basolateral protein exit from the TGN.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
gla6{at}pitt.edu.
| |
ABBREVIATIONS |
|---|
Abbreviations used: BSA, bovine serum albumin; DC, doxycycline; EGF, epidermal growth factor; FBS, fetal bovine serum; FITC, fluorescein isothiocyanate; Ig, immunoglobulin; LCM, low calcium medium; MDCK, Madin-Darby canine kidney cells; MEM, minimal essential medium; PI-3-K, phosphatidylinositol 3-kinase; pIgR, polymeric immunoglobulin receptor; TER, trans-epithelial resistance; TGN, trans-Golgi network; Tf, transferrin.
| |
REFERENCES |
|---|
|
|
|---|
stimulates transcytosis and apical secretion in MDCK cells through cAMP and protein kinase A.
J. Cell Biol.
126, 677-688
B-dependent gene expression, in macrophages challenged with Pseudomonas aeruginosa.
J. Biol. Chem.
275, 141-146
-subunit of the coatomer complex binds Cdc42 to mediate transformation.
Nature
405, 800-804[Medline].This article has been cited by other articles:
![]() |
B. A. Babbin, M. Sasaki, K. W. Gerner-Schmidt, A. Nusrat, and J.-M. A. Klapproth The Bacterial Virulence Factor Lymphostatin Compromises Intestinal Epithelial Barrier Function by Modulating Rho GTPases Am. J. Pathol., April 1, 2009; 174(4): 1347 - 1357. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Brady, J. K. Alan, J. P. Madigan, A. S. Fanning, and A. D. Cox The Transforming Rho Family GTPase Wrch-1 Disrupts Epithelial Cell Tight Junctions and Epithelial Morphogenesis Mol. Cell. Biol., February 15, 2009; 29(4): 1035 - 1049. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Jaffe, N. Kaji, J. Durgan, and A. Hall Cdc42 controls spindle orientation to position the apical surface during epithelial morphogenesis J. Cell Biol., November 17, 2008; 183(4): 625 - 633. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Babbey, N. Ahktar, E. Wang, C. C.-H. Chen, B. D. Grant, and K. W. Dunn Rab10 Regulates Membrane Transport through Early Endosomes of Polarized Madin-Darby Canine Kidney Cells Mol. Biol. Cell, July 1, 2006; 17(7): 3156 - 3175. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-F. Liu, H. Ishida, R. Raziuddin, and T. Miki Nucleotide Exchange Factor ECT2 Interacts with the Polarity Protein Complex Par6/Par3/Protein Kinase C{zeta} (PKC{zeta}) and Regulates PKC{zeta} Activity Mol. Cell. Biol., August 1, 2004; 24(15): 6665 - 6675. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bruewer, A. M. Hopkins, M. E. Hobert, A. Nusrat, and J. L. Madara RhoA, Rac1, and Cdc42 exert distinct effects on epithelial barrier via selective structural and biochemical modulation of junctional proteins and F-actin Am J Physiol Cell Physiol, August 1, 2004; 287(2): C327 - C335. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Etienne-Manneville Cdc42 - the centre of polarity J. Cell Sci., March 15, 2004; 117(8): 1291 - 1300. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Luton, S. Klein, J.-P. Chauvin, A. Le Bivic, S. Bourgoin, M. Franco, and P. Chardin EFA6, Exchange Factor for ARF6, Regulates the Actin Cytoskeleton and Associated Tight Junction in Response to E-Cadherin Engagement Mol. Biol. Cell, March 1, 2004; 15(3): 1134 - 1145. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fukuhara, K. Shimizu, T. Kawakatsu, T. Fukuhara, and Y. Takai Involvement of Nectin-activated Cdc42 Small G Protein in Organization of Adherens and Tight Junctions in Madin-Darby Canine Kidney Cells J. Biol. Chem., December 19, 2003; 278(51): 51885 - 51893. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. de Toledo, F. Senic-Matuglia, J. Salamero, G. Uze, F. Comunale, P. Fort, and A. Blangy The GTP/GDP Cycling of Rho GTPase TCL Is an Essential Regulator of the Early Endocytic Pathway Mol. Biol. Cell, December 1, 2003; 14(12): 4846 - 4856. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Roh and B. Margolis Composition and function of PDZ protein complexes during cell polarization Am J Physiol Renal Physiol, September 1, 2003; 285(3): F377 - F387. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Rubenstein, Y. Guan, P. L. Woo, and G. L. Firestone Glucocorticoid Down-regulation of RhoA Is Required for the Steroid-induced Organization of the Junctional Complex and Tight Junction Formation in Rat Mammary Epithelial Tumor Cells J. Biol. Chem., March 14, 2003; 278(12): 10353 - 10360. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Nunbhakdi-Craig, L. Craig, T. Machleidt, and E. Sontag Simian Virus 40 Small Tumor Antigen Induces Deregulation of the Actin Cytoskeleton and Tight Junctions in Kidney Epithelial Cells J. Virol., March 1, 2003; 77(5): 2807 - 2818. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Hopkins, S. V. Walsh, P. Verkade, P. Boquet, and A. Nusrat Constitutive activation of Rho proteins by CNF-1 influences tight junction structure and epithelial barrier function J. Cell Sci., February 15, 2003; 116(4): 725 - 742. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Hobert, K. A. Sands, R. J. Mrsny, and J. L. Madara Cdc42 and Rac1 Regulate Late Events in Salmonella typhimurium-induced Interleukin-8 Secretion from Polarized Epithelial Cells J. Biol. Chem., December 20, 2002; 277(52): 51025 - 51032. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Van Aelst and M. Symons Role of Rho family GTPases in epithelial morphogenesis Genes & Dev., May 1, 2002; 16(9): 1032 - 1054. [Full Text] [PDF] |
||||
![]() |
A. Luna, O. B. Matas, J. A. Martinez-Menarguez, E. Mato, J. M. Duran, J. Ballesta, M. Way, and G. Egea Regulation of Protein Transport from the Golgi Complex to the Endoplasmic Reticulum by CDC42 and N-WASP Mol. Biol. Cell, March 1, 2002; 13(3): 866 - 879. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||