![]() |
|
|
Vol. 12, Issue 8, 2275-2289, August 2001
Department of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, Missouri 63110
Submitted November 1, 2000; Revised May 4, 2001; Accepted May 25, 2001| |
ABSTRACT |
|---|
|
|
|---|
We have studied the localization of synaptogyrin family members in vivo. Both native and green fluorescent protein (GFP)-tagged Caenorhabditis elegans synaptogyrin (SNG-1) are expressed in neurons and synaptically localized. Deletion and mutational analysis with the use of GFP-tagged SNG-1 has defined a 38 amino acid sequence within the C terminus of SNG-1 and a single arginine in the cytoplasmic loop between transmembrane domain 2 and 3 that are required for SNG-1 localization. These domains may represent components of signals that target synaptogyrin for endocytosis from the plasma membrane and direct synaptogyrin to synaptic vesicles, respectively. In chimeric studies, these regions were sufficient to relocalize cellugyrin, a nonneuronal form of synaptogyrin, from nonsynaptic regions such as the sensory dendrites and the cell body to synaptic vesicles. Furthermore, GFP-tagged rat synaptogyrin is synaptically localized in neurons of C. elegans and in cultured hippocampal neurons. Similarly, the C-terminal domain of rat synaptogyrin is necessary for localization in hippocampal neurons. Our study suggests that the mechanisms for synaptogyrin localization are likely to be conserved from C. elegans to vertebrates.
| |
INTRODUCTION |
|---|
|
|
|---|
Synaptic vesicles (SVs) contain a restricted set of membrane
proteins important for neuronal function (Südhof, 1995
; Calakos and Scheller, 1996
; Fernandez-Chacon and Südhof, 1999
). The
mechanisms responsible for targeting these proteins specifically to the
SV membrane are poorly understood. Integral membrane proteins are synthesized on the rough endoplasmic reticulum and traffic through the
Golgi network. Proteins exiting the trans-Golgi network
(TGN) are sorted to different types of transport vesicles. SV proteins are sorted to synaptic vesicle precursors (preSVs), which differ from
mature SVs both in morphology and protein composition (Tsukita and
Ishikawa, 1980
; Okada et al., 1995
). Evidence supports both direct routing of SV proteins from TGN to preSVs and indirect routing
via the plasma membrane (reviewed by Hannah et al., 1999
). preSVs are subsequently transported along axonal processes to the nerve
terminal by motor proteins of the kinesin superfamily (reviewed by
Hirokawa, 1998
). How preSVs mature after delivery to the nerve terminal
is unknown. preSVs might fuse with an endosomal compartment and SVs
generated by budding from the endosome. A second, but not mutually
exclusive possibility, is that preSVs are delivered to the presynaptic
plasma membrane at the nerve terminal and then retrieved by the same
mechanism(s) used to recycle SVs after regulated exocytosis (Hannah
et al., 1999
; reviewed by Buckley et al.,
2000
). Regardless of the exact route of trafficking to the
mature organelle, SV proteins must be sorted away from other membrane
proteins at several stages during their life cycle.
Signal sequences resident in proteins are thought to mediate the
sorting of many proteins to cellular compartments. Several studies have
identified domains and motifs necessary for correct localization of SV
proteins. Targeting and sorting signals have been identified in
synaptophysin (Linstedt and Kelly, 1991
), synaptobrevin (Grote et
al., 1995
; Grote and Kelly, 1996
), synaptotagmin
(Blagoveshchenskaya et al., 1999
; Krasnov and
Enikolopov, 2000
), and vesicular neurotransmitter transporters (Tan
et al., 1998
; Varoqui and Erickson, 1998
). However, no
common motif that could serve as a universal targeting signal has been
found by experimental studies or by direct comparison of the primary
sequences of SV proteins. Although tyrosine-based signals are one of
the major sorting signals used by clathrin pit-mediated endocytosis
(Davis et al., 1986
, 1987
; Collawn et al., 1990
;
Peters et al., 1990
; Thies et al., 1990
;
Letourneur and Klausner, 1992
), only one protein, P-selectin, has been
shown to use a tyrosine-based signal to be targeted to synaptic-like microvesicles (SLMVs) in PC12 cells (Blagoveshchenskaya et
al., 1999
).
The absence of a common sorting signal element in SV proteins contrasts
to targeting to other organelles where many distinct proteins use the
same sorting signal (Stanley, 1996
). At least two different mechanisms
of SV protein sorting could account for the lack of a universal SV
targeting signal. First, distinct components of SVs may be sorted by
independent sorting mechanisms. Such an idea is also supported by other
findings. For example, the SV proteins synaptotagmin, synaptophysin,
and SV2 are sorted into different classes of organelles when expressed
in nonneuronal Chinese hamster ovary cells (Feany et
al., 1993
). In vivo, SV2 and synaptophysin associate with
different kinesin motor proteins and consequently probably reside in
distinct vesicle populations (Okada et al., 1995
). In
addition, in the Caenorhabditis elegans unc-11 (AP180
homolog) mutant, synaptobrevin alone is mislocalized, whereas other SV
proteins are unaffected (Nonet et al., 1999
). Furthermore, the protein stoned is required selectively for the retrieval of synaptotagmin I from the plasma membrane in
Drosophila (Fergestad et al., 1999
; Fergestad and
Broadie, 2001
), perhaps via its interaction with the C2B domain of
synaptotagmin I (Littleton et al., 2001
). Another
possibility is that sorting information is only present in a few
proteins, and other components form complexes with these proteins and
are secondarily targeted to SVs (Bennett et al., 1992
). More
likely, a combination of these two mechanisms is used to target SV
proteins. Defining distinct trafficking signals for all SV proteins
will be complex and ultimately may require defining multiple
protein-protein interactions that act coordinately.
Caenorhabditis elegans has several features that make it a
valuable system for studying both synaptic function and SV protein localization in vivo. Both forward and reverse genetics have been used
to generate mutations in multiple synaptic components, many of which
are evolutionarily conserved (Fernandez-Chacon and Südhof, 1999
;
Nonet, 1999
). The unique life cycle of C. elegans
allows many mutants (and double and triple mutants) that are severely compromised in neuronal function to survive simplifying detailed analysis of the role of these genes (Nonet et al., 1993
,
1997
, 1999
; Harris et al., 2000
). The compact organization
and completed sequence description of the genome greatly facilitates
the identification and manipulation of existing and novel members of
protein families known to have important functions in other organisms
(Bargmann, 1998
; The C. elegans Sequencing Consortium,
1998
). Qualitative and quantitative analysis of the distribution of
GFP-tagged protein in live animals under fluorescent microscopy is
simple owing to the transparent nature of the organism (Labrousse
et al., 1998
; Nonet, 1999
). Finally, genes that are
involved in protein localization can be isolated in classical genetic
screens with the use of GFP-tagged transgenes (reviewed by Koushika and
Nonet, 2000
).
In this study we have characterized signals required for localization
of members of the synaptogyrin family, which currently consists of
three human genes, three mouse genes, two rat genes and one C. elegans gene (Stenius et al., 1995
; Janz and
Südhof, 1998
; Kedra et al., 1998
; Nonet et
al., 1999
). The first cloned member of this family, rat
synaptogyrin (p29), is highly expressed in neurons and neuroendocrine
cells where it colocalizes with synaptophysin on SVs and SLMVs (Baumert
et al., 1990
; Stenius et al., 1995
). Synaptogyrin
together with synaptophysin, a family distantly related to
synaptogyrin, accounts for >10% of the total SV protein content (Jahn
et al., 1985
; Wiedenmann and Franke, 1985
; Baumert et
al., 1990
; Jahn and Südhof, 1993
; Stenius et al.,
1995
). Moreover, both synaptogyrin and synaptophysin families contain
nonneuronal isoforms that are ubiquitously expressed (Haass et
al., 1996
; Janz and Südhof, 1998
; Kedra et al.,
1998
; Takeshima et al., 1998
). Synaptophysin and
synaptogyrin share similar membrane topologies with four transmembrane
domains where their N and C termini face the cytoplasm (Johnston
et al., 1989
; Stenius et al., 1995
). In PC12
cells, overexpressing synaptogyrin and synaptophysin inhibits
exocytosis (Sugita et al., 1999
). Double mutant mice lacking
both synaptogyrin and synaptophysin show severe reductions in both
short-term and long-term synaptic plasticity, suggesting that they are
regulators of exocytosis (Janz et al., 1999
).
sng-1, the C. elegans member, has 30% identity
to the rat synaptogyrin and a similar hydrophobicity profile (Nonet,
1999
). Analysis of animals expressing green fluorescent protein
(GFP)-tagged synaptogyrin (SNG-1) suggests that SNG-1 is localized to
synaptic regions (Nonet, 1999
). Thus far, no other C. elegans synaptogyrin family members have been identified.
We have identified two primary sequences in SNG-1 that are necessary for its synaptic localization, a C-terminal region containing 38 amino acids and an arginine in the loop facing the cytoplasm. An SNG-1 sequence containing these elements is sufficient to localize rat cellugyrin that is normally not restricted to synaptic regions in C. elegans. Furthermore, rat synaptogyrin is localized to synaptic regions in both C. elegans and hippocampal neurons in culture and the C terminus is necessary for synaptic localization in each system. Our results suggest that the mechanisms used for synaptic localization among synaptogyrin family members are evolutionarily conserved.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Nematode Strains and Culture
Bristol strain N2, mutants, and transgenic animals were grown at
22.5°C on solid medium as described by Sulston and Hodgkin (1988)
.
Microscopy and Image Analysis
Live animals were anesthetized with 10 mM sodium azide, mounted on 2% agarose pads, and examined under epifluorescence with the use of an Olympus BX60. Time-averaged images were collected with the use of a DAGE SIT68 camera and a CG-7 frame grabber (Scion Image). Confocal images were taken in a series of 0.5 µM optical sections with the use of an Olympus Fluoview microscope and Fluoview software. A three-dimensional representation of a 50-µm segment of sublateral ventral nerve cord just anterior to the posterior end point of the cord near the tail (boxed area in Figure 4B) was made for quantitative analysis. Total intensity in the boxed area was measured with the use of Fluoview software. Background fluorescence was subtracted as the average intensity of areas adjacent to the boxed region. Total intensity in puncta (closed circles in Figure 4B), which were defined as discrete bright fluorescent patches, was calculated by summing the intensity in each punctum. The percentage of fluorescence in puncta was calculated by dividing the total intensity in the puncta by the total intensity in the boxed area after background subtraction.
Immunocytochemistry
Immunocytochemistry with antibodies against synaptotagmin
(SNT-1) (Nonet et al., 1993
) and GFP (mouse monoclonal;
CLONTECH, Palo Alto, CA) was performed as described previously (Saifee
et al., 1998
). The polyclonal antibody against SNG-1 was
generated in chicken with a purified bacterial product representing
amino acids 164-248 fused to a his6 tag. The fusion product was
purified under denaturing conditions (8 M urea) with the use of Ni-NTA agarose (Qiagen, Chatsworth, CA), and dialyzed into phosphate-buffered saline. The resulting serum was then immunoabsorbed against the SNG-1
fusion protein bound to nitrocellulose as described by Smith and Fisher
(1984)
. Immunocytochemistry with an antibody against rat synaptophysin
(gift of P. De Camilli, Yale University, New Haven, CT) was performed
as previously described (Rao et al., 1998
).
Plasmid Construction
All deletions were made with the use of Pfu polymerase and DpnI
digestion as previously described (Fisher and Pei, 1997
). All
oligonucleotides listed below are 5' to 3'.
pSY1: Oligonucleotides TGAGTTGTATTGCATTCCAGATCTAG and GTCCGG ATCCATAAGCACGCACGTTC were used in a polymerase chain reaction (PCR) to amplify the sng-1 promoter, a 1.8-kb sequence upstream of the start codon. The PCR product was digested with BglII and BamHI, and was ligated with pPD95.69 digested with BamHI. A. Fire, J. Ahnn, G. Seydoux, and S. Xu kindly provided pPD95.69. Detailed description of pPD95.69 available at ftp.ciwemb.edu/PNF:byName:/FireLabWeb/FireLabInfo/FireLabVectors/1995_Vector_Kit/
pSY12: Oligonucleotides
CATTCTCAGATCTATGGAAGGGGG-TGCGTACGGAGC and
CATTACCGGTCCGTAGCCCTGCGACTGGTAGCCC corresponding to the beginning and
the end of the coding region of rat synaptogyrin were used in a PCR to
amplify the gene from pCMV-Sgyr, a clone containing rat synaptogyrin
cDNA (Stenius et al., 1995
). The PCR product was digested
with BglII and Age I, and was ligated with pSY1 digested
with BamHI and Age I.
pSY14: Oligonucleotides
CATTCTCAGATCTATGCCCTTGAGG-GTCGGCGGCG and
CATTACCGGTCCGTACACTGGGGGAGGCT-GGTAG corresponding to the beginning and the end of the coding region of rat cellugyrin were used
in a PCR to amplify the gene from pCMV-Cgyr, a clone containing the rat
cellugyrin cDNA (Janz and Südhof, 1998
). The PCR product was
digested with BglII and Age I, and was ligated with pSY1
digested with BamHI and Age I.
pSY17: Oligonucleotides CTTTTATTTTAGCATGCCCGCGGTT-TTGTTCAGG and
CCTGAACAAAACCGCGGGCATGCTAAAAT-AAAAG were designed to delete the region encoding amino acids 2-24 in pSY3, a clone containing the
sng-1 genomic DNA, including the coding region and the
promoter (Nonet, 1999
).
pSY18: Oligonucleotides GCATTTTTCGCATGGCGGCCGCTAGAAAAAATGAG and CTCATTTTTTCTAGCGGCCGCCATGCGA-AAAATGC were designed to delete the region encoding amino acids 173-248 in pSY3.
pSY26: Oligonucleotides GAAGATCTCGCCACCATGGAAGGG-GGTGCGTAC and CATTACCGGTCCGTAGCCCTGCGACTGGTAGCCC corresponding to the beginning and the end of the coding region of rat synaptogyrin were used in a PCR to amplify the gene from pCMV-Sgyr. The PCR product was digested with BglII and Age I, and was ligated with pEGFP (CLONTECH), a clone containing human CMV promoter and the EGFP gene, digested with the same enzymes.
pSY31: Oligonucleotides CGG GAT CCC CGT CGT TAC GAA GAA GG and CGA CCG GTC CAT AAC CAT ATC CTT CCG corresponding to the beginning and the end of the coding region of the C-terminal domain of SNG-1 were used to PCR from pSCG110a, a clone contain partial SNG-1 cDNA. The PCR product was digested with BamHI and Age I and was ligated with pSY14 digested with the same enzymes.
pSY36: Oligonucleotides GGAGGAGACTCAACCCGGGTACCGGTAG and CTACCGGTACCCGGGTTGAGTCTCCTCC were designed to delete the region encoding amino acids 211-248 in pSY3.
pSY39: Oligonucleotides CATTTTTCGCATGGATCGGACATGTTGG and CCAACATGTCCGATCCATGCGAAAAATG were designed to delete the region encoding amino acids 173-210 in pSY3.
pSY42: Oligonucleotides GCATTTTTCGCATGGCAAGTGTCGACAGAC and GTCTGTCGACACTTGCCATGCGAAAAATGC were designed to delete the region encoding amino acids 173-191 in pSY3.
pSY43: Oligonucleotides GATGAACATTTTGGACATGTTGGCGCACCT and AGGTGCGCCAACATGTCCAAAATGTTCATC were designed to delete the region encoding amino acids 192-210 in pSY3.
pSY44: Oligonucleotides GGAAATCAAGCAACTGGATACGGAGGAGAC and GTCTCCTCCGTATCCAGTTGCTTGATTTCC were designed to delete the region encoding amino acids 182-200 in pSY3.
pSY45: Oligonucleotides GATGAACATTTTGGACAAACCATGCAACAAC and GTTGTTGCATGGTTTGTCCAAAATGTTCATC were designed to delete the region encoding amino acids 191-229 in pSY3.
pSY46: Oligonucleotides CAGCGGTATCAGATTGGACCGGTC-G-CCACC and GGTGGCGACCGGTCCAATCTGATACCGCTG were designed to delete the region encoding amino acids 176-235 in pSY26.
pSY47:Oligonucleotides GCCGTGCTAGCCTTGGGACCGGTAG-TAAAAA and TTTTTCTACCGGTCCGAAGGCTAGCACGGC were designed to delete the region encoding amino acids 179-243 in pSY12.
pSY57: Oligonucleotides CTTTTATTTTAGCATGCCGCGGACAAGAAGGAGAGCTG and CAGCTCTCCTTCTTGTCCGCGGC-ATGCTAAAATAAAAG were designed to delete the region encoding amino acids 1-99 of SNG-1 in pSY3 and a SacII restriction site was engineered into the deletion site. The resulting plasmid is designated pSY54. Oligonucleotides CAGATAAGCAATGCCCCGCGGATGAGTAAAGGAGAAG and CTTCTCCTTTACTCATCCGCG-GGGCATTGCTTATCT were used to delete the region encoding amino acids 109-234 of cellugyrin in pSY14 and a SacII restriction site was engineered into the deletion site. The resulting plasmid is designated pSY53. A HindIII and SacII fragment from pSY54 was inserted into pSY53 digested with the same enzymes.
pSY59: Oligonucleotides GATCTCGCCACCATGACCATCCTGCGCGTC and GACGCGCAGGATGGTCATGGTGGCGAGATC were designed to delete the sequences encoding amino acids 2-26 in pSY26.
pSY60: Oligonucleotides GACGTGCAAGATGGTGCAGGAGCG-GGAGGAGACTCAACC and GGTTGAGTCTCCTCCCGCTCCTGCACCATCTTGCACGTC were designed to engineer the changes Y201A and Y203A in pSY3. Oligonucleotides CGCATGGCGTCGTGCAGAAGAAGGAAATC and GATTTCCTTCTTCTGCACGACG-CCATGCG were designed to engineer the change Y174A into the resulting plasmid.
pSY62: Oligonucleotides CCAACAAGAAGGGCAGCTGTCCTA-GCAGAT and ATCTGCTAGGACAGCTGCCCTTCTTGTTGG were designed to engineer the R104A change in pSY3.
Germline Transformation
Nematodes were transformed with the use of the method
described by Mello et al. (1991)
. Plasmids were injected at
5 ng/µl in conjunction with the dominant rol-6(su1003)
transformation marker (Kramer et al., 1990
) plasmid pRF4 at
140 ng/µl. Several independent transformed lines were obtained for
each construct examined.
Neuron Culture and Transfection
Hippocampal neuronal cultures were prepared as previously
described (Banker and Cowan, 1977
; Goslin and Banker, 1989
). After dissociation and before plating, neurons were transfected by a lipid-mediated gene transfer method with the use of the Effectene kit
(Qiagen). Approximately 5 × 105 cells were
incubated with 1 µg of DNA for 2h at 37°C in the presence of the
transfection reagents and were then plated onto coverslips in fresh
medium at a density of 18,000 cells/cm2. This
procedure resulted in a 0.01-0.05% transfection efficiency. Neurons
5-7 d old were fixed and immunostained with an antibody against synaptophysin.
| |
RESULTS |
|---|
|
|
|---|
Endogenous SNG-1 and GFP-tagged SNG-1 Are Localized to SVs in C. elegans
To assess the localization of endogenous SNG-1, an antibody was
raised against the C terminus of the protein. Immunostaining wild-type
animals with the use of this antibody revealed a typical localization
pattern observed for other SV proteins, including SNT-1, SNB-1
(synaptobrevin), and RAB-3 (Nonet et al., 1993
, 1997
, 1998
). Immunoreactivity was concentrated in nervous system regions rich
in synapses, including the nerve ring (Figure
1A), the dorsal nerve cord (Figure 1B)
and the ventral nerve cord (not shown). Discrete puncta were
found in the ventral and dorsal sublateral process bundles (Figure 1B;
our unpublished results). The SNG-1 protein also accumulated in the
presynaptic varicosities of SAB motor neurons innervating the
head muscle (Figure 1A). Finally, the endogenous protein was
undetectable in neuronal cell bodies, commissures that run
circumferentially along the body, and the dendrites of sensory neurons
in the nose. Wild-type animals double immunolabeled with antibodies
against SNG-1 and SNT-1 showed that native SNG-1 colocalized with SNT-1
(our unpublished results). Taken together, these results suggest that
endogenous SNG-1 is localized to SVs in C. elegans, although
localization to another membrane such as synaptic endosomes cannot be
excluded.
|
We next asked whether GFP-tagged SNG-1 fusion protein is localized like
the endogenous protein. jsIs219 animals harbor a GFP fusion
to the C terminus of sng-1 under the control of the
sng-1 promoter (SNG-1::GFP) stably integrated into
the genome (Nonet, 1999
). No behavioral defects have been
observed in jsIs219 animals. In jsIs219, the
pattern of GFP fluorescence observed was similar to the typical
localization pattern seen in immunolocalization experiments with
endogenous SNG-1, except that faint GFP fluorescence was detected in
the neuronal cell bodies in the head ganglia and the ventral nerve cord
(Figure 2B). Double staining
jsIs219 with antibodies against GFP (Figure 1, E and F) and
SNT-1 (Figure 1, C and D) revealed similar localization pattern in the
nerve ring, nerve cords, and the SAB axons. The merged images indicate
that SNG-1::GFP colocalizes with SNT-1 (Figure 1, G and H).
These results strongly suggest that SNG-1::GFP is localized
to SVs, similar to endogenous SNG-1.
|
An additional line of evidence supporting this conclusion is the
dependence of the synaptic localization of SNG-1::GFP on the
unc-104 gene. The unc-104 gene encodes a
kinesin-like molecule that is required for the axonal transport of SVs
(Hall and Hedgecock, 1991
; Otsuka et al., 1991
). Mutations
in this gene result in the accumulation of SVs in neuronal cell bodies
(Hall and Hedgecock, 1991
). SV proteins such as RAB-3, SNB-1, and SNT-1
all require unc-104 for synaptic localization (Nonet
et al., 1993
, 1997
, 1998
). In contrast, localization of
nonvesicular localized proteins such as SYD-2, RIM, UNC-11, and UNC-13
does not require unc-104 (Nonet et al., 1999
;
Zhen and Jin, 1999
; Kohn et al., 2000
; Hadwiger and Nonet,
unpublished observations). In unc-104(e1265) mutants, SNG-1::GFP was concentrated in neuronal cell bodies in both
the head ganglia and the ventral nerve cord (Figure 2, C and D). GFP fluorescence was greatly diminished in ventral axonal regions (Figure
2D) and absent from sublateral nerve cords, SAB axons and the dorsal
nerve cord (our unpublished results). This result demonstrates that
SNG-1::GFP localization requires the UNC-104 kinesin like
other SV proteins, suggesting that it is localized to SVs.
For the purposes of this study, any GFP fusion protein that is considered to be localized to SVs has the following features: 1) strong punctate signal along the nerve cords; 2) accumulation of GFP fluorescence in the nerve ring and presynaptic varicosities of SAB neurons with little process staining; 3) no signal in sensory dendrites in the nose and commissures along the body, and neuronal cell bodies undetectable or barely visible; and 4) a dependency of the localization pattern on the unc-104 gene.
SNG-1::GFP Localization Does Not Require Several Synaptic Proteins We Examined
Biochemical studies have revealed many protein-protein
interactions between different SV proteins (Bennett et al.,
1992
; Calakos and Scheller, 1994
; Galli et al., 1996
;
Schivell et al., 1996
). To assess whether localization of
SNG-1 is mediated by protein-protein interactions with other SV
protein(s), we examined SNG-1::GFP or native SNG-1
localization in mutants lacking distinct SV-associated proteins,
including RAB-3 and RBF-1 (rabphilin), SNB-1, and SNT-1 (Table
1; Nonet et al., 1993
, 1997
,
1998
; Staunton, Ganetzky, and Nonet, unpublished observations). In
these single mutant backgrounds, the localization of
SNG-1::GFP or native SNG-1 was indistinguishable from that in
jsIs219 or wild-type animals (our unpublished results). We
also determined whether SNG-1::GFP localization depends on unc-11 and aex-3 genes, which are required for
the localization of SNB-1 and RAB-3 in C. elegans,
respectively (Table 1; Iwasaki et al., 1997
; Nonet et
al., 1999
). The localization of SNG-1::GFP was not
affected by mutations in either gene. In addition, the gross
localization pattern of SNG-1::GFP was not affected by genes that have been implicated in SV endocytosis such as unc-26
and dpy-23 (Table 1; Harris et al., 2000
; Baum
and Garriga, personal communication). For all mutants analyzed, except
aex-3, null alleles were used to examine the localization of
SNG-1::GFP or native SNG-1. Thus, SNG-1::GFP/SNG-1
localization does not depend on the individual SV proteins considered,
suggesting that SNG-1 localization to synaptic regions might be
mediated by information in its own sequence.
|
A Synaptic Localization Signal Resides in C-Terminal Domain of SNG-1
The topology of rat synaptogyrin suggests that the N terminus, C
terminus, and the small loop between the second and the third transmembrane domain of SNG-1 reside in the cytoplasm (Stenius et
al., 1995
; Nonet, 1999
). Reasoning that the localization of SNG-1 might be mediated by interactions with cytoplasmic factors, we
deleted cytoplasmic domains of SNG-1 and assessed the ability of the
lesioned proteins to localize in vivo (Figure 4C). As shown in Figure
3, A and B, when the N terminus was
deleted, the localization of the mutated protein was similar to the
full-length protein. However, when the C terminus was deleted, the
pattern of GFP fluorescence was altered. SNG-1
(
173-248)::GFP decorated the entire cell in a
distribution likely to reflect localization to the plasma membrane. Fluorescence was observed in the sensory dendrites in the nose (Figure
3E) and in many commissures along the body (Figure 3F). Moreover,
fluorescence was more defuse and less punctate along neuronal processes
(Figure 3F). The fraction of GFP in the puncta of the ventral
sublateral cord was dramatically decreased and the process regions were
more clearly visible (Figures 3F and 4C). The process regions of SAB
neurons were also much brighter compared with those in
jsIs219 (our unpublished results). Finally, bright
fluorescence was seen in neuronal cell bodies along the ventral nerve
cord and in the head ganglia (Figure 3, E and F). These results suggest
that the C-terminal domain of SNG-1 is required for the correct
localization of SNG-1, whereas the N-terminal domain is dispensable.
|
To provide additional support that the C-terminal deletion localizes to
a cellular compartment distinct from SVs, we examined the localization
of the mutant proteins in a unc-104 background. The GFP
fluorescence pattern of the fusion protein lacking the N terminus in
unc-104(e1265) was similar to that of full-length SNG-1::GFP, namely, GFP accumulated in the neuronal cell
bodies of the ventral nerve cord and the head ganglia (Figure 3, C and D) and was absent from the dorsal nerve cord and the varicosities of
SAB neurons. In contrast, the C-terminal truncated protein showed a
similar distribution pattern in both an unc-104(e1265) and a
wild-type background (Figure 3, G-I). To eliminate the possibility that GFP is detached from the SNG-1(
173-248)::GFP
protein, an eight amino acid FLAG tag was placed at the N terminus of
the mutant protein
[FLAG::SNG-1(
173-248)::GFP]. An identical
distribution pattern of
FLAG::SNG-1(
173-248)::GFP was revealed by
antibodies directed against each of the FLAG and GFP tags (our
unpublished results), demonstrating that the fusion protein is intact
and the localization pattern of the epitopes reflects the distribution pattern of the fusion protein. Immunodetection of
FLAG::SNG-1::GFP with the use of both anti-FLAG and
anti-GFP showed that the FLAG tag had no effect on localization (our
unpublished results). Taken together, these data demonstrate that the
C-terminal region of SNG-1 is necessary for its localization to SVs.
Fine Mapping of Localization Signal within C Terminus of SNG-1
To further map the localization signal within the C-terminal
domain, we performed a systematic deletion analysis within the C
terminus. Figure 4C shows a schematic
diagram of the mutated regions. A quantitative approach was used to
determine the degree of in vivo synaptic localization of each mutated
protein (see MATERIALS AND METHODS). The percentage of the fluorescence
intensity in the puncta within a segment of the sublateral ventral cord just anterior of the tail was used as an index for synaptic
localization. The localization index of GFP alone was determined as a
control.
|
As shown in Figure 4C, when the whole C-terminal domain was deleted,
the localization index was dramatically decreased compared with the
full-length fusion protein. However, when amino acids 211-248 were
deleted, the localization index was unchanged. In contrast, when amino
acids 173-210 were deleted, the localization index was decreased
almost to the same extent as when the whole C-terminal domain was
deleted. Further division of this region led to partial localization.
These results were consistent with the distribution patterns observed
by fluorescence microscopy, indicating that the localization signal is
broadly distributed within amino acids 173-210 in the C terminus.
There are three tyrosines conserved between rat synaptogyrin and SNG-1
within this defined region (Figure 4A). We investigated the role of
these tyrosine residues in the localization of SNG-1 because such
tyrosine-based signals have been shown to mediate endocytosis (Davis
et al., 1986
, 1987
; Collawn et al., 1990
; Peters
et al., 1990
; Thies et al., 1990
; Letourneur and
Klausner, 1992
; Haucke and De Camilli, 1999
). The Y174A Y201A Y203A
triple mutant protein was partially mislocalized (Figure 4C). This
suggests that the three tyrosines in the C terminus play a role in
SNG-1 localization although they are not solely responsible for it. In
summary, our data are consistent with a role for the C terminus in
targeting SNG-1 for endocytosis from the plasma membrane. However, they
do not exclude a role of the C terminus in the sorting of SNG-1 to SV
precursors at the level of the trans-Golgi.
A Single Arginine in Small Cytoplasmic Loop Is Involved in Proper Localization of SNG-1
The cytoplasmic loop between transmembrane domain 2 and 3 of SNG-1
is well conserved among members of the synaptogyrin family (Figure 4A).
Because rat synaptogyrin and SNG-1 are localized in C. elegans (Figure 6), but rat cellugyrin is not (Figure
5), we focused our attention on
differences in this domain because they might identify a signal
regulating the selective targeting of synaptogyrin to SVs, rather than
to other transport vesicles. Specifically, we noted that a tyrosine in
cellugyrin that is substituted by a positively charged amino acid in
both synaptogyrin and SNG-1. Hence, we mutated the corresponding amino
acid, arginine, in SNG-1 to an alanine by site-directed mutagenesis. In
transgenic animals, R104A mutant SNG-1::GFP was partially
mislocalized. The fraction of GFP signal in synaptic puncta was
decreased (Figure 4C). In addition, GFP signal was retained in the
neuronal cell bodies and was present in the commissures and sensory
dendrites (Figure 5, K and L). Although this finding does not directly
address which sorting step is disrupted by this domain, our data
suggest that it plays a role in sorting synaptogyrin to SVs.
|
Cellugyrin-SNG-1 Chimera Is Localized to Synaptic Regions
We next assessed whether a region of SNG-1 containing the two
identified primary sequence motifs necessary for SNG-1 localization are
sufficient to localize rat cellugyrin to synaptic regions. GFP-tagged
full-length cellugyrin expressed in C. elegans under the
control of the sng-1 promoter showed a very different
localization pattern from SNG-1::GFP.
Cellugyrin::GFP accumulated in neuronal cell bodies of the
head ganglia and the ventral nerve cord (Figure 5B). GFP was also
distributed in the sensory dendrites in the nose and commissures
running circumferentially along the body (Figure 5, A and B). Along the
nerve cords and SAB axons, GFP was much less punctate (our unpublished
results). This distribution pattern was not affected by mutation in
unc-104 gene (Figure 5, C and D). These results demonstrate
that rat cellugyrin is not restricted to synaptic regions in C. elegans, which is consistent with its endogenous localization in
rat where it is excluded from SVs (Janz and Südhof, 1998
).
When the C-terminal domain of cellugyrin was replaced by the C-terminal domain of SNG-1, the localization pattern of the chimera was indistinguishable from cellugyrin alone (Figure 5, E and F). However, when a region of SNG-1 containing both the C terminus and the cytoplasmic loop was used to replace the corresponding region of cellugyrin, the chimera was localized to synaptic regions in a manner similar to SNG-1::GFP (Figure 5, G and H). The only difference between the two localization patterns was the slightly greater fluorescence intensity in neuronal cell bodies in animals expressing the cellugyrin::GFP chimera compared with animals expressing SNG-1::GFP (Figure 5H). Furthermore, in unc-104(e1265) background, the chimeric protein was accumulated in neuronal cell bodies (Figure 5, I and J). The GFP-tagged cellugyrin portion or the SNG-1 portion of the chimeric protein was not localized to synaptic regions by itself, instead, the fusion protein was accumulated in the neuronal cell bodies (not shown). These results suggest that the region of SNG-1 that contains the identified localization motifs is sufficient to localize cellugyrin to synaptic regions. This does not exclude the possibility that the third and fourth transmembrane domain and the second intravesicular loop of SNG-1 may aid in the localization of the chimera.
Mechanisms for Synaptogyrin Localization Are Evolutionarily Conserved
To determine whether mechanisms of synaptogyrin localization are
evolutionarily conserved, we assessed whether the localization signal(s) of rat synaptogyrin can be recognized in C. elegans. A GFP fusion to the C terminus of rat synaptogyrin was
expressed in a wild-type genetic background under the control of the
sng-1 promoter. In transgenic animals, GFP-tagged rat
synaptogyrin showed a punctate pattern along the major nerve cords and
the sublateral nerve cords (Figure 6A).
GFP was concentrated in the nerve ring and in the presynaptic
varicosities of SAB neurons (our unpublished results). In contrast, in
an unc-104(e1265) mutant background, fluorescence
accumulated in the cell bodies along the ventral nerve cord (Figure 6B)
and in the head ganglia (our unpublished results). Furthermore,
GFP-tagged rat synaptogyrin colocalized with native SNG-1 shown by
double immunostaining with the use of antibodies against GFP and SNG-1
(SNG-1 antibody did not cross-react with rat synaptogyrin) (Figure 6,
C-H). These results suggest that rat synaptogyrin is localized to
synaptic regions in C. elegans, indicating that the
localization signal(s) of rat synaptogyrin are recognized by the
C. elegans SNG-1 localization machinery. We next asked
whether the C terminus of rat synaptogyrin is necessary for its
localization in C. elegans. GFP-tagged synaptogyrin lacking the C terminus was expressed in wild-type animals. Fluorescence was
detected in neuronal cell bodies in the head ganglia and the sensory
dendrites in the nose (Figure 6, I and J), but not synaptic regions,
suggesting the C terminus of synaptogyrin is necessary for its
localization in C. elegans.
|
To determine whether rat synaptogyrin was localized similarly to other
SV proteins in mammalian neurons, we examined the localization of
synaptogyrin in hippocampal neurons. First, GFP was fused to the C
terminus of full-length synaptogyrin and the fusion gene was
transfected into cultured hippocampal primary neurons. Then 5- to
7-day-old neurons were fixed to preserve GFP fluorescence and stained
with an antibody against synaptophysin. Figure
7B shows that the full-length GFP-tagged
synaptogyrin exhibited a punctate pattern along the axonal process of
the hippocampal neuron, similar to the pattern observed by
anti-synaptophysin immunostaining (Figure 7, A and C). GFP was also
seen in neuronal cell bodies and dendritic processes, where it was
evenly distributed with no obvious puncta (our unpublished results).
This aberrant localization may be the result of overexpression of the
fusion protein. These results suggest that axonal GFP-tagged
synaptogyrin is largely localized to synaptic regions in hippocampal
neurons.
|
To identify whether the localization signals used by C. elegans SNG-1 and rat synaptogyrin were similar we examined the localization of GFP-tagged rat synaptogyrin lacking either the N- or C-terminal domain in cultured hippocampal neurons. Synaptogyrin lacking its N terminus (Figure 7, I-L) showed a distribution pattern similar to the full-length rat synaptogyrin (Figure 7, A-D), suggesting that the N-terminal domain is not required for its correct localization. However, when the C-terminal domain was deleted from rat synaptogyrin, GFP fluorescence was no longer punctate, but showed a diffuse pattern along the axonal processes of cultured hippocampal neurons (Figure 7, E and F). Furthermore, this mutant protein no longer colocalized with synaptophysin immunostaining (Figure 7G) because GFP was present in regions of processes where synaptophysin was absent (Figure 7H). This distribution pattern was similar as that of GFP alone expressed in hippocampal neurons (Figure 7, M-P). These results suggest that the C-terminal domain of synaptogyrin contains a targeting signal that is required for its synaptic localization in mammalian neurons.
| |
DISCUSSION |
|---|
|
|
|---|
We have identified the primary sequences that are required for the subcellular localization of both C. elegans and rat synaptogyrin. Synaptic localization of SNG-1 depends upon two sequence motifs located in the cytoplasmic loop separating the second and third transmembrane domains and in the C-terminal domain. These two domains may define signals required for targeting SNG-1 selectively to SVs and for selective endocytosis from the plasma membrane. These regions define bona fide localization signals because they are also sufficient, in the context of other SNG-1 sequences, to localize rat cellugyrin to synaptic regions in C. elegans. The C-terminal domain of rat synaptogyrin contains a similar targeting signal required for localization in hippocampal neurons. Indeed, the rat ortholog is appropriately localized in C. elegans and the analogous C-terminal region of rat synaptogyrin is required in this assay. These data suggest that the rat localization signal is recognized by the C. elegans trafficking machinery. Thus, the mechanisms for synaptogyrin localization appear to be evolutionarily conserved. These results represent the first set of experiments that define the localization signal of a SV integral membrane protein in a model organism with the use of an in vivo assay.
Caenorhabditis elegans as a Model System to Study Protein Targeting
The criteria we have used to examine localization of a SV protein in C. elegans differ considerably from criteria used for most prior studies in PC12 cells to define SV targeting signals. Our studies use primarily visual criteria to assess localization, whereas studies with the use of PC12 cells rely on biochemical fractionation. Due to the small size of C. elegans it is essentially impossible to separate the 2% of neuronal tissue in the C. elegans adult before biochemical fractionation. Our attempts to develop biochemical assays for localization have been severely hampered by this limitation. Despite the limitations, the availability of mutants permit us to examine the dependence of localization on specific trafficking components. For example, examination of the targeting behavior in unc-104 kinesin mutants acts as an indirect assay for sorting to preSVs. As the study of trafficking identifies genes essential for other trafficking steps, these assays will become a powerful tool in our analysis. Our extensive reliance on visual assays does limit the interpretation of some of our in vivo findings. Specifically, although N-terminal-deleted SNG-1 still targets to regions rich in synapses, it is possible that the protein is still absent from mature SVs, and instead accumulates in another vesicular structure in synaptic neuropil (such as synaptic endosomes). It is also difficult to assess in which cellular compartments our mistargeted SNG-1 mutants are accumulating.
Although our assays have limitations, they examine trafficking in
functioning neurons in an intact animal. In other studies, we have
observed significant differences between the role of targeting signals
in PC12 cells and in our in vivo assays. Specifically, we examined the
role of previously defined SV targeting signals of synaptobrevin (Grote
et al., 1995
). We introduced into the C. elegans
synaptobrevin gene two specific lesions (M46A and N49A), which altered
targeting of synaptobrevin in PC12 cells. Genomic clones containing
each lesion completely rescued the lethal phenotype of C. elegans synaptobrevin mutants and the mutant protein localized indistinguishably from wild-type (Wei and Nonet, unpublished
observations). These observations imply that the identified sequences
do not play as critical roles in synaptobrevin sorting in neurons in vivo. This dichotomy could be explained either by differences between
how PC12 cells and neurons sort synaptic proteins, or in differences
between synaptobrevin sorting mechanisms in vertebrates and
invertebrates. However, our data demonstrating the conservation of
synaptogyrin sorting signals through the metazoan lineage suggest that
differences between PC12 cells and neurons many be more significant than species differences.
Our in vivo observations also provide a framework within which to
interpret functional studies in PC12 cells. Previous experiments reported that C-terminal sequences adjacent to the transmembrane region
in rat synaptogyrin are required for its inhibitory effect on
Ca2+ dependent exocytosis in PC12 cells (Sugita
et al., 1999
). Our data suggest that deleting this region
probably disrupts protein localization; this in turn could indirectly
lead to the reported effects on exocytosis. Our system provides a
relatively simple method of examining the role of identified targeting
signals in vivo that complement biochemical studies with the use of
PC12 cells. Furthermore, in cases where mutants disrupting the gene encoding the protein of interest have been identified, the role of
these signals can also be assessed functionally.
The potential to saturate or alter sorting pathways as in response to
changes in expression levels of introduced genes is a difficult issue
to control for in both this system and in PC12 cells. However, we
believe it is unlikely that expression levels are significantly
affecting our assays. In C. elegans, expression levels in
transgenic animals are often manipulated by varying the ratio of input
experimental and marker DNAs (Mello and Fire, 1995
). The mutated SNG-1
constructs were injected at a DNA concentration several fold below
levels where wild-type SNG-1 protein remains localized
indistinguishably from the native protein (our unpublished results). In
addition, multiple transgenic lines were created for each construct we
examined, and several with similar expression levels behaved
identically. Finally, the fluorescent intensity did not vary
dramatically in animals expressing different mutant SNG-1 proteins.
Taken together, our data suggest that expression levels of the various
mutant SNG-1 proteins do not contribute significantly to their mislocalization.
Synaptic Localization Signals in Other Systems
Most of the studies of trafficking pathways of SV proteins have
examined the targeting of proteins to SLMVs in PC12 cells. Experimental
evidence suggests that SV protein sorting occurs by at least three
pathways at a number of distinct stages during the SV life cycle
(Calakos and Scheller, 1996
; Hannah et al., 1999
). SVs are
probably not formed directly by budding from the TGN; rather mature SVs
probably bud off from another membrane compartment. Experimental
evidence supports both the plasma membrane and endosomal intermediates
as the donor compartment (Regnier-Vigouroux et al., 1991
;
Bauerfeind and Huttner, 1993
). Pulse chase studies of synaptophysin
trafficking in PC12 cells suggest that synaptophysin is routed through
the plasma membrane before inclusion into SLMVs. This route is
apparently adaptor protein complex 2- (AP-2), clathrin-, and
dynamin-dependent and brefeldin A-insensitive (Takei et al., 1996
; Shupliakov et al., 1997
; Schmidt and Huttner, 1998
;
Shi et al., 1998
). In vitro studies have demonstrated that
SVs can be budded from the endosomal compartment with the use of AP-3 and the small GTPase ADP ribosylation factor 1 (Faundez et
al., 1997
, 1998
) as well as being brefeldin A-sensitive (Shi
et al., 1998
). However, AP-3
subunit mutants in mouse
are viable and contain an abundance of normal SVs, suggesting this is
not an obligate pathway (Kantheti et al., 1998
). In
addition, recent data have documented that a third route of SLMV
formation, from the late endosome, also exists in PC12 cells. In this
pathway, P-selectin passes through early and late endosomal
intermediates sequentially en route to both the lysosome and SLMVs
(Blagoveshchenskaya and Cutler, 2000
).
At least in neuroendocrine PC12 cells, different proteins use different
pathways to differing extents to traffic to the same destination
vesicle, the SLMV (Shi et al., 1998
; Blagoveshchenskaya et al., 1999a
,b
). This suggests that each SV protein
contains multiple signals that control the flux of the protein through more than one pathway. These signals may mediate different sorting steps at the TGN, plasma membrane, and early or late endosome. In
keeping with this idea multiple signal sequences have been found within
the cytoplasmic domain of synaptobrevin and synaptotagmin. In
neuroendocrine PC12 cells, a sorting signal of synaptobrevin consisting
of residues 41-50 probably functions at the plasma membrane because
its deletion prevented endocytosis and SLMV targeting (Grote et
al., 1995
; Grote and Kelly, 1996
). In contrast, residues 31-38 of
synaptobrevin are required at a sorting stage other than endocytosis at
the plasma membrane because a deletion mutant lacking these amino acids
was endocytosed normally but excluded from SLMV (Grote et
al., 1995
). Although these regions are within the amphipathic helix required for biochemically defined synaptobrevin functions (SNARE
complex formation), studies by Hao et al. (1997)
revealed little correlation between either endocytosis or SLMV targeting activity and complex formation activity. Furthermore, West et al. (1997)
showed that the cytoplasmic sequences of synaptobrevin were sufficient to target synaptobrevin to synaptic sites in
hippocampal cultures, but not into SVs, suggesting that the
transmembrane sequences may also contain targeting information.
Although multiple sorting motifs have been found in the C-terminal
domain of synaptotagmin, a detailed biochemical study is lacking that
would identify the precise steps in which they play an important role
(Blagoveshchenskaya et al., 1999
; Krasnov and
Enikolopov, 2000
).
SNG-1 Sorting Signals in C. elegans
In the C. elegans SNG-1 protein we have also found multiple elements that are required for its proper targeting, namely, a 38 amino acid element in the C-terminal domain and a single amino acid in the cytoplasmic loop. Mutations in these sequences could affect SNG-1 sorting at the TGN, plasma membrane, or endosomal compartments. We observe an accumulation of SNG-1 at the periphery of neuronal cell bodies, suggesting that these elements may be required for endocytosis at the plasma membrane. Lesioning the three tyrosines in the C-terminal targeting domain also resulted in accumulation of mutant protein in the periphery of the soma. Thus, one component of the signal may be a tyrosine-based endocytosis signal. In addition, the distribution of the mutant proteins is not significantly altered by a reduction in SV axonal transport caused by the unc-104 mutant, suggesting that SNG-1 lacking these elements is distributed to vesicles other than preSVs at the TGN. One simple model explaining the behavior of our mutants implicates two signals. First, a TGN signal targeting proteins to preSVs. In absence of this signal synaptogyrin traffics to the plasma membrane in the cell body. The protein accumulates in the plasma membrane rather than maturing via an endocytic pathway in the soma because of the absence of a second signal, perhaps tyrosine-based, which mediates an AP-2-dependent endocytosis. Although our data are consistent with this model, in absence of a clearer understanding of the cellular compartments where targeting mutants accumulate, it is difficult to eliminate many other consistent models.
What Can Diverse Sorting Signals Achieve?
The signal sequences identified in SNG-1 are unique and do not
share any obvious homology to other SV protein-sorting sequences. Other
sequences identified in other systems also do not show any similarity
to each other. This strongly supports the idea that no common primary
sequence motif serves as a universal SV targeting signal. What would be
the advantage of having each SV protein sorted with the use of distinct
targeting signals, instead of with the use of one common signal? First,
multiple signals may aid in regulating the stoichiometry of individual
proteins in the SV, a small organelle containing only a few molecules
of certain critical protein constituents. Therefore, achieving
vesicular homogeneity may require that SV formation be tightly
controlled at the single protein level. During the sorting process,
"adaptor" proteins that interact with multiple vesicle proteins
with the use of distinct targeting sequences could ensure a specific
protein stoichiometry in each vesicle. In contrast, if different
proteins compete with the use of the same targeting signal, the
relative stoichiometry may be more stochastic. Second, several
different types of related secretory vesicles are present in neurons
and secretory cells with unique, but related membrane protein
composition (Winkler, 1997
). These include peptide-containing dense
core secretory vesicles as well as zinc-containing vesicles
(Perez-Clausell and Danscher, 1985
). Multiple targeting signals may be
needed to target the same protein to different classes of related
vesicles. Finally, it may be beneficial for certain classes of vesicles
to be nonfunctional with respect to secretion until they reach their
final destination. Trafficking of distinct secretory vesicle components
to the synapse with the use of different pathways is one mechanism of
ensuring that preSVs are largely fusion incompetent.
How Is Sorting Achieved?
Identifying trans-acting factors that interact with
identified sorting signals is critical to understanding complex sorting processes that are likely to be dependent on both protein-protein and
protein-lipid interactions. We have used two approaches to attempt to
identify trans-acting factors. First, we have examined the
localization of SNG-1 in other mutants lacking specific SV proteins. In
particular, we examined the localization of SNG-1 in a synaptobrevin
mutant background. In vertebrates, synaptophysin (related to
synaptogyrin) interacts with synaptobrevin (Calakos and Scheller, 1994
;
Galli et al., 1996
), and formation of this complex
correlates with maturation of synapses (Becher et al., 1999
). In C. elegans, synaptogyrin localization was not
dependent upon synaptobrevin, nor on the presence of any other SV
protein we examined (Table 1). Although our experiments would not
detect interactions that are mediated by the synergistic action of
several SV proteins, they argue against a piggyback targeting mechanism for synaptogyrin. In a second attempt to identify other proteins that
aid in SNG-1 localization we carried out a yeast two-hybrid analysis
with the C termini of both SNG-1 and rat synaptogyrin, without success.
The focus of our current and future work is identifying mutants that
fail to efficiently target SNG-1::GFP with the use of
classical genetic mutant screens.
| |
ACKNOWLEDGMENTS |
|---|
We thank Anne Marie Craig, Huai-Yang Wu, and Kimberly Harms for providing hippocampal cultures and expertise regarding their manipulation; Dr. T. Südhof for providing cellugyrin and synaptogyrin cDNA clones; Dr. P. De Camilli for providing rat synaptogyrin antibody; and the Nonet and Salkoff labs for critical comments on the manuscript. The Caenorhabditis Genetic Center provided some strains used in this work. This work was funded by a grant from the U.S. Public Health Service.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: nonetm{at}thalamus.wustl.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Wang, E. O. Gracheva, J. Richmond, T. Kawano, J. M. Couto, J. A. Calarco, V. Vijayaratnam, Y. Jin, and M. Zhen The C2H2 zinc-finger protein SYD-9 is a putative posttranscriptional regulator for synaptic transmission PNAS, July 5, 2006; 103(27): 10450 - 10455. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Belfort, K. Bakirtzi, and K. V. Kandror Cellugyrin Induces Biogenesis of Synaptic-like Microvesicles in PC12 Cells J. Biol. Chem., February 25, 2005; 280(8): 7262 - 7272. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Koushika, A. M. Schaefer, R. Vincent, J. H. Willis, B. Bowerman, and M. L. Nonet Mutations in Caenorhabditis elegans Cytoplasmic Dynein Components Reveal Specificity of Neuronal Retrograde Cargo J. Neurosci., April 21, 2004; 24(16): 3907 - 3916. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ruvinsky and G. Ruvkun Functional tests of enhancer conservation between distantly related species Development, November 1, 2003; 130(21): 5133 - 5142. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||